MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-302M16
Chromosome	18 (Build37)
Map Location	35,485,699 - 35,485,942
singlet/doublet	singlet
Overlap gene	Sil1
Upstream gene	Srp19, Reep5, Pkd2l2, 2610024E20Rik, Wnt8a, Nme5, 4933408B17Rik, Brd8, Kif20a, Cdc23, Gfra3, Cdc25c, LOC100041859, 2810012G03Rik, LOC100041879, LOC100041887, Jmjd1b, Reep2, Egr1, Etf1, Hspa9, LOC100041377, EG626954, LOC100041951, Ctnna1, Lrrtm2
Downstream gene	LOC100041423, LOC666460, LOC666462, EG383341, EG436583, Matr3, Paip2, Slc23a1, 2010001M09Rik, Gm1614, 5133400G04Rik, Dnajc18, 1110006O17Rik, 1700066B19Rik, 2610307O08Rik, LOC666505, Ube2d2, Cxxc5, LOC100042131, Psd2, LOC100042150, LOC100041531, Pura
Link	Open Mouse BAC browser

Click to get alignment info.

name	Srp19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66384 MGI:1913634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Reep5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13476 MGI:1270152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkd2l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53871 MGI:1858231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610024E20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225358 MGI:2447834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20890 MGI:107924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nme5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75533 MGI:1922783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933408B17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271508 MGI:3045347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78656 MGI:1925906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif20a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19348 MGI:1201682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52563 MGI:1098815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14587 MGI:1201403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc25c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12532 MGI:88350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 873 ESTs, 5 Proteins

name	2810012G03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66306 MGI:1913556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041879 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC100041887 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 60 ESTs

name	Jmjd1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277250 MGI:1923356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Reep2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225362 MGI:2385070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Egr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13653 MGI:95295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225363 MGI:2385071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hspa9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15526 MGI:96245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041377 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	EG626954 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626954 MGI:3648052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 780 ESTs, 8 Proteins

name	LOC100041951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Ctnna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12385 MGI:88274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrtm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107065 MGI:2389174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sil1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81500 MGI:1932040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041423 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC666460 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins pseudo : _no_value

name	LOC666462 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	EG383341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383341 MGI:3648788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 16 Proteins

name	EG436583 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436583 MGI:3646921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Matr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17184 MGI:1298379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67869 MGI:1915119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc23a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20522 MGI:1341903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010001M09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69816 MGI:1917066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1614 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381148 MGI:2686460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 26 ESTs, 2 Proteins

name	5133400G04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71242 MGI:1918492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dnajc18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76594 MGI:1923844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110006O17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68545 MGI:1915795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700066B19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73449 MGI:1920699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610307O08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72512 MGI:1919762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 207 ESTs, 5 Proteins

name	LOC666505 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Ube2d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56550 MGI:1930715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cxxc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67393 MGI:1914643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042131 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Psd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74002 MGI:1921252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 9 Proteins

name	LOC100041531 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Pura (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19290 MGI:103079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srp19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365535 GeneID:66384 MGI:1913634
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal recognition particle 19 transcript_id : NM_025527.2

name	Reep5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542567 GeneID:13476 MGI:1270152
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor accessory protein 5 transcript_id : NM_007874.2

name	Pkd2l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350821 GeneID:53871 MGI:1858231
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycystic kidney disease 2-like 2 transcript_id : NM_016927.2

name	2610024E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122578 GeneID:225358 MGI:2447834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610024E20 gene transcript_id : NM_146084.1

name	Wnt8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678168 GeneID:20890 MGI:107924
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 8A transcript_id : NM_009290.1

name	Nme5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359743 GeneID:75533 MGI:1922783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed in non-metastatic cells 5 transcript_id : NM_080637.3

name	4933408B17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382686 GeneID:271508 MGI:3045347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933408B17 gene transcript_id : NM_177773.3

name	Brd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:69354973 GeneID:78656 MGI:1925906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 8 transcript_id : NM_030147.2

name	Kif20a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385767 GeneID:19348 MGI:1201682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 20A transcript_id : NM_009004.3

