MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-525B12
Chromosome	18 (Build37)
Map Location	38,658,096 - 38,658,630
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Pcdhb19, Pcdhb20, Pcdhb21, Pcdhb22, Slc25a2, Taf7, EG666693, Pcdhg@, Pcdhga1, Pcdhga2, Pcdhga3, Pcdhgb1, Pcdhga4, Pcdhgb2, Pcdhga5, Pcdhga6, Pcdhga7, Pcdhgb4, Pcdhga8, Pcdhgb5, Pcdhga9, Pcdhgb6, Pcdhga10, Pcdhgb7, Pcdhga11, Pcdhgb8, Pcdhga12, Pcdhgc3, Pcdhgc4, Pcdhgc5, Diap1, Hdac3, 4631403P03Rik, Fchsd1, Centd3, Pcdh1, LOC100042583, 1700086O06Rik, 0610009O20Rik, Pcdh12, Rnf14, Gnpda1, LOC240219, LOC100041839, Ndfip1
Downstream gene	Spry4, 9630014M24Rik, LOC100041865, LOC100041875, LOC100042671, LOC666809, LOC100041894, Fgf1, EG545253, Arhgap26, Nr3c1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pcdhb19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93890 MGI:2136757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93891 MGI:2136758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93892 MGI:2136759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93893 MGI:2136760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83885 MGI:2137907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 9 Proteins

name	Taf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24074 MGI:1346348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG666693 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666693 MGI:3647216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins pseudo : _no_value

name	Pcdhg@ (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 22 mRNAs

name	Pcdhga1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93709 MGI:1935212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93710 MGI:1935214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93711 MGI:1935215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93699 MGI:1935169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93712 MGI:1935216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93700 MGI:1935170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93713 MGI:1935217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93714 MGI:1935218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93715 MGI:1935219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93701 MGI:1935173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93716 MGI:1935221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93702 MGI:1935196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93717 MGI:1935226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93703 MGI:1935197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93722 MGI:1935227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93704 MGI:1935199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93723 MGI:1935228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93705 MGI:1935200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93724 MGI:1935229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93706 MGI:1935201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93707 MGI:1935203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93708 MGI:1935205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Diap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13367 MGI:1194490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15183 MGI:1343091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4631403P03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225392 MGI:1918044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fchsd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319262 MGI:2441771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Centd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106952 MGI:2147274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75599 MGI:104692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042583 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 914 ESTs, 9 Proteins

name	1700086O06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73516 MGI:1920766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	0610009O20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66839 MGI:1914089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdh12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53601 MGI:1855700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56736 MGI:1929668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnpda1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26384 MGI:1347054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC240219 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:240219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 12 Proteins

name	LOC100041839 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Ndfip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65113 MGI:1929601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spry4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24066 MGI:1345144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9630014M24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381155 MGI:3588234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100041865 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041875 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 84 ESTs

name	LOC100042671 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC666809 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100041894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Fgf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14164 MGI:95515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545253 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545253 MGI:3646292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71302 MGI:1918552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr3c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14815 MGI:95824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89363033 GeneID:93890 MGI:2136757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 19 transcript_id : NM_053144.2

name	Pcdhb20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89994746 GeneID:93891 MGI:2136758
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 20 transcript_id : NM_053145.2

name	Pcdhb21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872174 GeneID:93892 MGI:2136759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 21 transcript_id : NM_053146.2

name	Pcdhb22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189395 GeneID:93893 MGI:2136760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 22 transcript_id : NM_053147.2

name	Slc25a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269721 GeneID:83885 MGI:2137907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 9 Proteins product : solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 2 transcript_id : XM_111757.7

name	Taf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348602 GeneID:24074 MGI:1346348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_175770.3

name	Taf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755711 GeneID:24074 MGI:1346348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_011901.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087752 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033584.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087754 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033585.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:40254132 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033586.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:34328336 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033574.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:31982597 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033587.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142380298 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033575.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142378127 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033588.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087762 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033589.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130765 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033590.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087736 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033576.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130786 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033591.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087738 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033577.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130792 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033592.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130767 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033578.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:31982599 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033593.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087742 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033579.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:40538828 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033594.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087744 GeneID:192682
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033580.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130793 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033595.4

