MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-064F13
Chromosome	19 (Build37)
Map Location	4,755,662 - 4,929,450
singlet/doublet	doublet
Overlap gene	Rbm4b, Rbm4, Rbm14, Ccs, Ccdc87, Ctsf, Actn3, Zdhhc24, Bbs1, Dpp3
Upstream gene	Suv420h1, Chka, Tcirg1, Ndufs8, Aldh3b1, Unc93b1, LOC100039337, 1700055N04Rik, Aldh3b2, Acy3, Tbx10, Nudt8, Doc2g, Ndufv1, Gstp1, Gstp2, BC021614, Cabp2, Cdk2ap2, Pitpnm1, Aip, Tmem134, Cabp4, Gpr152, Coro1b, Ptprcap, Rps6kb2, AI790298, Tbc1d10c, Ppp1ca, Rad9, Clcf1, Pold4, Ssh3, Ankrd13d, Adrbk1, Fbxl11, LOC100043628, Rhod, Syt12, 2010003K11Rik, Pcx, Lrfn4, Rce1, Gm960, Spnb3
Downstream gene	Peli3, Mrpl11, Npas4, Slc29a2, B3gnt1, Brms1, Rin1, Cd248, Tmem151, Yif1a, Cnih2, Rab1b, Klc2, LOC383424, Pacs1, Sf3b2, Gal3st3, EG631868, Catsper1, Cst6, Banf1, 2010003J03Rik, Sart1, Tsga10ip, EG622178, Drap1, AI837181, LOC383425, Fosl1, Ccdc85b, Fibp, Ctsw, Efemp2, Mus81, Cfl1, B930037P14Rik, 1700020D05Rik, Ovol1, Gm962, Rnaseh2c, Htatip, Rela, Sipa1, Pcnxl3, Map3k11, Kcnk7, Ehbp1l1, Mtvr2, Sssca1, Ltbp3, Scyl1, 2310043N10Rik, 1200004M23Rik, Slc25a45, Tigd3, Dpf2, Cdc42ep2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Suv420h1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225888 MGI:2444557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chka (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12660 MGI:107760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tcirg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27060 MGI:1350931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufs8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225887 MGI:2385079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh3b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67689 MGI:1914939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc93b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54445 MGI:1859307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039337 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	1700055N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73458 MGI:1920708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 21 Proteins

name	Aldh3b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621603 MGI:2147613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 27 ESTs, 25 Proteins

name	Acy3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71670 MGI:1918920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbx10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109575 MGI:1261436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nudt8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66387 MGI:1913637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Doc2g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60425 MGI:1926250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17995 MGI:107851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14870 MGI:95865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14869 MGI:95864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC021614 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225884 MGI:2385078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cabp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29866 MGI:1352749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk2ap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52004 MGI:1098779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pitpnm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18739 MGI:1197524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11632 MGI:109622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem134 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66990 MGI:1914240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cabp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73660 MGI:1920910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr152 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269053 MGI:2685519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coro1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23789 MGI:1345963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptprcap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19265 MGI:97811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps6kb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58988 MGI:1927343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI790298 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107239 MGI:2147595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 51 ESTs, 3 Proteins

name	Tbc1d10c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108995 MGI:1922072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1ca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19045 MGI:103016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rad9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19367 MGI:1328356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clcf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56708 MGI:1930088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pold4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69745 MGI:1916995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssh3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245857 MGI:2683546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd13d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68423 MGI:1915673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adrbk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110355 MGI:87940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225876 MGI:1354736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043628 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Rhod (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11854 MGI:108446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syt12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171180 MGI:2159601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010003K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69861 MGI:1917111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18563 MGI:97520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrfn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225875 MGI:2385612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rce1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19671 MGI:1336895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm960 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381196 MGI:2685806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spnb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20743 MGI:1313261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66704 MGI:1913954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19653 MGI:1100865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56275 MGI:1929092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12460 MGI:1333783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc87 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399599 MGI:3026882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56464 MGI:1861434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11474 MGI:99678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70605 MGI:1917855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bbs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52028 MGI:1277215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75221 MGI:1922471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Peli3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240518 MGI:1924963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66419 MGI:2137215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npas4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225872 MGI:2664186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc29a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13340 MGI:1345278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gnt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108902 MGI:1919680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brms1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107392 MGI:2388804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225870 MGI:2385695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd248 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70445 MGI:1917695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem151 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381199 MGI:2147713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yif1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68090 MGI:1915340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnih2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12794 MGI:1277225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76308 MGI:1923558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16594 MGI:107953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383424 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 13 Proteins pseudo : _no_value

name	Pacs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107975 MGI:1277113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sf3b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319322 MGI:2441856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gal3st3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545276 MGI:3617843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG631868 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631868 MGI:3645420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Catsper1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225865 MGI:2179947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cst6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73720 MGI:1920970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Banf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23825 MGI:1346330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2010003J03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69860 MGI:1917110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sart1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20227 MGI:1309453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsga10ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78306 MGI:1925556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein

name	EG622178 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622178 MGI:3649011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 4 Proteins

name	Drap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66556 MGI:1913806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI837181 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107242 MGI:2147598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383425 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 191 ESTs, 5 Proteins pseudo : _no_value

name	Fosl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14283 MGI:107179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc85b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240514 MGI:2147607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fibp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58249 MGI:1926233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsw (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13041 MGI:1338045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efemp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58859 MGI:1891209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mus81 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71711 MGI:1918961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cfl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12631 MGI:101757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B930037P14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225861 MGI:2444704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700020D05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75555 MGI:1922805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ovol1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18426 MGI:1330290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm962 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381201 MGI:2685808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnaseh2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68209 MGI:1915459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htatip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81601 MGI:1932051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rela (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19697 MGI:103290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sipa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20469 MGI:107576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcnxl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104401 MGI:1861733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map3k11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26403 MGI:1346880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnk7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16530 MGI:1341841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ehbp1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114601 MGI:3612340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtvr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17826 MGI:106595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Sssca1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56390 MGI:1913482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltbp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16998 MGI:1101355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scyl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78891 MGI:1931787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310043N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66961 MGI:1914211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 254 ESTs

name	1200004M23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67457 MGI:1914707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107375 MGI:2147731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tigd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332359 MGI:2681860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19708 MGI:109529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc42ep2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104252 MGI:1929744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Suv420h1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801842 GeneID:225888 MGI:2444557
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of variegation 4-20 homolog 1 (Drosophila) transcript_id : NM_144871.3

name	Chka (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:95147346 GeneID:12660 MGI:107760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : choline kinase alpha transcript_id : NM_013490.3

name	Chka (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70908365 GeneID:12660 MGI:107760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : choline kinase alpha transcript_id : NM_001025566.1

name	Tcirg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980623 GeneID:27060 MGI:1350931
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3 transcript_id : NM_016921.2