name	Cdc23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369947 GeneID:52563 MGI:1098815
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC23 (cell division cycle 23, yeast, homolog) transcript_id : NM_178347.3

name	Gfra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981761 GeneID:14587 MGI:1201403
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glial cell line derived neurotrophic factor family receptor alpha 3 transcript_id : NM_010280.2

name	Cdc25c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122114544 GeneID:12532 MGI:88350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 25 homolog C (S. pombe) transcript_id : NM_009860.2

name	LOC100041859 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269723 GeneID:100041859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 873 ESTs, 5 Proteins product : similar to ribosomal protein transcript_id : XM_001477476.1

name	2810012G03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129841 GeneID:66306 MGI:1913556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810012G03 gene transcript_id : NM_175104.4

name	LOC100041879 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269727 GeneID:100041879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100041879 transcript_id : XM_001477557.1

name	LOC100041887 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269729 GeneID:100041887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 60 ESTs product : hypothetical protein LOC100041887 transcript_id : XM_001477572.1

name	Jmjd1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486934 GeneID:277250 MGI:1923356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 1B transcript_id : NM_001081256.1

name	Reep2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450088 GeneID:225362 MGI:2385070
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor accessory protein 2 transcript_id : NM_144865.1

name	Egr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76559936 GeneID:13653 MGI:95295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : early growth response 1 transcript_id : NM_007913.5

name	Etf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286825 GeneID:225363 MGI:2385071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation termination factor 1 transcript_id : NM_144866.3

name	Hspa9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754255 GeneID:15526 MGI:96245
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein 9 transcript_id : NM_010481.1

name	LOC100041377 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269711 GeneID:100041377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100041377 transcript_id : XM_001476281.1

name	EG626954 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269735 GeneID:626954 MGI:3648052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 780 ESTs, 8 Proteins product : predicted gene, EG626954 transcript_id : XM_891577.3

name	LOC100041951 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269737 GeneID:100041951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041951 transcript_id : XM_001477645.1

name	Ctnna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753293 GeneID:12385 MGI:88274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catenin (cadherin associated protein), alpha 1 transcript_id : NM_009818.1

name	Lrrtm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802003 GeneID:107065 MGI:2389174
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat transmembrane neuronal 2 transcript_id : NM_178005.2

name	Sil1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13540506 GeneID:81500 MGI:1932040
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae) transcript_id : NM_030749.1

name	LOC100041423 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269714 GeneID:100041423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041423 transcript_id : XM_001476356.1

name	LOC666462 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94404369 GeneID:666462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical LOC666462 transcript_id : XM_984027.1

name	EG383341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269743 GeneID:383341 MGI:3648788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 16 Proteins product : predicted gene, EG383341 transcript_id : XM_356994.4

name	Matr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349909 GeneID:17184 MGI:1298379
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrin 3 transcript_id : NM_010771.4

name	Paip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372306 GeneID:67869 MGI:1915119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polyadenylate-binding protein-interacting protein 2 transcript_id : NM_026420.2

name	Slc23a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42741685 GeneID:20522 MGI:1341903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 23 (nucleobase transporters), member 1 transcript_id : NM_011397.3

name	2010001M09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803335 GeneID:69816 MGI:1917066
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010001M09 gene transcript_id : NM_027222.2

name	Gm1614 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269717 GeneID:381148 MGI:2686460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 26 ESTs, 2 Proteins product : gene model 1614, (NCBI) transcript_id : XM_891736.3

name	5133400G04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56961613 GeneID:71242 MGI:1918492
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5133400G04 gene transcript_id : NM_029485.1

name	5133400G04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803045 GeneID:71242 MGI:1918492
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5133400G04 gene transcript_id : NM_027733.4

name	Dnajc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377320 GeneID:76594 MGI:1923844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 18 transcript_id : NM_029669.3

name	1110006O17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75677529 GeneID:68545 MGI:1915795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110006O17 gene transcript_id : NM_001033141.1

name	1700066B19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388187 GeneID:73449 MGI:1920699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700066B19 gene transcript_id : NM_001033168.2

name	2610307O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94404341 GeneID:72512 MGI:1919762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 185 ESTs, 2 Proteins product : RIKEN cDNA 2610307O08 gene, transcript variant 6 transcript_id : XM_989707.1