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130764 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033581.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:40789290 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033582.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130787 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033583.3

name	Diap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131108 GeneID:13367 MGI:1194490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diaphanous homolog 1 (Drosophila) transcript_id : NM_007858.2

name	Hdac3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89257351 GeneID:15183 MGI:1343091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 3 transcript_id : NM_010411.2

name	4631403P03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418898 GeneID:225392 MGI:1918044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4631403P03 gene transcript_id : NM_153793.1

name	Fchsd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130311 GeneID:319262 MGI:2441771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FCH and double SH3 domains 1 transcript_id : NM_175684.4

name	Centd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27885014 GeneID:106952 MGI:2147274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, delta 3 transcript_id : NM_139206.1

name	Pcdh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130604 GeneID:75599 MGI:104692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin 1 transcript_id : NM_029357.3

name	LOC100042583 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269776 GeneID:100042583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 914 ESTs, 9 Proteins product : similar to Rpl17 protein transcript_id : XM_001478844.1

name	1700086O06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269778 GeneID:73516 MGI:1920766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : RIKEN cDNA 1700086O06 gene transcript_id : XM_001478852.1

name	0610009O20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383028 GeneID:66839 MGI:1914089
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610009O20 gene transcript_id : NM_024179.4

name	Pcdh12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444907 GeneID:53601 MGI:1855700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin 12 transcript_id : NM_017378.2

name	Rnf14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910591 GeneID:56736 MGI:1929668
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 14 transcript_id : NM_020012.1

name	Gnpda1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754029 GeneID:26384 MGI:1347054
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosamine-6-phosphate deaminase 1 transcript_id : NM_011937.1

name	LOC240219 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269781 GeneID:240219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 12 Proteins product : similar to glutamine synthetase transcript_id : XM_001478918.1

name	Ndfip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89001090 GeneID:65113 MGI:1929601
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Nedd4 family interacting protein 1 transcript_id : NM_022996.1

name	Spry4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543766 GeneID:24066 MGI:1345144
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sprouty homolog 4 (Drosophila) transcript_id : NM_011898.2

name	LOC100041875 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269725 GeneID:100041875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 84 ESTs product : hypothetical protein LOC100041875 transcript_id : XM_001477150.1

name	LOC100041894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269731 GeneID:100041894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical protein LOC100041894 transcript_id : XM_001477178.1

name	Fgf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937366 GeneID:14164 MGI:95515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 1 transcript_id : NM_010197.3

name	EG545253 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702102 GeneID:545253 MGI:3646292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545253 transcript_id : NM_001033789.1

name	Arhgap26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87159825 GeneID:71302 MGI:1918552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 26 transcript_id : NM_175164.4

name	Nr3c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121247452 GeneID:14815 MGI:95824
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 3, group C, member 1 transcript_id : NM_008173.3

name	Pcdhb19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89363034 CCDS:CCDS29185.1 GeneID:93890 MGI:2136757
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 19 protein_id : NP_444374.2

name	Pcdhb20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89994747 GeneID:93891 MGI:2136758
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 20 protein_id : NP_444375.2

name	Pcdhb21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087803 CCDS:CCDS29186.1 GeneID:93892 MGI:2136759
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 21 protein_id : NP_444376.1

name	Pcdhb22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189396 CCDS:CCDS29187.1 GeneID:93893 MGI:2136760
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin beta 22 protein_id : NP_444377.2

name	Slc25a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269722 GeneID:83885 MGI:2137907
definition	codon_start : 1 product : mutant ornithine transporter 2 protein_id : XP_111757.4

name	Taf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755712 CCDS:CCDS29189.1 GeneID:24074 MGI:1346348
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence ISS] [Evidence IDA] GO_function : GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030520 - estrogen receptor signaling pathway [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : TATA box binding protein (TBP) associated factor, RNA polymerase II, F, 55 kDa; TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55 kDa product : TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_036031.1

name	Taf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28461141 CCDS:CCDS29189.1 GeneID:24074 MGI:1346348
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence ISS] [Evidence IDA] GO_function : GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030520 - estrogen receptor signaling pathway [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : TATA box binding protein (TBP) associated factor, RNA polymerase II, F, 55 kDa; TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55 kDa product : TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_786964.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087753 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 1 protein_id : NP_291062.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087755 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 2 protein_id : NP_291063.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087757 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 3 protein_id : NP_291064.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:34328337 GeneID:192682
definition	GO_component : GO:0030426 - growth cone [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin gamma subfamily B, 1 protein_id : NP_291052.2