name	Ndufs8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364966 GeneID:225887 MGI:2385079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) Fe-S protein 8 transcript_id : NM_144870.4

name	Aldh3b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328287 GeneID:67689 MGI:1914939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 3 family, member B1 transcript_id : NM_026316.2

name	Unc93b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956093 GeneID:54445 MGI:1859307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-93 homolog B1 (C. elegans) transcript_id : NM_019449.1

name	1700055N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405716 GeneID:73458 MGI:1920708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 21 Proteins product : RIKEN cDNA 1700055N04 gene, transcript variant 1 transcript_id : XM_895013.2

name	Aldh3b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405693 GeneID:621603 MGI:2147613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 27 ESTs, 25 Proteins product : aldehyde dehydrogenase 3 family, member B2 transcript_id : XM_129134.7

name	Acy3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893369 GeneID:71670 MGI:1918920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aspartoacylase (aminoacylase) 3 transcript_id : NM_027857.3

name	Tbx10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47604969 GeneID:109575 MGI:1261436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 10 transcript_id : NM_001001320.1

name	Tbx10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133506835 GeneID:109575 MGI:1261436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 10 transcript_id : NM_011533.1

name	Nudt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381955 GeneID:66387 MGI:1913637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 8 transcript_id : NM_025529.3

name	Doc2g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139949244 GeneID:60425 MGI:1926250
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : double C2, gamma transcript_id : NM_021791.3

name	Ndufv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130958 GeneID:17995 MGI:107851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) flavoprotein 1 transcript_id : NM_133666.2

name	Gstp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10092607 GeneID:14870 MGI:95865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, pi 1 transcript_id : NM_013541.1

name	Gstp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45597456 GeneID:14869 MGI:95864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, pi 2 transcript_id : NM_181796.2

name	BC021614 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130056 GeneID:225884 MGI:2385078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC021614 transcript_id : NM_144869.2

name	Cabp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304940 GeneID:29866 MGI:1352749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding protein 2 transcript_id : NM_013878.1

name	Cdk2ap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348581 GeneID:52004 MGI:1098779
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDK2-associated protein 2 transcript_id : NM_026373.2

name	Pitpnm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357370 GeneID:18739 MGI:1197524
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol membrane-associated 1 transcript_id : NM_008851.2

name	Aip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131102 GeneID:11632 MGI:109622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aryl-hydrocarbon receptor-interacting protein transcript_id : NM_016666.2

name	Tmem134 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118403329 GeneID:66990 MGI:1914240
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 134 transcript_id : NM_001078649.1

name	Tmem134 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118403318 GeneID:66990 MGI:1914240
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 134 transcript_id : NM_025889.2

name	Cabp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982570 GeneID:73660 MGI:1920910
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding protein 4 transcript_id : NM_144532.2

name	Gpr152 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71534279 GeneID:269053 MGI:2685519
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 152 transcript_id : NM_206973.2

name	Coro1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388278 GeneID:23789 MGI:1345963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 1B transcript_id : NM_011778.2

name	Ptprcap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60499027 GeneID:19265 MGI:97811
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, C polypeptide-associated protein transcript_id : NM_016933.3

name	Rps6kb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130463 GeneID:58988 MGI:1927343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S6 kinase, polypeptide 2 transcript_id : NM_021485.2

name	AI790298 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270257 GeneID:107239 MGI:2147595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 51 ESTs, 3 Proteins product : expressed sequence AI790298, transcript variant 3 transcript_id : XM_902445.3

name	Tbc1d10c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517464 GeneID:108995 MGI:1922072
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 10c transcript_id : NM_178650.3

name	Ppp1ca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892519 GeneID:19045 MGI:103016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, catalytic subunit, alpha isoform transcript_id : NM_031868.2

name	Rad9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892125 GeneID:19367 MGI:1328356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD9 homolog (S. pombe) transcript_id : NM_011237.2

name	Clcf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373681 GeneID:56708 MGI:1930088
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cardiotrophin-like cytokine factor 1 transcript_id : NM_019952.2

name	Pold4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367718 GeneID:69745 MGI:1916995
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA-directed), delta 4 transcript_id : NM_027196.2

name	Ssh3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130790 GeneID:245857 MGI:2683546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : slingshot homolog 3 (Drosophila) transcript_id : NM_198113.2

name	Ankrd13d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363887 GeneID:68423 MGI:1915673
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 13 family, member D transcript_id : NM_026720.2

name	Adrbk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859768 GeneID:110355 MGI:87940
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor kinase, beta 1 transcript_id : NM_130863.1

name	Fbxl11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100818177 GeneID:225876 MGI:1354736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 11 transcript_id : NM_001001984.2

name	LOC100043628 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270266 GeneID:100043628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100043628 transcript_id : XM_001480911.1

name	Rhod (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364466 GeneID:11854 MGI:108446
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ras homolog gene family, member D transcript_id : NM_007485.3

name	Syt12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803147 GeneID:171180 MGI:2159601
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin XII transcript_id : NM_134164.3

name	2010003K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037184 GeneID:69861 MGI:1917111
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010003K11 gene transcript_id : NM_027237.1

name	Pcx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351600 GeneID:18563 MGI:97520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyruvate carboxylase transcript_id : NM_008797.2

name	Lrfn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802447 GeneID:225875 MGI:2385612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat and fibronectin type III domain containing 4 transcript_id : NM_153388.3

name	Rce1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963506 GeneID:19671 MGI:1336895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RCE1 homolog, prenyl protein peptidase (S. cerevisiae) transcript_id : NM_023131.1

name	Gm960 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802976 GeneID:381196 MGI:2685806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 960, (NCBI) transcript_id : NM_001033447.2

name	Spnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55926126 GeneID:20743 MGI:1313261
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spectrin beta 3 transcript_id : NM_021287.1

name	Rbm4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909366 GeneID:66704 MGI:1913954
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 4B transcript_id : NM_025717.3

name	Rbm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262143 GeneID:19653 MGI:1100865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 4 transcript_id : NM_009032.2

name	Rbm14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262141 GeneID:56275 MGI:1929092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 14 transcript_id : NM_019869.2

name	Ccs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326534 GeneID:12460 MGI:1333783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : copper chaperone for superoxide dismutase transcript_id : NM_016892.3

name	Ccdc87 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803415 GeneID:399599 MGI:3026882
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 87 transcript_id : NM_207268.2

name	Ctsf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9845245 GeneID:56464 MGI:1861434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin F transcript_id : NM_019861.1

name	Actn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304854 GeneID:11474 MGI:99678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actinin alpha 3 transcript_id : NM_013456.1

name	Zdhhc24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363793 GeneID:70605 MGI:1917855
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 24 transcript_id : NM_027476.2