name	2610307O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94404340 GeneID:72512 MGI:1919762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 199 ESTs, 3 Proteins product : RIKEN cDNA 2610307O08 gene, transcript variant 5 transcript_id : XM_900126.2

name	2610307O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94404338 GeneID:72512 MGI:1919762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 128 ESTs, 4 Proteins product : RIKEN cDNA 2610307O08 gene, transcript variant 2 transcript_id : XM_892499.2

name	2610307O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94404337 GeneID:72512 MGI:1919762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 124 ESTs, 3 Proteins product : RIKEN cDNA 2610307O08 gene, transcript variant 1 transcript_id : XM_128954.7

name	LOC666505 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269718 GeneID:666505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to hCG1640785 transcript_id : XM_984294.2

name	Ube2d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910599 GeneID:56550 MGI:1930715
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2D 2 transcript_id : NM_019912.1

name	Cxxc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59709446 GeneID:67393 MGI:1914643
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CXXC finger 5 transcript_id : NM_133687.2

name	LOC100042131 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269746 GeneID:100042131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100042131 transcript_id : XM_001477987.1

name	Psd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676386 GeneID:74002 MGI:1921252
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin and Sec7 domain containing 2 transcript_id : NM_028707.3

name	LOC100042150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269755 GeneID:100042150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 2 Proteins product : similar to NTAK alpha2, transcript variant 4 transcript_id : XM_001478044.1

name	LOC100042150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269749 GeneID:100042150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 4 Proteins product : similar to NTAK alpha2, transcript variant 1 transcript_id : XM_001478011.1

name	LOC100042150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269753 GeneID:100042150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 3 Proteins product : similar to NTAK alpha2, transcript variant 3 transcript_id : XM_001478031.1

name	LOC100042150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269751 GeneID:100042150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 3 Proteins product : similar to NTAK alpha2, transcript variant 2 transcript_id : XM_001478024.1

name	Pura (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358028 GeneID:19290 MGI:103079
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purine rich element binding protein A transcript_id : NM_008989.2

name	Srp19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384948 GeneID:66384 MGI:1913634
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005786 - signal recognition particle (sensu Eukaryota) [Evidence IEA] GO_function : GO:0008312 - 7S RNA binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : signal recognition particle 19 protein_id : NP_079803.1

name	Reep5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542568 GeneID:13476 MGI:1270152
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : receptor expression enhancing protein 5; deleted in polyposis 1 product : receptor accessory protein 5 protein_id : NP_031900.2

name	Pkd2l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393965 CCDS:CCDS29127.1 GeneID:53871 MGI:1858231
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Polycystin - L2 product : polycystic kidney disease 2-like 2 protein_id : NP_058623.1

name	2610024E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122579 CCDS:CCDS29128.1 GeneID:225358 MGI:2447834
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : expressed sequence AW060714 protein_id : NP_666196.1

name	Wnt8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678169 CCDS:CCDS29129.1 GeneID:20890 MGI:107924
definition	GO_function : GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : stimulated by retinoic acid gene 11; wingless-related MMTV integration site 8D product : wingless-related MMTV integration site 8A protein_id : NP_033316.1

name	Nme5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625839 CCDS:CCDS29130.1 GeneID:75533 MGI:1922783
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0000302 - response to reactive oxygen species [Evidence NAS]; GO:0007286 - spermatid development [Evidence IDA]; GO:0048515 - spermatid differentiation [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 product : expressed in non-metastatic cells 5 protein_id : NP_542368.2

name	4933408B17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244282 GeneID:271508 MGI:3045347
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC271508 protein_id : NP_808441.1

name	Brd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536234 GeneID:78656 MGI:1925906
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : bromodomain containing 8 protein_id : NP_084423.1

name	Kif20a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679597 CCDS:CCDS29131.1 GeneID:19348 MGI:1201682
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0051301 - cell division [Evidence IEA]; GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Rab6, kinesin-like; Rabkinesin-6 product : kinesin family member 20A protein_id : NP_033030.1