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:31982598 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin gamma subfamily A, 4 protein_id : NP_291065.2

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087735 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : 3' RACE product; protocadherin gamma B2 product : protocadherin gamma subfamily B, 2 protein_id : NP_291053.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087761 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 5 protein_id : NP_291066.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087763 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 6 protein_id : NP_291067.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:50878294 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 7 protein_id : NP_291068.2

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087737 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : protocadherin gamma C-VI product : protocadherin gamma subfamily B, 4 protein_id : NP_291054.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087767 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 8 protein_id : NP_291069.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087739 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily B, 5 protein_id : NP_291055.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087769 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 9 protein_id : NP_291070.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087741 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily B, 6 protein_id : NP_291056.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087771 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 10 protein_id : NP_291071.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087743 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily B, 7 protein_id : NP_291057.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087773 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 11 protein_id : NP_291072.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087745 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : protocadherin gamma subfamily B, 8 protein_id : NP_291058.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087775 CCDS:CCDS29191.1 GeneID:192682
definition	GO_component : GO:0005911 - intercellular junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence ISS]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : protocadherin 13; protocadherin gamma A12; protocadherin gamma B6 product : protocadherin gamma subfamily A, 12 protein_id : NP_291073.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087747 CCDS:CCDS29192.1 GeneID:192682
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0005911 - intercellular junction [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence TAS]; GO:0007156 - homophilic cell adhesion [Evidence TAS] codon_start : 1 note : protocadherin 2 product : protocadherin gamma subfamily C, 3 protein_id : NP_291059.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087749 CCDS:CCDS29193.1 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily C, 4 protein_id : NP_291060.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087751 CCDS:CCDS29194.1 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily C, 5 protein_id : NP_291061.1

name	Diap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681183 GeneID:13367 MGI:1194490
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017048 - Rho GTPase binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0030041 - actin filament polymerization [Evidence IDA]; GO:0016043 - cell organization and biogenesis [Evidence IEA] codon_start : 1 product : diaphanous homolog 1 protein_id : NP_031884.1

name	Hdac3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89257352 GeneID:15183 MGI:1343091
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004407 - histone deacetylase activity [Evidence TAS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0016568 - chromatin modification [Evidence TAS] [Evidence IEA]; GO:0016575 - histone deacetylation [Evidence IEA]; GO:0007346 - regulation of progression through mitotic cell cycle [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : histone deacetylase 3 protein_id : NP_034541.2

name	4631403P03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418899 CCDS:CCDS29195.1 GeneID:225392 MGI:1918044
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC225392 protein_id : NP_722488.1

name	Fchsd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254312 GeneID:319262 MGI:2441771
definition	GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : FCH and double SH3 domains 1 protein_id : NP_783615.2

name	Centd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27885015 CCDS:CCDS29196.1 GeneID:106952 MGI:2147274
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0008060 - ARF GTPase activator activity [Evidence IDA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0030675 - Rac GTPase activator activity [Evidence IDA]; GO:0005100 - Rho GTPase activator activity [Evidence IDA] GO_process : GO:0030336 - negative regulation of cell migration [Evidence IDA]; GO:0035021 - negative regulation of Rac protein signal transduction [Evidence IDA]; GO:0035024 - negative regulation of Rho protein signal transduction [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IDA]; GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : dual-specificity Rho- and Arf-GTPase activating protein 1; ARF-GAP, RHO-GAP, ankyrin repeat and plekstrin homology domains-containing protein 3 product : ARF-GAP, RHO-GAP, ankyrin repeat and pleckstrin homology domains-containing protein 3 protein_id : NP_631945.1

name	Pcdh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328319 CCDS:CCDS29197.1 GeneID:75599 MGI:104692
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0005911 - intercellular junction [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence TAS]; GO:0007156 - homophilic cell adhesion [Evidence TAS] codon_start : 1 product : protocadherin 1 protein_id : NP_083633.2

name	1700086O06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269779 GeneID:73516 MGI:1920766
definition	codon_start : 1 product : hypothetical protein LOC73516 protein_id : XP_001478902.1

name	LOC100042583 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269777 GeneID:100042583
definition	codon_start : 1 product : similar to Rpl17 protein protein_id : XP_001478894.1

name	0610009O20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560224 GeneID:66839 MGI:1914089
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66839 protein_id : NP_077141.2