name	Bbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366848 GeneID:52028 MGI:1277215
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bardet-Biedl syndrome 1 homolog (human) transcript_id : NM_001033128.2

name	Dpp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527017 GeneID:75221 MGI:1922471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dipeptidylpeptidase 3 transcript_id : NM_133803.1

name	Peli3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982118 GeneID:240518 MGI:1924963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pellino 3 transcript_id : NM_172835.2

name	Mrpl11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376910 GeneID:66419 MGI:2137215
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L11 transcript_id : NM_025553.2

name	Npas4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365106 GeneID:225872 MGI:2664186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal PAS domain protein 4 transcript_id : NM_153553.3

name	Slc29a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892139 GeneID:13340 MGI:1345278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 29 (nucleoside transporters), member 2 transcript_id : NM_007854.2

name	B3gnt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92110030 GeneID:108902 MGI:1919680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 transcript_id : NM_175383.2

name	Brms1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527391 GeneID:107392 MGI:2388804
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : breast cancer metastasis-suppressor 1 transcript_id : NM_134155.1

name	Rin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130150 GeneID:225870 MGI:2385695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras and Rab interactor 1 transcript_id : NM_145495.2

name	Cd248 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982596 GeneID:70445 MGI:1917695
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD248 antigen, endosialin transcript_id : NM_054042.2

name	Tmem151 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49457864 GeneID:381199 MGI:2147713
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 151 transcript_id : NM_001001885.1

name	Yif1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802995 GeneID:68090 MGI:1915340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Yip1 interacting factor homolog A (S. cerevisiae) transcript_id : NM_026553.3

name	Cnih2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345469 GeneID:12794 MGI:1277225
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cornichon homolog 2 (Drosophila) transcript_id : NM_009920.2

name	Rab1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373067 GeneID:76308 MGI:1923558
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB1B, member RAS oncogene family transcript_id : NM_029576.2

name	Klc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778982 GeneID:16594 MGI:107953
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin light chain 2 transcript_id : NM_008451.2

name	Pacs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54291703 GeneID:107975 MGI:1277113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphofurin acidic cluster sorting protein 1 transcript_id : NM_153129.2

name	Sf3b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794205 GeneID:319322 MGI:2441856
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor 3b, subunit 2 transcript_id : NM_030109.1

name	Gal3st3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701541 GeneID:545276 MGI:3617843
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactose-3-O-sulfotransferase 3 transcript_id : NM_001024717.1

name	Catsper1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129998 GeneID:225865 MGI:2179947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cation channel of sperm 1 transcript_id : NM_139301.2

name	Cst6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388301 GeneID:73720 MGI:1920970
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystatin E/M transcript_id : NM_028623.3

name	Banf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981404 GeneID:23825 MGI:1346330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : barrier to autointegration factor 1 transcript_id : NM_011793.2

name	Banf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84042520 GeneID:23825 MGI:1346330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : barrier to autointegration factor 1 transcript_id : NM_001038231.1

name	2010003J03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893041 GeneID:69860 MGI:1917110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010003J03 gene transcript_id : NM_027236.2

name	Sart1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244095 GeneID:20227 MGI:1309453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : squamous cell carcinoma antigen recognized by T-cells 1 transcript_id : NM_016882.3

name	EG622178 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405706 GeneID:622178 MGI:3649011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 4 Proteins product : predicted gene, EG622178 transcript_id : XM_886587.2

name	Drap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313423 GeneID:66556 MGI:1913806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Dr1 associated protein 1 (negative cofactor 2 alpha) transcript_id : NM_024176.1

name	AI837181 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527385 GeneID:107242 MGI:2147598
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI837181 transcript_id : NM_134149.1

name	Fosl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129965 GeneID:14283 MGI:107179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fos-like antigen 1 transcript_id : NM_010235.2

name	Ccdc85b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348477 GeneID:240514 MGI:2147607
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 85B transcript_id : NM_198616.1

name	Fibp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625665 GeneID:58249 MGI:1926233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor (acidic) intracellular binding protein transcript_id : NM_021438.2

name	Ctsw (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367215 GeneID:13041 MGI:1338045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin W transcript_id : NM_009985.3

name	Efemp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982689 GeneID:58859 MGI:1891209
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epidermal growth factor-containing fibulin-like extracellular matrix protein 2 transcript_id : NM_021474.2

name	Mus81 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980666 GeneID:71711 MGI:1918961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MUS81 endonuclease homolog (yeast) transcript_id : NM_027877.2

name	Cfl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369132 GeneID:12631 MGI:101757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofilin 1, non-muscle transcript_id : NM_007687.3

name	B930037P14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356128 GeneID:225861 MGI:2444704
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B930037P14 gene transcript_id : NM_001024560.2

name	1700020D05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802344 GeneID:75555 MGI:1922805
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700020D05 gene transcript_id : NM_023781.4

name	Ovol1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374732 GeneID:18426 MGI:1330290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : OVO homolog-like 1 (Drosophila) transcript_id : NM_019935.3

name	Gm962 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349236 GeneID:381201 MGI:2685808
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 962, (NCBI) transcript_id : NM_001033448.2

name	Rnaseh2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71834684 GeneID:68209 MGI:1915459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease H2, subunit C transcript_id : NM_026616.2

name	Htatip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30519990 GeneID:81601 MGI:1932051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIV-1 tat interactive protein, homolog (human) transcript_id : NM_178637.1

name	Rela (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130517 GeneID:19697 MGI:103290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-rel reticuloendotheliosis viral oncogene homolog A (avian) transcript_id : NM_009045.4

name	Sipa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61556719 GeneID:20469 MGI:107576
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal-induced proliferation associated gene 1 transcript_id : NM_011379.3

name	Pcnxl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130055 GeneID:104401 MGI:1861733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pecanex-like 3 (Drosophila) transcript_id : NM_144868.2

name	Map3k11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66392589 GeneID:26403 MGI:1346880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase kinase 11 transcript_id : NM_022012.3

name	Kcnk7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51944954 GeneID:16530 MGI:1341841
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel, subfamily K, member 7 transcript_id : NM_010609.2

name	Kcnk7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51944956 GeneID:16530 MGI:1341841
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel, subfamily K, member 7 transcript_id : NM_001004138.1

name	Ehbp1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158692 GeneID:114601 MGI:3612340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EH domain binding protein 1-like 1 transcript_id : NM_053252.2

name	Mtvr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31324533 GeneID:17826 MGI:106595
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mammary tumor virus receptor 2 transcript_id : NM_181452.1

name	Mtvr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963546 GeneID:17826 MGI:106595
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mammary tumor virus receptor 2 transcript_id : NM_023166.1

name	Sssca1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60687516 GeneID:56390 MGI:1913482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sjogren's syndrome/scleroderma autoantigen 1 homolog (human) transcript_id : NM_020491.4