name	Cdc23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30387632 CCDS:CCDS29132.1 GeneID:52563 MGI:1098815
definition	GO_component : GO:0005680 - anaphase-promoting complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0030071 - regulation of mitotic metaphase/anaphase transition [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : CDC23 (cell division cycle 23, yeast, homolog) protein_id : NP_848124.1

name	Gfra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981762 CCDS:CCDS29133.1 GeneID:14587 MGI:1201403
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008046 - axon guidance receptor activity [Evidence IMP]; GO:0015026 - coreceptor activity [Evidence TAS]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007411 - axon guidance [Evidence IMP]; GO:0007422 - peripheral nervous system development [Evidence IMP]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence TAS] codon_start : 1 exception : mismatches in translation product : glial cell line derived neurotrophic factor family receptor alpha 3 protein_id : NP_034410.2

name	Cdc25c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122114545 GeneID:12532 MGI:88350
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000087 - M phase of mitotic cell cycle [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : cell division cycle control protein 25C; cell cycle phosphatase CDC25C product : cell division cycle 25 homolog C protein_id : NP_033990.2

name	LOC100041859 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269724 GeneID:100041859
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_001477526.1

name	LOC100041879 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269728 GeneID:100041879
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477607.1

name	2810012G03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424703 CCDS:CCDS29134.1 GeneID:66306 MGI:1913556
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : family 53, member C protein protein_id : NP_780313.1

name	LOC100041887 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269730 GeneID:100041887
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477622.1

name	Jmjd1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486935 GeneID:277250 MGI:1923356
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : jumonji domain containing 1B protein_id : NP_001074725.1

name	Reep2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54261730 CCDS:CCDS29135.1 GeneID:225362 MGI:2385070
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : receptor expression enhancing protein 2 protein_id : NP_659114.2

name	Egr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681285 CCDS:CCDS29136.1 GeneID:13653 MGI:95295
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IMP] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IMP]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0030217 - T cell differentiation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Krox-24 nuclear protein product : early growth response 1 protein_id : NP_031939.1

name	Etf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286826 CCDS:CCDS29137.1 GeneID:225363 MGI:2385071
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003747 - translation release factor activity [Evidence ISS]; GO:0016149 - translation release factor activity, codon specific [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006415 - translational termination [Evidence ISS] [Evidence IEA] codon_start : 1 product : eukaryotic translation termination factor 1 protein_id : NP_659115.3

name	Hspa9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754256 CCDS:CCDS29138.1 GeneID:15526 MGI:96245
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006611 - protein export from nucleus [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0009408 - response to heat [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 exception : mismatches in translation note : heat shock protein cognate 74; heat shock protein, 74 kDa, A; heat shock protein, A; C3H-specific antigen product : heat shock protein 9A protein_id : NP_034611.1

name	LOC100041377 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269712 GeneID:100041377
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476331.1

name	EG626954 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269736 GeneID:626954 MGI:3648052
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896670.2

name	LOC100041951 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269738 GeneID:100041951
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477695.1

name	Ctnna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753294 CCDS:CCDS29139.1 GeneID:12385 MGI:88274
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IEA]; GO:0005912 - adherens junction [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005915 - zonula adherens [Evidence IDA] GO_function : GO:0051015 - actin filament binding [Evidence IDA]; GO:0045296 - cadherin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : alpha E catenin; alpha(E)-catenin; cadherin associated protein product : catenin alpha 1 protein_id : NP_033948.1

name	Lrrtm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29725617 GeneID:107065 MGI:2389174
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : leucine-rich repeat transmembrane neuronal 2 protein protein_id : NP_821072.1

name	Sil1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13540507 CCDS:CCDS29140.1 GeneID:81500 MGI:1932040
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : ER chaperone and modulator of BiP product : endoplasmic reticulum chaperone SIL1 homolog protein_id : NP_109674.1

name	LOC100041423 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269715 GeneID:100041423
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476406.1

name	LOC666462 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94404370 GeneID:666462
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989121.1

name	EG383341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82996161 GeneID:383341 MGI:3648788
definition	codon_start : 1 product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1 protein_id : XP_356994.2

name	Matr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25141233 CCDS:CCDS29142.1 GeneID:17184 MGI:1298379
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : matrin 3 protein_id : NP_034901.2