name	Pcdh12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444908 CCDS:CCDS29199.1 GeneID:53601 MGI:1855700
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005911 - intercellular junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence IDA]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IDA] codon_start : 1 note : protocadherin 14; VE-cadherin-2; vascular endothelial cadherin-2 product : protocadherin 12 protein_id : NP_059074.2

name	Rnf14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910592 CCDS:CCDS29200.1 GeneID:56736 MGI:1929668
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0019787 - small conjugating protein ligase activity [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence ISS]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TRIAD2 type I product : ring finger protein 14 protein_id : NP_064396.1

name	Gnpda1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754030 CCDS:CCDS29201.1 GeneID:26384 MGI:1347054
definition	GO_function : GO:0004342 - glucosamine-6-phosphate deaminase activity [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007340 - acrosome reaction [Evidence TAS]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006002 - fructose 6-phosphate metabolism [Evidence ISS]; GO:0046370 - fructose biosynthesis [Evidence ISS]; GO:0006041 - glucosamine metabolism [Evidence ISS]; GO:0006044 - N-acetylglucosamine metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glucose-6-phosphate isomerase product : glucosamine-6-phosphate deaminase 1 protein_id : NP_036067.1

name	LOC240219 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269782 GeneID:240219
definition	codon_start : 1 product : similar to glutamine synthetase protein_id : XP_001478968.1

name	Ndfip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89001091 GeneID:65113 MGI:1929601
definition	GO_component : GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : Nedd4 WW-binding protein 5; Nedd4 WW binding protein 5 product : Nedd4 family interacting protein 1 protein_id : NP_075372.1

name	Spry4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543767 CCDS:CCDS29202.1 GeneID:24066 MGI:1345144
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0043407 - negative regulation of MAPK activity [Evidence IDA]; GO:0009966 - regulation of signal transduction [Evidence IEA] codon_start : 1 product : sprouty homolog 4 protein_id : NP_036028.2

name	LOC100041875 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269726 GeneID:100041875
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477200.1

name	LOC100041894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269732 GeneID:100041894
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477228.1

name	Fgf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753850 CCDS:CCDS29204.1 GeneID:14164 MGI:95515
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0001759 - induction of an organ [Evidence IDA]; GO:0030324 - lung development [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : fibroblast growth factor 1 (acidic) product : fibroblast growth factor 1 protein_id : NP_034327.1

name	EG545253 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702103 GeneID:545253 MGI:3646292
definition	codon_start : 1 product : hypothetical protein LOC545253 protein_id : NP_001028961.1

name	Arhgap26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87159826 CCDS:CCDS29205.1 GeneID:71302 MGI:1918552
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Rho GTPase activating protein 26 protein_id : NP_780373.3

name	Nr3c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121247453 GeneID:14815 MGI:95824
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004883 - glucocorticoid receptor activity [Evidence IDA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0042921 - glucocorticoid receptor signaling pathway [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : glucocorticoid receptor 1 product : nuclear receptor subfamily 3, group C, member 1 protein_id : NP_032199.3

name	LOC100041839 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041839
definition	number : 1 pseudo : _no_value

name	LOC100041865 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041865
definition	number : 1 pseudo : _no_value

name	LOC100042671 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042671
definition	number : 2 pseudo : _no_value

name	LOC100042671 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042671
definition	number : 1 pseudo : _no_value

name	LOC666809 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666809
definition	number : 3 pseudo : _no_value

name	LOC666809 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666809
definition	number : 2 pseudo : _no_value

name	LOC666809 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666809
definition	number : 1 pseudo : _no_value

name	EG666693 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94404394 GeneID:666693 MGI:3647216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins product : predicted gene, EG666693 pseudo : _no_value transcript_id : XR_001910.1

name	9630014M24Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149269783 GeneID:381155 MGI:3588234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 9630014M24 gene transcript_id : XR_035375.1