name	Ltbp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487414 GeneID:16998 MGI:1101355
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : latent transforming growth factor beta binding protein 3 transcript_id : NM_008520.2

name	Scyl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130697 GeneID:78891 MGI:1931787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SCY1-like 1 (S. cerevisiae) transcript_id : NM_023912.2

name	1200004M23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367845 GeneID:67457 MGI:1914707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200004M23 gene transcript_id : NM_026169.4

name	Slc25a45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374011 GeneID:107375 MGI:2147731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 45 transcript_id : NM_134154.2

name	Tigd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348509 GeneID:332359 MGI:2681860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tigger transposable element derived 3 transcript_id : NM_198634.1

name	Dpf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625650 GeneID:19708 MGI:109529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : D4, zinc and double PHD fingers family 2 transcript_id : NM_011262.2

name	Cdc42ep2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22779863 GeneID:104252 MGI:1929744
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC42 effector protein (Rho GTPase binding) 2 transcript_id : NM_026772.1

name	Suv420h1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542284 CCDS:CCDS29399.1 GeneID:225888 MGI:2444557
definition	GO_component : GO:0000780 - condensed nuclear chromosome, pericentric region [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0042799 - histone lysine N-methyltransferase activity (H4-K20 specific) [Evidence IDA] GO_process : GO:0016571 - histone methylation [Evidence IDA] codon_start : 1 exception : mismatches in translation product : suppressor of variegation 4-20 homolog 1 protein_id : NP_659120.2

name	Chka (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70908364 CCDS:CCDS29400.1 GeneID:12660 MGI:107760
definition	GO_function : GO:0004103 - choline kinase activity [Evidence IDA]; GO:0004104 - cholinesterase activity [Evidence IDA]; GO:0004305 - ethanolamine kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006656 - phosphatidylcholine biosynthesis [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; CK/EK-alpha; choline/ethanolamine kinase alpha; choline/ethanolamine kinase-alpha product : choline kinase alpha isoform 1 protein_id : NP_038518.2

name	Chka (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70908366 GeneID:12660 MGI:107760
definition	GO_function : GO:0004103 - choline kinase activity [Evidence IDA]; GO:0004104 - cholinesterase activity [Evidence IDA]; GO:0004305 - ethanolamine kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006656 - phosphatidylcholine biosynthesis [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; CK/EK-alpha; choline/ethanolamine kinase alpha; choline/ethanolamine kinase-alpha product : choline kinase alpha isoform 2 protein_id : NP_001020737.1

name	Tcirg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980624 CCDS:CCDS29401.1 GeneID:27060 MGI:1350931
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0015992 - proton transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : osteosclerotic; ATPase, H+ transporting, lysosomal I; V-ATPase a3 product : T-cell, immune regulator 1 protein_id : NP_058617.2

name	Ndufs8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195430 CCDS:CCDS29402.1 GeneID:225887 MGI:2385079
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) Fe-S protein 8 protein_id : NP_659119.2

name	Aldh3b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328288 CCDS:CCDS29403.1 GeneID:67689 MGI:1914939
definition	GO_function : GO:0004030 - aldehyde dehydrogenase [NAD(P)+] activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006081 - aldehyde metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : ALDH class 3-like; microsomal aldehyde dehydrogenase-like product : fatty aldehyde dehydrogenase-like protein_id : NP_080592.2

name	Unc93b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956094 CCDS:CCDS29404.1 GeneID:54445 MGI:1859307
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP]; GO:0008063 - Toll signaling pathway [Evidence IMP] codon_start : 1 exception : mismatches in translation note : unc-93 homolog B product : unc93 homolog B protein_id : NP_062322.1

name	1700055N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82997826 GeneID:73458 MGI:1920708
definition	codon_start : 1 product : hypothetical protein LOC73458 isoform 1 protein_id : XP_900106.1

name	Aldh3b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38084778 GeneID:621603 MGI:2147613
definition	codon_start : 1 product : similar to Aldehyde dehydrogenase 3 family, member B1 protein_id : XP_129134.2

name	Acy3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982632 CCDS:CCDS29406.1 GeneID:71670 MGI:1918920
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004046 - aminoacylase activity [Evidence IDA]; GO:0019807 - aspartoacylase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IDA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : acylase III; hepatitis C virus core-binding protein 1 product : aspartoacylase-3 protein_id : NP_082133.2

name	Tbx10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47604970 CCDS:CCDS29407.1 GeneID:109575 MGI:1261436
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; T-box 13; dancer product : T-box 10 isoform 1 protein_id : NP_001001320.1

name	Tbx10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133506836 GeneID:109575 MGI:1261436
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; T-box 13; dancer product : T-box 10 isoform 2 protein_id : NP_035663.1

name	Nudt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384950 CCDS:CCDS29408.1 GeneID:66387 MGI:1913637
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : nudix-type motif 8 protein_id : NP_079805.1

name	Doc2g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254529 CCDS:CCDS29409.1 GeneID:60425 MGI:1926250
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : double C2, gamma protein_id : NP_068563.2

name	Ndufv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526814 CCDS:CCDS29410.1 GeneID:17995 MGI:107851
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0010181 - FMN binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0016651 - oxidoreductase activity, acting on NADH or NADPH [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : NADH dehydrogenase flavoprotein 1; 24 kDa (FP) product : NADH dehydrogenase (ubiquinone) flavoprotein 1 protein_id : NP_598427.1

name	Gstp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10092608 CCDS:CCDS29411.1 GeneID:14870 MGI:95865
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006749 - glutathione metabolism [Evidence IDA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : Gst p-1 product : glutathione S-transferase, pi 1 protein_id : NP_038569.1

name	Gstp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32401425 CCDS:CCDS29412.1 GeneID:14869 MGI:95864
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IDA] GO_process : GO:0006749 - glutathione metabolism [Evidence IDA] codon_start : 1 note : Gst p-2 product : glutathione S-transferase, pi 2 protein_id : NP_861461.1

name	BC021614 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450105 GeneID:225884 MGI:2385078
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC225884 protein_id : NP_659118.1

name	Cabp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304941 CCDS:CCDS29413.1 GeneID:29866 MGI:1352749
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : calcium binding protein 2 protein_id : NP_038906.1

name	Cdk2ap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385870 CCDS:CCDS29414.1 GeneID:52004 MGI:1098779
definition	codon_start : 1 product : DOC-1 related protein protein_id : NP_080649.1

name	Pitpnm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679339 GeneID:18739 MGI:1197524
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005543 - phospholipid binding [Evidence ISS] GO_process : GO:0015031 - protein transport [Evidence IEA] codon_start : 1 note : retinal degeneration 9 product : phosphatidylinositol membrane-associated 1 protein_id : NP_032877.1