name	Paip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385918 CCDS:CCDS29143.1 GeneID:67869 MGI:1915119
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA] codon_start : 1 note : Pabp-interacting protein 2 product : polyadenylate-binding protein-interacting protein 2 protein_id : NP_080696.1

name	Slc23a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42741686 CCDS:CCDS29144.1 GeneID:20522 MGI:1341903
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 23 (nucleobase transporters), member 2 product : solute carrier family 23 (nucleobase transporters), member 1 protein_id : NP_035527.3

name	2010001M09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312436 CCDS:CCDS29145.1 GeneID:69816 MGI:1917066
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69816 protein_id : NP_081498.1

name	Gm1614 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82996166 GeneID:381148 MGI:2686460
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896829.1

name	5133400G04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56961614 CCDS:CCDS29146.1 GeneID:71242 MGI:1918492
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; TATA-binding protein-like factor-interacting protein product : TATA-binding protein-like factor-interacting protein isoform 2 protein_id : NP_083761.1

name	5133400G04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56961629 CCDS:CCDS29147.1 GeneID:71242 MGI:1918492
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; TATA-binding protein-like factor-interacting protein product : TATA-binding protein-like factor-interacting protein isoform 1 protein_id : NP_082009.3

name	Dnajc18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313260 CCDS:CCDS29148.1 GeneID:76594 MGI:1923844
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : DnaJ (Hsp40) homolog, subfamily C, member 18 protein_id : NP_083945.1

name	1110006O17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677530 GeneID:68545 MGI:1915795
definition	codon_start : 1 product : hypothetical protein LOC68545 protein_id : NP_001028313.1

name	1700066B19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701682 GeneID:73449 MGI:1920699
definition	codon_start : 1 product : hypothetical protein LOC73449 protein_id : NP_001028340.1

name	2610307O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82995953 GeneID:72512 MGI:1919762
definition	codon_start : 1 product : hypothetical protein LOC72512 isoform 2 protein_id : XP_897592.1

name	2610307O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38083636 GeneID:72512 MGI:1919762
definition	codon_start : 1 product : hypothetical protein LOC72512 isoform 1 protein_id : XP_128954.2

name	2610307O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94404342 GeneID:72512 MGI:1919762
definition	codon_start : 1 product : hypothetical protein LOC72512 isoform 6 protein_id : XP_994801.1

name	2610307O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82995950 GeneID:72512 MGI:1919762
definition	codon_start : 1 product : hypothetical protein LOC72512 isoform 5 protein_id : XP_905219.1

name	LOC666505 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269719 GeneID:666505
definition	codon_start : 1 product : similar to hCG1640785 protein_id : XP_989388.2

name	Ube2d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910600 GeneID:56550 MGI:1930715
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : ubiquitin conjugating enzyme 2e product : ubiquitin-conjugating enzyme E2D 2 protein_id : NP_064296.1

name	Cxxc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526854 CCDS:CCDS29150.1 GeneID:67393 MGI:1914643
definition	codon_start : 1 product : CXXC finger 5 protein_id : NP_598448.1

name	LOC100042131 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269747 GeneID:100042131
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478037.1

name	Psd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676387 GeneID:74002 MGI:1921252
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 product : pleckstrin and Sec7 domain containing 2 protein_id : NP_082983.3

name	LOC100042150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269756 GeneID:100042150
definition	codon_start : 1 product : similar to NTAK alpha2 isoform 4 protein_id : XP_001478094.1

name	LOC100042150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269750 GeneID:100042150
definition	codon_start : 1 product : similar to NTAK alpha2 isoform 1 protein_id : XP_001478061.1

name	LOC100042150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269754 GeneID:100042150
definition	codon_start : 1 product : similar to NTAK alpha2 isoform 3 protein_id : XP_001478081.1

name	LOC100042150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269752 GeneID:100042150
definition	codon_start : 1 product : similar to NTAK alpha2 isoform 2 protein_id : XP_001478074.1