clone name	MSMg01-521H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440B13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056C19
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-525B12.T7 (MSMg01no525_b12.b1)	MSMg01-525B12.TJ (MSMg01no525_b12.g1)
ACC	AG595015	AG595016
length	768	773
length of high quality (start - end)	543 (33 - 575)	343 (69 - 411)
definition	CHROMAT_FILE: MSMg01no525_b12.b1 PHD_FILE: MSMg01no525_b12.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:59:34 2005	CHROMAT_FILE: MSMg01no525_b12.g1 PHD_FILE: MSMg01no525_b12.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:59:35 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TTTGXXXXXXXXXXXXXXXXXXXXXXTCCCAGAGGATCCGCGGAATTCTG TCTGTGGATAAGTTCATATATTTCCTGTGCCATCCAAGGAACAAAATAAT GGTGAGAGAGTGTGGAGGAGGGAGGGCTAGAGAGGATGAAAATATCACTA CTTGAGGTCTCCATTCAGAGCCTTTGCCCATAGCTCAGCTCAGTAGGTAC TGAGTGACATGTCAGGAGAGGGTTTCAGGTTGTGATGAGCAAATTATTAA GTCGTTGTCCTGGGCTCCGTATTCGCTTACTCAGGCACGTCTGTCCAGTG TGCCCTGAAATTCACACCCAGAGAAGATCCTGTTCTTTCCTGGAATTGTG AGACAGCTTGGCACTGTGAGCCCAGGGCCATGCTAGTAATGGAAGGCATA GGCAGTTGGCTGTAGGTCTGGGAAGAAAAGCTGCTATTTAATACCCATTT CGGGTTTTCCCATCTCTTAATTCTGGCCATAGAAGATTCAGACCCTGGTG AGCCAGGTGGAAGTGCCCAGGACTTAATTCAGACACTTAATGGCTGAGGT CAGGTACCTCTGGAAAGCTTTGGGTCCTAGAGTCAGCCTCACAAACCTCC CACAAGAACATGTCTGAAGACCTTCTTGCAGTATGGGGTTGTCAGTGCCT CCTTTAATACTCTAGACCAGGGTGGGGTTAAACTTGCCATCCTCTTGGCT CAACCTCTTGTCATGGTTTCCAGTATTGTCACCACCCCCCCCTTTTAACA TAGACCGATCTTGGTTTG	TTGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXAGAGACAGCTTAGTGAATTATGCCAGTTGCTA CCAAGCCTGATGACGTCAGTTCAATCCCCAGGACTCATGAGGAAAAGAGA GGCCAAATTTTTTTTTTTTTTGGACCTCTGCTCTGCTCGCTTGCTCCAGC CCAAAGATTTATTTATTATTATACATAAGTACACTGTAGCTGACTTCAAA CGCACCAGAAGAAGGTGTCAGATCTCATTATAGATGATTGTGAACCACCA TGTAGTTGCTGGGATTTGAACTCAGGACCTTCAGAAGAACAGTCAGTGCT CTTTAGCAAGTTGACCTCTGACTTCCACATGCATGCATGCAGTGGGGGGG TGGGTGGAGGACAGTTTTTCTTTTTCCCTCCCTCTCTTTTTTTTTTCTCC CGTTTTTTTTTCTTTATTCCCCCCCCTTTTCCCTTTTTTTTTTATTTTTC CTTTTTCTGCCATTTTTTTTTTTCATTTTTTTTCGCCCCTTTTCACTTTT CTCCCGTTCTTTTTTCCCCCCCTTTTTTCTTTTTTTTTTCCTCCCCTCGC CCTCTTTTTCCCCCTTTTTCTTTTTCCCGTTTCTCTATTTCTTACGCCCT TCCCCCTCCTTTCTCCCTTCCTCTTTTTTCTCTCCTCTTCCCTTTTTTCT TTTTTCTCCTTTCTTCTTTTCCCCGACCGCTTATTTCTCCCCGATCTTCT CCATCTCATCCTTTTTTTCTCTT
quality values	Open. Hide. 9 9 9 10 9 11 12 13 28 28 28 22 21 21 19 22 22 37 26 28 25 19 17 8 9 9 10 10 10 10 13 14 18 22 28 30 30 31 31 39 39 39 23 19 16 21 23 25 41 42 30 30 18 21 15 11 11 12 15 24 30 39 42 42 47 47 47 57 57 57 57 57 57 68 57 68 68 68 47 50 42 42 41 42 40 43 46 50 50 50 50 47 54 54 54 57 57 47 47 47 57 47 57 57 57 57 54 57 57 57 57 57 57 57 47 48 48 48 48 48 57 57 57 57 57 59 59 57 57 54 54 54 57 50 50 50 50 50 50 50 50 50 50 50 50 57 57 57 57 59 68 68 57 68 57 57 57 57 57 57 57 52 57 57 57 52 52 52 52 52 59 59 68 68 68 68 68 68 68 68 68 68 57 57 52 57 52 59 59 59 59 59 59 68 68 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 62 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 68 62 62 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 52 45 45 52 52 62 62 62 62 62 62 62 62 52 52 52 52 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 57 57 52 52 57 57 57 57 57 57 57 59 57 59 59 59 59 57 57 57 52 43 43 42 35 35 47 47 52 52 57 57 57 57 57 57 57 57 52 52 52 52 57 59 57 52 52 52 57 52 57 57 52 52 52 57 57 57 54 54 54 57 57 57 57 