name	Aip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7709982 CCDS:CCDS29415.1 GeneID:11632 MGI:109622
definition	GO_component : GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003712 - transcription cofactor activity [Evidence IPI] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006805 - xenobiotic metabolism [Evidence IPI] codon_start : 1 product : aryl-hydrocarbon receptor-interacting protein protein_id : NP_057875.1

name	Tmem134 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118403330 GeneID:66990 MGI:1914240
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform a is encoded by transcript variant 1 product : hypothetical protein LOC66990 isoform a protein_id : NP_001072117.1

name	Tmem134 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385378 GeneID:66990 MGI:1914240
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform b is encoded by transcript variant 2 product : hypothetical protein LOC66990 isoform b protein_id : NP_080165.1

name	Cabp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746185 CCDS:CCDS29416.1 GeneID:73660 MGI:1920910
definition	GO_component : GO:0009288 - flagellum (sensu Bacteria) [Evidence IEA] GO_process : GO:0001539 - ciliary or flagellar motility [Evidence IEA] codon_start : 1 product : calcium binding protein 4 protein_id : NP_653115.1

name	Gpr152 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195446 CCDS:CCDS29417.1 GeneID:269053 MGI:2685519
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : putative G-protein coupled receptor protein_id : NP_996856.1

name	Coro1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753494 CCDS:CCDS29418.1 GeneID:23789 MGI:1345963
definition	GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : coronin 1b; coronin 2 product : coronin, actin binding protein 1B protein_id : NP_035908.1

name	Ptprcap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18640746 GeneID:19265 MGI:97811
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 note : CD45-associated protein product : protein tyrosine phosphatase, receptor type, C polypeptide-associated protein protein_id : NP_058629.2

name	Rps6kb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946894 CCDS:CCDS29419.1 GeneID:58988 MGI:1927343
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : S6 kinase 2; ribosomal protein S6 kinase, 70kD, polypeptide 2 product : ribosomal protein S6 kinase, polypeptide 2 protein_id : NP_067460.1

name	AI790298 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270258 GeneID:107239 MGI:2147595
definition	codon_start : 1 product : hypothetical protein LOC107239 isoform 3 protein_id : XP_907538.3

name	Tbc1d10c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517465 GeneID:108995 MGI:1922072
definition	codon_start : 1 note : EBP50-PDZ interactor of 64 kD product : TBC1 domain family, member 10c protein_id : NP_848765.2

name	Ppp1ca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994195 CCDS:CCDS29421.1 GeneID:19045 MGI:103016
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0000163 - protein phosphatase type 1 activity [Evidence ISS] [Evidence TAS] [Evidence IDA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence IDA] GO_process : GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence TAS]; GO:0007143 - female meiosis [Evidence TAS]; GO:0005977 - glycogen metabolism [Evidence TAS]; GO:0030324 - lung development [Evidence IMP]; GO:0008152 - metabolism [Evidence TAS]; GO:0006470 - protein amino acid dephosphorylation [Evidence TAS] [Evidence IDA]; GO:0006417 - regulation of protein biosynthesis [Evidence TAS] codon_start : 1 product : protein phosphatase 1, catalytic subunit, alpha protein_id : NP_114074.1

name	Rad9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755282 CCDS:CCDS29422.1 GeneID:19367 MGI:1328356
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0008853 - exodeoxyribonuclease III activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000075 - cell cycle checkpoint [Evidence IGI]; GO:0000077 - DNA damage checkpoint [Evidence ISS]; GO:0006281 - DNA repair [Evidence IEA]; GO:0043065 - positive regulation of apoptosis [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0009314 - response to radiation [Evidence ISS] codon_start : 1 note : Rad9-like protein product : RAD9 homolog protein_id : NP_035367.1

name	Clcf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910314 CCDS:CCDS29423.1 GeneID:56708 MGI:1930088
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0005125 - cytokine activity [Evidence ISS] [Evidence IDA]; GO:0008083 - growth factor activity [Evidence ISS] GO_process : GO:0030183 - B cell differentiation [Evidence IDA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence ISS]; GO:0007259 - JAK-STAT cascade [Evidence IDA]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0042517 - positive regulation of tyrosine phosphorylation of Stat3 protein [Evidence ISS] codon_start : 1 note : neurotrophin-1/B-cell stimulating factor-3; NNT-1/BSF-3; B-cell stimulating factor 3 product : cardiotrophin-like cytokine factor 1 protein_id : NP_064336.1

name	Pold4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312396 CCDS:CCDS29424.1 GeneID:69745 MGI:1916995
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0001938 - positive regulation of endothelial cell proliferation [Evidence IMP] codon_start : 1 note : DNA polymerase delta smallest subunit p12 product : small subunit DNA polymerase delta p12 protein_id : NP_081472.1

name	Ssh3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674269 CCDS:CCDS29425.1 GeneID:245857 MGI:2683546
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : slingshot-3L; slingshot-like 3 product : slingshot homolog 3 protein_id : NP_932781.1

name	Ankrd13d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:142363888 GeneID:68423 MGI:1915673
definition	codon_start : 1 product : ankyrin repeat domain 13 family, member D protein_id : NP_080996.2

name	Adrbk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859769 CCDS:CCDS29426.1 GeneID:110355 MGI:87940
definition	GO_component : GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004703 - G-protein coupled receptor kinase activity [Evidence IDA] [Evidence IMP]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0002026 - cardiac inotropy [Evidence IGI]; GO:0002029 - desensitization of G-protein coupled receptor protein signaling pathway [Evidence IGI] [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007507 - heart development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : beta ARK; beta ARK1; beta-AR kinase-1; beta-adrenergic receptor kinase-1 product : adrenergic receptor kinase, beta 1 protein_id : NP_570933.1

name	Fbxl11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100818178 GeneID:225876 MGI:1354736
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box protein containing leucine repeats product : F-box and leucine-rich repeat protein 11 protein_id : NP_001001984.2

name	LOC100043628 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270267 GeneID:100043628
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480961.1

name	Rhod (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671573 CCDS:CCDS29427.1 GeneID:11854 MGI:108446
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : aplysia ras-related homolog D; ras homolog D (RhoD) product : ras homolog D protein_id : NP_031511.1

name	Syt12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527400 CCDS:CCDS29428.1 GeneID:171180 MGI:2159601
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA] codon_start : 1 note : synaptotagmin 12 product : synaptotagmin XII protein_id : NP_598925.1

name	2010003K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037185 CCDS:CCDS29429.1 GeneID:69861 MGI:1917111
definition	codon_start : 1 product : hypothetical protein LOC69861 protein_id : NP_081513.1

name	Pcx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679237 CCDS:CCDS29430.1 GeneID:18563 MGI:97520
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0009374 - biotin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004736 - pyruvate carboxylase activity [Evidence IEA] GO_process : GO:0006094 - gluconeogenesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation function : ATP-dependent carboxylation of pyruvate to form oxaloacetate note : pyruvate decarboxylase product : pyruvate carboxylase protein_id : NP_032823.1