name	Pura (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679573 CCDS:CCDS29151.1 GeneID:19290 MGI:103079
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005662 - DNA replication factor A complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003690 - double-stranded DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003697 - single-stranded DNA binding [Evidence IDA]; GO:0046332 - SMAD binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence NAS]; GO:0030154 - cell differentiation [Evidence NAS]; GO:0008283 - cell proliferation [Evidence NAS]; GO:0031575 - G1/S transition checkpoint [Evidence NAS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007399 - nervous system development [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] citation : [PUBMED 93078769] citation : [PUBMED 95047494] codon_start : 1 function : sequence-specific single-stranded DNA-binding protein note : Pur alpha product : purine rich element binding protein A protein_id : NP_033015.1

name	LOC100041531 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041531
definition	number : 2 pseudo : _no_value

name	LOC100041531 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041531
definition	number : 1 pseudo : _no_value

name	LOC666460 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149269716 GeneID:666460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins product : similar to Ac2-008 pseudo : _no_value transcript_id : XR_032703.1

name	EG436583 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:142382261 GeneID:436583 MGI:3646921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG436583 transcript_id : NR_002905.2

clone name	MSMg01-326M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121F22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-302M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542K17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-375F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158N01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-328P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284I13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-302M16.T7 (MSMg01no302_m16.b1)	MSMg01-302M16.TJ (MSMg01no302_m16.g1)
ACC	AG428582	AG428583
length	723	803
length of high quality (start - end)	244 (436 - 679)	48 (77 - 124)
definition	CHROMAT_FILE: MSMg01no302_m16.b1 PHD_FILE: MSMg01no302_m16.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:40:31 2005	CHROMAT_FILE: MSMg01no302_m16.g1 PHD_FILE: MSMg01no302_m16.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:40:31 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	CTCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGG AATTCACTTGTTCTTTGCTATTAAAGGTCTTACTACATAGCGCTGGCTGT CCTGGAACTCACTATATTGACCCCGCTGACCTTGAACTCACAGAGATCCT CCTGAGAGGTCATGTGTTTGTTGTTTCTATTGTTCCCTGGCTCTAAGAAG TGACTTAGCCTTTCCAGACCTCTTTGTTGGCTTTGTTTACCATCCAGACT GCTCTACCTGAGACTTGCAAGAGCATTTCGCGGGGTTTTAGTCCAAGAAG AAGAGTGGTACCTCCTAGATGTGATAGCTTTGATGGAGCATCTTTTTAAA AGGAGGGTGATTTATTCTCTTCCCCCCCACCCCTCTATAGAATCCTTATA CCAGGGAGAGAAACCATAGGTAATAGATGAATAATTTGGAGCTGACAACT GCTCATCATCCTGCTTTTTATAAATGCCCATGCCTTTTAATTTTTCTTGT AAGATAGATACATAAACTACTGTAACCTTTCAGACTCTCCTTATAAGCAC TATCCACTAAAATGGGAAGAAAGTGGAGTGCCACATGTATAAAATACCCA ATTAAAGTCTTTTATTCACCTCCAACATAATTTCATTTTAAAGATTTTTA TACGTGTGTGTGGGGTAGGGAGGACTGAGAGAAATTGTTTTGAGATTTGA GTATAGTACATACAGTAATTTAG	CAATGACXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXATAGCCAGCCTAAGATACATCCTG GGTTATATGAGACACTGGGGTTGTCCGGGTGGGGGTGGNNNNNNNNNNNN NNNNNNNNNNNNNNNGNNNNNNNNNNGNAAANNNNNGTNNNNGTTTATAA ATATCAATAATTAAATTAAATAAATTTATATATAATTAAAATAATATATT TTTTAAATTTTAATAAATAAAAATAATATTTATAAATATAAAAAAAAAAA TAAAAAAATAAAAAAATTTTTTTTTTAAAAAAAAAAGAAAAAAAAAAAAA AAATTTTAAAGTAGCTCCAGAAAACAAATTCCCCATTTATTTATTTTTAT TTTGTTTTGTTGTGGTTTCCCCCCAAAAAAACTTATCCAAAAAAATTTTC GCGGCGGGGGCCCGTCCTTTCTATACAACACAACACATCTATAAACACCT CCACAAATCCTTCACCCCTCACACTTACTACTCAACAACAAACACCCCCA TCACCCCCCACACAATCCCATAATTCCCCCACCCACTTCCACACATTAAC CTTATCTCCTTAAACTACTACACATTCCCCCTATATTACTCCCCAATCCT TTTATTTCCCCCACATAACAACATTTAACACCACAACTCCATTCATACCC CTATTCCCTCCCCCCCCCTTTATTATTATTACTCTAAACTTATCCACACC CTAACCACACCTCTCTTTATTAATCCTATATCCCTCACCATTTCTCCTAT TAN