57 57 57 57 57 57 57 57 59 59 57 57 54 57 57 57 57 57 57 57 54 54 54 57 59 57 57 46 40 40 57 57 57 59 59 57 57 48 48 48 57 57 57 47 47 47 57 42 42 35 35 35 42 42 44 40 25 22 22 31 36 39 43 40 40 43 39 39 32 31 30 25 25 30 40 43 43 43 43 36 43 43 43 43 37 28 23 23 24 19 15 21 29 23 23 23 31 34 37 43 37 37 40 39 39 39 31 24 19 28 20 23 14 14 18 19 25 28 39 39 37 31 25 28 16 16 17 24 30 32 28 24 20 20 18 22 12 11 11 13 10 10 14 15 10 15 17 18 22 11 11 12 12 12 25 22 22 25 20 24 23 23 19 19 15 15 9 9 9 8 10 12 21 27 25 33 25 24 18 12 12 12 11 13 10 14 14 21 19 15 15 11 11 16 14 9 9 9 10 10 11 12 11 12 12 26 25 25 11 10 10 10 6 8 6 6 8 8 22 27 13 12 10 13 13 10 12 14 19 14 8 8 8 8 8 8 10 11 10 10 11 10 10 9 13 10 9 8 8 8 8 8 8 9 9 10 10 10 13 13 10 9 12 10 8 10 13 13 12 8 8 8 8 8 10 9 10 8 8 8 10 10 8 8 8 8 8 8 10 10 17 8 9 9 9 12 12 25 19 18 18 20 18 17 17 11 11 11 11 11 10 6 7 7 6 6 8 9 10 12 10 9 9 9 8 8 6 6	Open. Hide. 10 10 10 10 10 8 8 7 9 9 9 35 31 31 30 30 32 25 25 32 19 25 16 14 7 6 6 6 6 8 3 0 3 10 10 21 21 24 18 18 21 21 37 37 37 37 37 37 37 24 18 16 8 8 8 8 8 15 24 32 34 47 33 33 36 36 33 33 28 28 36 43 47 47 47 47 50 59 59 57 48 48 48 48 50 54 51 43 48 47 48 42 48 48 48 48 57 44 59 42 42 39 39 41 46 59 59 46 46 54 57 57 57 57 57 44 44 43 43 44 46 57 57 57 54 57 57 57 47 39 39 35 42 42 43 47 50 57 57 57 57 44 50 46 46 50 43 43 43 46 57 52 52 52 52 57 57 57 57 57 68 68 68 68 68 68 68 68 68 59 59 57 57 54 54 54 57 59 59 57 57 57 59 52 52 52 57 59 59 59 59 57 52 52 57 59 57 57 57 57 59 59 59 59 68 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 57 57 57 57 57 59 62 62 52 62 62 62 62 62 62 62 52 43 62 43 62 62 62 62 62 52 52 52 62 62 57 57 52 52 57 57 52 52 52 52 57 57 57 57 57 52 52 52 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 52 57 57 57 59 59 59 59 59 59 59 59 57 57 52 52 52 43 52 52 57 57 57 57 57 57 57 57 57 57 57 59 59 57 54 44 43 31 28 28 43 43 43 57 44 50 43 35 35 37 43 43 57 57 50 42 39 35 42 35 35 35 42 42 48 48 42 44 42 47 47 57 57 48 48 48 48 57 57 54 54 54 57 57 54 54 54 57 57 54 54 54 57 57 57 54 54 48 48 48 48 48 48 46 43 43 43 43 43 48 48 47 39 35 35 32 32 28 22 19 28 26 23 21 11 10 10 10 10 12 10 9 8 8 10 10 10 12 10 8 8 8 8 11 8 8 9 9 9 8 11 17 15 11 11 22 22 19 19 15 13 10 8 8 8 8 8 11 8 9 9 10 14 23 15 15 10 12 11 10 10 8 10 9 10 10 10 8 8 10 10 9 9 8 10 8 9 9 14 12 12 12 14 16 14 9 9 8 8 8 8 10 8 9 10 12 13 14 11 9 12 8 8 8 8 8 8 8 15 20 18 18 15 15 15 19 12 10 10 10 10 10 12 20 15 12 12 12 11 11 9 8 8 8 7 10 6 6 8 8 10 15 9 8 8 8 8 8 10 11 10 14 14 18 17 12 8 8 8 8 8 11 13 28 19 14 9 9 10 11 15 9 10 10 12 10 12 12 13 13 12 10 8 8 8 8 8 12 10 10 11 8 8 8 8 8 10 10 10 15 17 19 10 14 8 13 10 10 11 12 15 13 10 10 10 10 10 10 9 8 6 6 6 8 6 10 16 17 15 8 8 8 8 8 14 11 7 12 6 6 8 8 8 10 10 10 13 8 9 9 9 9 11 12 16 9 9 9 9 8 8 8 8 8 8 11 12 10 10 10 11 13 12 12 11 10 10 10 10 10 9 9 10 10 9 9 9 10 17 24 24 21 20 20 20 18 18 15 13 11 8 8 8 8 8 10 11 8 9 10 11 16 14 16 12 10 13 12 11 8 8 6 6 6 8 8 8 8 8 8 10 11 12 9 12 10 9 9 9 9 9 10 10 10 10 8 8 6 8 6 6 6 6 8 9 9 12 10 20 28 12 13 10 8 8 10 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no525_b12.b1 MSMg01no525_b12.b1 CHROMAT_FILE:
MSMg01no525_b12.b1 PHD_FILE: MSMg01no525_b12.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:59:34 2005
         (543 letters)