name	Lrfn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559904 CCDS:CCDS29431.1 GeneID:225875 MGI:2385612
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : synaptic adhesion-like molecule 3 product : leucine rich repeat and fibronectin type III domain containing 4 protein_id : NP_700437.2

name	Rce1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963507 CCDS:CCDS29432.1 GeneID:19671 MGI:1336895
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 function : proteolytic processing of prenylated proteins product : Ras and a-factor-converting enzyme 1 homolog protein_id : NP_075620.1

name	Gm960 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701969 GeneID:381196 MGI:2685806
definition	codon_start : 1 product : hypothetical protein LOC381196 protein_id : NP_001028619.1

name	Spnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55926127 CCDS:CCDS29434.1 GeneID:20743 MGI:1313261
definition	GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA] codon_start : 1 note : beta-spectrin 3 product : spectrin beta 3 protein_id : NP_067262.1

name	Rbm4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754120 CCDS:CCDS29435.1 GeneID:66704 MGI:1913954
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : 4921506I22Rik protein protein_id : NP_079993.2

name	Rbm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86262144 CCDS:CCDS29436.1 GeneID:19653 MGI:1100865
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : RNA binding motif protein 4 protein_id : NP_033058.2

name	Rbm14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86262142 CCDS:CCDS29437.1 GeneID:56275 MGI:1929092
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0000119 - mediator complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030674 - protein binding, bridging [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] [Evidence ISS]; GO:0016455 - RNA polymerase II transcription mediator activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006310 - DNA recombination [Evidence ISS]; GO:0006281 - DNA repair [Evidence ISS]; GO:0006260 - DNA replication [Evidence ISS]; GO:0030520 - estrogen receptor signaling pathway [Evidence ISS]; GO:0042921 - glucocorticoid receptor signaling pathway [Evidence ISS]; GO:0016575 - histone deacetylation [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0009725 - response to hormone stimulus [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : synaptotagmin interacting protein product : RNA binding motif protein 14 protein_id : NP_063922.2

name	Ccs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393066 CCDS:CCDS29438.1 GeneID:12460 MGI:1333783
definition	GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0005375 - copper ion transporter activity [Evidence IEA]; GO:0004785 - copper, zinc superoxide dismutase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006825 - copper ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0051353 - positive regulation of oxidoreductase activity [Evidence IMP]; GO:0006457 - protein folding [Evidence IEA]; GO:0006801 - superoxide metabolism [Evidence IEA] codon_start : 1 product : copper chaperone for superoxide dismutase protein_id : NP_058588.1

name	Ccdc87 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402285 CCDS:CCDS29439.1 GeneID:399599 MGI:3026882
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 87 protein_id : NP_997151.1

name	Ctsf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845246 CCDS:CCDS29440.1 GeneID:56464 MGI:1861434
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016946 - cathepsin F activity [Evidence IEA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : cathepsin F protein_id : NP_063914.1

name	Actn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304855 CCDS:CCDS29441.1 GeneID:11474 MGI:99678
definition	GO_component : GO:0005865 - striated muscle thin filament [Evidence TAS] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0051015 - actin filament binding [Evidence TAS] [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030674 - protein binding, bridging [Evidence TAS]; GO:0042803 - protein homodimerization activity [Evidence TAS] GO_process : GO:0006936 - muscle contraction [Evidence IPI] codon_start : 1 product : actinin alpha 3 protein_id : NP_038484.1

name	Zdhhc24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229103 GeneID:70605 MGI:1917855
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : leukocyte receptor cluster (LRC) member 4 protein_id : NP_081752.1

name	Bbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370025 CCDS:CCDS29442.1 GeneID:52028 MGI:1277215
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0016358 - dendrite development [Evidence IMP]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0001895 - retinal homeostasis [Evidence IMP]; GO:0035058 - sensory cilium biogenesis [Evidence IGI] [Evidence IMP]; GO:0007608 - sensory perception of smell [Evidence IMP] codon_start : 1 product : Bardet-Biedl syndrome 1 homolog protein_id : NP_001028300.1

name	Dpp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527018 CCDS:CCDS29443.1 GeneID:75221 MGI:1922471
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0017039 - dipeptidyl-peptidase III activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : dipeptidylpeptidase III product : dipeptidyl peptidase III protein_id : NP_598564.1

name	Peli3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982119 GeneID:240518 MGI:1924963
definition	codon_start : 1 exception : mismatches in translation product : pellino 3 protein_id : NP_766423.2

name	Mrpl11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384980 CCDS:CCDS29444.1 GeneID:66419 MGI:2137215
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence ISS]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence TAS] codon_start : 1 product : mitochondrial ribosomal protein L11 protein_id : NP_079829.1

name	Npas4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24233564 CCDS:CCDS29445.1 GeneID:225872 MGI:2664186
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : limbic-enhanced PAS protein; bHLH-PAS type transcription factor NXF product : neuronal PAS domain protein 4 protein_id : NP_705781.1

name	Slc29a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678013 GeneID:13340 MGI:1345278
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005337 - nucleoside transporter activity [Evidence IDA] GO_process : GO:0015858 - nucleoside transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : delayed early response gene 12 product : solute carrier family 29 (nucleoside transporters), member 2 protein_id : NP_031880.1

name	B3gnt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30039682 CCDS:CCDS29446.1 GeneID:108902 MGI:1919680
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008532 - N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 note : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 product : beta-1,3-N-acetylglucosaminyltransferase bGnT-6 protein_id : NP_780592.1

name	Brms1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527392 GeneID:107392 MGI:2388804
definition	GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IDA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : breast cancer metastasis-suppressor 1 protein_id : NP_598916.1

name	Rin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703974 CCDS:CCDS29447.1 GeneID:225870 MGI:2385695
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Ras and Rab interactor 1 protein_id : NP_663470.1

name	Cd248 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16923944 CCDS:CCDS29448.1 GeneID:70445 MGI:1917695
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : CD164 sialomucin-like 1; tumor endothelial marker 1 product : CD248 antigen, endosialin protein_id : NP_473383.1

name	Tmem151 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49457865 CCDS:CCDS29449.1 GeneID:381199 MGI:2147713
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC381199 protein_id : NP_001001885.1

name	Yif1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25282409 CCDS:CCDS29450.1 GeneID:68090 MGI:1915340
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : putative transmembrane protein; homolog of yeast Golgi membrane protein Yif1p (Yip1p-interacting factor) product : Yip1p-interacting factor protein_id : NP_080829.1

name	Cnih2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753470 CCDS:CCDS29451.1 GeneID:12794 MGI:1277225
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : cornichon-like product : cornichon homolog 2 protein_id : NP_034050.1