quality values	Open. Hide. 6 6 8 8 17 12 11 15 19 37 37 33 32 32 28 21 19 10 9 9 21 21 39 48 48 31 29 32 32 28 35 37 37 30 30 30 39 40 44 57 42 42 36 36 36 42 59 57 57 47 47 47 37 50 50 36 36 38 59 59 48 59 47 43 39 39 39 28 21 8 8 6 6 8 19 21 47 47 50 50 50 50 53 53 53 53 53 53 53 57 57 59 59 59 57 57 57 57 57 59 59 59 59 59 57 53 53 44 44 39 37 37 26 31 15 15 12 11 11 15 23 12 12 11 16 22 34 43 47 50 50 50 50 53 47 50 38 53 53 53 53 53 50 50 50 53 53 53 53 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 42 24 24 23 23 36 35 28 28 31 31 59 59 59 68 57 57 57 57 57 59 59 59 59 59 59 59 59 57 57 57 57 53 53 59 59 59 59 59 24 22 11 12 11 8 11 6 6 6 8 8 8 10 11 11 12 12 9 11 9 8 8 8 8 8 8 8 8 8 19 27 41 41 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 57 50 68 68 68 68 48 59 46 43 43 46 59 41 41 15 15 11 15 15 20 17 14 14 18 18 18 25 21 34 44 59 59 59 44 44 35 35 30 42 42 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 57 57 68 68 68 68 68 68 68 57 59 59 59 59 59 59 59 57 57 57 57 57 57 57 59 59 68 68 68 57 57 57 57 59 59 68 68 68 68 68 59 59 57 57 54 59 59 68 68 68 68 57 57 50 48 48 48 48 48 57 59 59 57 48 48 59 48 48 48 48 48 50 50 47 47 47 41 41 41 37 37 41 43 43 41 46 46 46 48 59 59 59 48 59 57 57 47 42 42 42 39 39 43 43 43 46 46 48 47 41 41 39 39 34 34 20 20 23 34 34 34 24 22 22 30 34 41 32 32 39 30 30 24 24 24 34 34 37 37 41 37 37 37 39 39 47 57 57 48 43 47 43 43 46 46 46 41 43 43 41 37 37 32 37 37 30 26 26 35 35 27 29 32 37 24 25 13 17 17 19 13 19 12 9 9 11 15 25 30 34 34 11 11 10 10 10 15 29 32 37 31 28 26 15 12 10 10 16 16 11 13 11 17 15 15 15 19 17 26 24 14 14	Open. Hide. 18 18 14 9 9 9 14 9 9 11 12 18 11 11 11 12 15 30 29 37 47 50 50 50 50 50 50 57 57 53 53 53 48 28 28 19 18 11 14 9 21 21 37 19 23 9 9 23 23 32 39 46 34 53 48 27 27 15 15 20 34 21 21 10 15 15 14 20 24 32 27 50 50 48 50 50 48 48 41 41 41 48 42 42 42 57 41 41 17 17 17 35 35 53 50 50 43 44 44 54 59 57 48 59 59 43 43 19 19 13 12 12 34 34 43 37 32 28 20 20 16 12 8 8 10 8 8 18 11 13 18 26 18 18 15 16 9 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 3 0 3 20 3 0 0 0 0 0 3 3 0 0 0 0 3 6 9 8 10 10 8 8 8 8 10 14 21 15 8 8 8 8 8 8 8 10 10 10 11 10 15 15 8 8 8 8 6 6 7 7 7 6 8 6 6 8 8 8 6 6 8 8 8 8 8 8 8 6 6 8 10 10 13 13 18 18 11 11 12 12 10 10 8 8 8 8 8 8 8 8 8 8 14 14 14 16 11 7 8 6 6 8 6 6 8 6 8 8 8 8 8 8 8 8 10 15 21 13 13 13 14 10 8 8 8 8 10 8 8 8 8 13 8 9 9 10 10 10 9 10 9 15 21 10 10 8 9 10 9 9 22 22 22 22 11 10 10 9 9 9 10 10 10 10 23 25 19 14 13 10 10 9 17 10 10 12 10 12 8 8 9 3 3 3 3 3 3 8 8 7 3 3 3 7 6 6 6 6 6 9 9 11 10 8 8 6 8 8 15 17 8 8 8 11 12 12 11 11 11 11 12 11 23 18 11 11 9 10 8 8 6 8 6 6 6 6 9 10 15 12 29 35 23 23 15 11 12 14 21 22 14 11 8 7 7 7 8 9 11 11 11 21 16 16 9 8 8 8 12 8 8 8 8 8 8 8 8 8 10 10 12 10 8 8 8 8 8 8 11 11 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 6 6 8 8 8 8 8 10 10 8 8 8 8 10 9 8 8 8 8 8 8 8 8 8 8 9 9 12 11 11 11 11 11 9 10 8 8 8 8 10 9 10 15 12 9 8 8 8 8 8 8 8 8 10 10 8 8 8 8 10 9 9 14 12 15 10 8 8 8 10 9 19 13 13 13 8 9 9 9 9 9 11 11 11 9 9 9 10 8 8 8 8 8 8 8 11 10 10 11 8 8 8 8 8 8 11 11 10 10 9 9 8 8 8 8 8 8 6 6 6 6 8 8 8 8 8 8 8 8 8 8 9 8 8 8 8 8 8 8 11 16 10 10 10 11 8 8 8 8 8 8 8 8 9 10 10 10 10 15 10 10 10 9 9 9 9 9 10 15 12 11 11 11 10 10 10 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 11 12 10 10 10 10 9 8 8 6 6 6 6 8 8 8 10 8 8 9 9 9 10 10 8 8 8 8 10 10 10 10 10 10 10 9 9 10 9 15 9 10 10 10 10 10 10 10 9 10 8 8 8 8 9 8 11 11 11 11 10 9 9 8 8 8 8 8 8 11 11 11 11 9 8 8 8 8 8 8 9 8 8 6 6 6 8 15 13 17 14 11 13 11 11 11 11 10 9 8 8 8 6 6 8 8 8 8 10 8 9 8 8 8 8 8 8 10 11 11 12 11 9 10 10 8 8 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no302_m16.b1 MSMg01no302_m16.b1 CHROMAT_FILE:
MSMg01no302_m16.b1 PHD_FILE: MSMg01no302_m16.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 21:40:31 2005
         (244 letters)