>mm_chr18_38657886_38658830
          Length = 945

 Score =  992 bits (513), Expect = 0.0
 Identities = 529/535 (98%), Gaps = 2/535 (0%)
 Strand = Plus / Plus

                                                                       
Query: 11  gaattctgtctgtggataagttcatatatttcctgtgccatccaaggaacaaaataatgg 70
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 211 gaattctgtctgtggataagttcatatatttcctgtgccatccaaggaacaaaataatgg 270

                                                                       
Query: 71  tgagagagtgtggaggagggagggctagagaggatgaaaatatcactacttgaggtctcc 130
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 271 tgagagagtgtggaggagggagggctagagaggatgaaaatatcactacttgaggtctcc 330

                                                                       
Query: 131 attcagagcctttgcccatagctcagctcagtaggtactgagtgac--atgtcaggagag 188
           ||||||||||||||||||||||||||||||||||||||||||||||  ||||||| ||||
Sbjct: 331 attcagagcctttgcccatagctcagctcagtaggtactgagtgacaaatgtcagtagag 390

                                                                       
Query: 189 ggtttcaggttgtgatgagcaaattattaagtcgttgtcctgggctccgtattcgcttac 248
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 391 ggtttcaggttgtgatgagcaaattattaagtcgttgtcctgggctccgtattcgcttac 450

                                                                       
Query: 249 tcaggcacgtctgtccagtgtgccctgaaattcacacccagagaagatcctgttctttcc 308
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 451 tcaggcacgtctgtccagtgtgccctgaaattcacacccagagaagatcctgttctttcc 510

                                                                       
Query: 309 tggaattgtgagacagcttggcactgtgagcccagggccatgctagtaatggaaggcata 368
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 511 tggaattgtgagagagcttggcactgtgagcccagggccaggctagtaatggaaggcata 570

                                                                       
Query: 369 ggcagttggctgtaggtctgggaagaaaagctgctatttaatacccatttcgggttttcc 428
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 571 ggcagttggctgtagggctgggaagaaaagctgctatttaatacccatttcgggttttcc 630

                                                                       
Query: 429 catctcttaattctggccatagaagattcagaccctggtgagccaggtggaagtgcccag 488
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 631 catctcttaattctggccatagaagattcagaccctggtgagccaggtggaagtgcccag 690

                                                                  
Query: 489 gacttaattcagacacttaatggctgaggtcaggtacctctggaaagctttgggt 543
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 691 gacttaattcagacacttaatggctgaggtcaggtacctctggaaagctttgggt 745


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 24
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 543
Length of database: 945
Length adjustment: 10
Effective length of query: 533
Effective length of database: 935
Effective search space:   498355
Effective search space used:   498355
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information