name	Rab1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313162 CCDS:CCDS29452.1 GeneID:76308 MGI:1923558
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB1B, member RAS oncogene family protein_id : NP_083852.1

name	Klc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778983 GeneID:16594 MGI:107953
definition	GO_component : GO:0035253 - ciliary rootlet [Evidence IDA] [Evidence IPI]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008088 - axon cargo transport [Evidence IMP] codon_start : 1 product : kinesin light chain 2 protein_id : NP_032477.2

name	Pacs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54291704 CCDS:CCDS29453.1 GeneID:107975 MGI:1277113
definition	GO_component : GO:0030137 - COPI-coated vesicle [Evidence IDA] GO_process : GO:0000042 - protein targeting to Golgi [Evidence IDA] codon_start : 1 note : cytosolic sorting protein PACS-1 product : phosphofurin acidic cluster sorting protein 1 protein_id : NP_694769.2

name	Sf3b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794206 CCDS:CCDS29454.1 GeneID:319322 MGI:2441856
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation product : splicing factor 3b, subunit 2 protein_id : NP_084385.1

name	Gal3st3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701542 CCDS:CCDS29455.1 GeneID:545276 MGI:3617843
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001733 - galactosylceramide sulfotransferase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : galactose-3-O-sulfotransferase 3 protein_id : NP_001019888.1

name	Catsper1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314844 CCDS:CCDS29456.1 GeneID:225865 MGI:2179947
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0007342 - fusion of sperm to egg plasma membrane [Evidence IMP]; GO:0030317 - sperm motility [Evidence IMP] codon_start : 1 note : sperm ion channel product : cation channel of sperm 1 protein_id : NP_647462.1

name	Cst6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312060 CCDS:CCDS29457.1 GeneID:73720 MGI:1920970
definition	GO_component : GO:0001533 - cornified envelope [Evidence IDA] GO_process : GO:0008544 - epidermis development [Evidence IMP] codon_start : 1 note : cystatin M; harlequin ichthysosis; harlequin ichthyosis product : cystatin E/M protein_id : NP_082899.1

name	Banf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84042521 CCDS:CCDS29458.1 GeneID:23825 MGI:1346330
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence TAS] [Evidence IDA] GO_process : GO:0015074 - DNA integration [Evidence IDA]; GO:0019047 - provirus integration [Evidence TAS] codon_start : 1 note : breakpoint cluster region protein 1; LAP2 binding protein 1 product : barrier to autointegration factor 1 protein_id : NP_001033320.1

name	Banf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753178 CCDS:CCDS29458.1 GeneID:23825 MGI:1346330
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence TAS] [Evidence IDA] GO_process : GO:0015074 - DNA integration [Evidence IDA]; GO:0019047 - provirus integration [Evidence TAS] codon_start : 1 note : breakpoint cluster region protein 1; LAP2 binding protein 1 product : barrier to autointegration factor 1 protein_id : NP_035923.1

name	2010003J03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037183 CCDS:CCDS29459.1 GeneID:69860 MGI:1917110
definition	GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69860 protein_id : NP_081512.1

name	Sart1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244096 CCDS:CCDS29460.1 GeneID:20227 MGI:1309453
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : squamous cell carcinoma antigen recognized by T-cells 1 protein_id : NP_058578.3

name	EG622178 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82997807 GeneID:622178 MGI:3649011
definition	codon_start : 1 product : similar to RIKEN cDNA 1110020P15 gene protein_id : XP_891680.1

name	Drap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313424 CCDS:CCDS29462.1 GeneID:66556 MGI:1913806
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IDA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Dr1 associated protein 1 (negative cofactor 2 alpha) protein_id : NP_077138.1

name	AI837181 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527386 CCDS:CCDS29463.1 GeneID:107242 MGI:2147598
definition	codon_start : 1 product : basophilic leukemia expressed protein protein_id : NP_598910.1

name	Fosl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753896 CCDS:CCDS29464.1 GeneID:14283 MGI:107179
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : fos-like antigen 1 protein_id : NP_034365.1

name	Ccdc85b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348478 GeneID:240514 MGI:2147607
definition	codon_start : 1 product : coiled-coil domain containing 85B protein_id : NP_941018.1

name	Fibp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946808 GeneID:58249 MGI:1926233
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0017134 - fibroblast growth factor binding [Evidence IEA] codon_start : 1 note : aFGF intracellular binding protein product : FGF intracellular binding protein protein_id : NP_067413.1

name	Ctsw (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981819 CCDS:CCDS29465.1 GeneID:13041 MGI:1338045
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : cathepsin W preproprotein protein_id : NP_034115.2

name	Efemp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982690 CCDS:CCDS29466.1 GeneID:58859 MGI:1891209
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : EGF-containing fibulin-like extracellular matrix protein 2 (Efemp2); fibulin 4; fibulin-4 product : epidermal growth factor-containing fibulin-like extracellular matrix protein 2 protein_id : NP_067449.2

name	Mus81 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980667 CCDS:CCDS29467.1 GeneID:71711 MGI:1918961
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006259 - DNA metabolism [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA] [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MUS81 endonuclease protein_id : NP_082153.2

name	Cfl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680924 GeneID:12631 MGI:101757
definition	GO_component : GO:0030864 - cortical actin cytoskeleton [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0007015 - actin filament organization [Evidence IMP]; GO:0006928 - cell motility [Evidence IMP]; GO:0000910 - cytokinesis [Evidence IMP]; GO:0030010 - establishment of cell polarity [Evidence IMP]; GO:0001755 - neural crest cell migration [Evidence IMP]; GO:0001842 - neural fold formation [Evidence IMP]; GO:0030836 - positive regulation of actin filament depolymerization [Evidence IMP] codon_start : 1 product : cofilin 1, non-muscle protein_id : NP_031713.1

name	B930037P14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66792896 CCDS:CCDS29468.1 GeneID:225861 MGI:2444704
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC225861 protein_id : NP_001019731.1

name	1700020D05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981318 GeneID:75555 MGI:1922805
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : mage-g2 protein protein_id : NP_076270.2

name	Ovol1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910472 CCDS:CCDS29469.1 GeneID:18426 MGI:1330290
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008544 - epidermis development [Evidence IMP]; GO:0007498 - mesoderm development [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0000239 - pachytene [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : OVO homolog-like 1 protein_id : NP_064319.1

name	Gm962 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677454 CCDS:CCDS29470.1 GeneID:381201 MGI:2685808
definition	codon_start : 1 product : hypothetical protein LOC381201 protein_id : NP_001028620.1

name	Rnaseh2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386102 CCDS:CCDS29471.1 GeneID:68209 MGI:1915459
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : AYP1 protein protein_id : NP_080892.1