>mm_chr18_35485499_35486142
          Length = 644

 Score =  472 bits (244), Expect = e-138
 Identities = 244/244 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   ttggagctgacaactgctcatcatcctgctttttataaatgcccatgccttttaattttt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 444 ttggagctgacaactgctcatcatcctgctttttataaatgcccatgccttttaattttt 385

                                                                       
Query: 61  cttgtaagatagatacataaactactgtaacctttcagactctccttataagcactatcc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 384 cttgtaagatagatacataaactactgtaacctttcagactctccttataagcactatcc 325

                                                                       
Query: 121 actaaaatgggaagaaagtggagtgccacatgtataaaatacccaattaaagtcttttat 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 324 actaaaatgggaagaaagtggagtgccacatgtataaaatacccaattaaagtcttttat 265

                                                                       
Query: 181 tcacctccaacataatttcattttaaagatttttatacgtgtgtgtggggtagggaggac 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 264 tcacctccaacataatttcattttaaagatttttatacgtgtgtgtggggtagggaggac 205

               
Query: 241 tgag 244
           ||||
Sbjct: 204 tgag 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 11
Number of extensions: 2
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 244
Length of database: 644
Length adjustment: 9
Effective length of query: 235
Effective length of database: 635
Effective search space:   149225
Effective search space used:   149225
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information