name	Htatip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519991 CCDS:CCDS29472.1 GeneID:81601 MGI:1932051
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004402 - histone acetyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Tat-interactive protein-60; mHTATIP/CPLA2; HIV-1 tat interactive protein 1, homolog; HIV-1 tat interactive protein 1, 60 kDa homolog product : HIV-1 tat interactive protein, homolog protein_id : NP_848752.1

name	Rela (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677709 CCDS:CCDS29473.1 GeneID:19697 MGI:103290
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence TAS] GO_process : GO:0051092 - activation of NF-kappaB transcription factor [Evidence ISS]; GO:0006952 - defense response [Evidence IMP]; GO:0001942 - hair follicle development [Evidence IMP]; GO:0001889 - liver development [Evidence IMP]; GO:0042177 - negative regulation of protein catabolism [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045084 - positive regulation of interleukin-12 biosynthesis [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : p65 NF-kappa B; p65 NFkB; avian reticuloendotheliosis viral (v-rel) oncogene homolog A; p65 NF kappaB product : v-rel reticuloendotheliosis viral oncogene homolog A protein_id : NP_033071.1

name	Sipa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61556720 CCDS:CCDS29474.1 GeneID:20469 MGI:107576
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0046582 - Rap GTPase activator activity [Evidence ISS] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0007162 - negative regulation of cell adhesion [Evidence ISS]; GO:0030308 - negative regulation of cell growth [Evidence ISS]; GO:0045786 - negative regulation of progression through cell cycle [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA] codon_start : 1 exception : mismatches in translation product : signal-induced proliferation associated gene 1 protein_id : NP_035509.3

name	Pcnxl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450095 CCDS:CCDS29475.1 GeneID:104401 MGI:1861733
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : pecanex-like 3 protein_id : NP_659117.1

name	Map3k11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543234 CCDS:CCDS29476.1 GeneID:26403 MGI:1346880
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0046328 - regulation of JNK cascade [Evidence IDA] codon_start : 1 note : mixed lineage kinase 3 product : mitogen activated protein kinase kinase kinase 11 protein_id : NP_071295.2

name	Kcnk7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51944955 CCDS:CCDS29477.1 GeneID:16530 MGI:1341841
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0005267 - potassium channel activity [Evidence IEA] [Evidence ISS]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : potassium channel, subfamily K, member 7 isoform a protein_id : NP_034739.2

name	Kcnk7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51944957 GeneID:16530 MGI:1341841
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0005267 - potassium channel activity [Evidence IEA] [Evidence ISS]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : potassium channel, subfamily K, member 7 isoform b protein_id : NP_001004138.1

name	Ehbp1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158693 GeneID:114601 MGI:3612340
definition	codon_start : 1 product : tangerin protein_id : NP_444482.2

name	Mtvr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963547 GeneID:17826 MGI:106595
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : mammary tumor virus receptor 2 isoform 2 protein_id : NP_075655.1

name	Mtvr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31324534 GeneID:17826 MGI:106595
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : mammary tumor virus receptor 2 isoform 1 protein_id : NP_852117.1

name	Sssca1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543773 CCDS:CCDS29479.1 GeneID:56390 MGI:1913482
definition	GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : C184L-22 protein_id : NP_065237.3

name	Ltbp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487415 GeneID:16998 MGI:1101355
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence ISS]; GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0019838 - growth factor binding [Evidence IEA] GO_process : GO:0001501 - skeletal development [Evidence IMP]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IPI] [Evidence IMP] codon_start : 1 product : latent transforming growth factor beta binding protein 3 protein_id : NP_032546.2

name	Scyl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963867 CCDS:CCDS29480.1 GeneID:78891 MGI:1931787
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : ubiquitous protein kinase-like (105 kDa); N-terminal kinase-like product : SCY1-like 1 protein_id : NP_076401.1

name	1200004M23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385676 CCDS:CCDS29481.1 GeneID:67457 MGI:1914707
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : FKSG44 homolog protein_id : NP_080445.1

name	Slc25a45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956272 CCDS:CCDS29482.1 GeneID:107375 MGI:2147731
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : solute carrier family 25, member 45 protein_id : NP_598915.1

name	Tigd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348510 CCDS:CCDS29483.1 GeneID:332359 MGI:2681860
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : tigger transposable element derived 3 protein_id : NP_941036.1

name	Dpf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755314 GeneID:19708 MGI:109529
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : requiem; neuro-d4/requiem product : D4, zinc and double PHD fingers family 2 protein_id : NP_035392.1

name	Cdc42ep2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779864 CCDS:CCDS29484.1 GeneID:104252 MGI:1929744
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0001515 - opioid peptide activity [Evidence IPI] GO_process : GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 note : Cdc42 effector protein 2 product : CDC42 effector protein (Rho GTPase binding) 2 protein_id : NP_081048.1

name	LOC100039337 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039337
definition	number : 3 pseudo : _no_value

name	LOC100039337 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039337
definition	number : 2 pseudo : _no_value

name	LOC100039337 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039337
definition	number : 1 pseudo : _no_value

name	EG631868 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631868
definition	number : 1 pseudo : _no_value

name	EG631868 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631868
definition	number : 2 pseudo : _no_value

name	LOC383424 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270268 GeneID:383424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 13 Proteins product : similar to HNRPF protein pseudo : _no_value transcript_id : XR_034922.1

name	Tsga10ip (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270269 GeneID:78306 MGI:1925556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : testis specific 10 interacting protein transcript_id : XR_034927.1

name	LOC383425 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270259 GeneID:383425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 191 ESTs, 5 Proteins product : similar to nucleolar protein 5A pseudo : _no_value transcript_id : XR_031076.1

name	2310043N10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270260 GeneID:66961 MGI:1914211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 254 ESTs product : RIKEN cDNA 2310043N10 gene transcript_id : XR_035482.1

clone name	MSMg01-356E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487H08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-491I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319D05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-082J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-539N05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-395L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417L15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-512N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518C18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247I02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-064F13.b	B6Ng01-064F13.g
ACC	DH884163	DH884164
length	1,072	980
definition	DH884163\|Mus musculus domesticus DNA, BAC clone: B6Ng01-064F13, 5' end.	DH884164\|Mus musculus domesticus DNA, BAC clone: B6Ng01-064F13, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(4,928,365 - 4,929,450)	(4,755,662 - 4,756,645)
sequence	gaattcccccttataatgacactcaccaatcagaaccaagagctactagc gctgtggtgacaaggctggccttaagcacatggttgctctggcccctcta aataggcaaggtaaggaaggtgtgttggatttcagtcccgaaacactacc tcctacacaactctaggggacagcactacctcttgatggctgcccatccc ttgggtagacttagtcctgaagtaaagctgacagtgttccagagtaagag aagtgagctatctaaagtcacacagctggtaggagacagacatctgattg aaccctagacagcctaagtcaggccccagctctttgcagtgcttaccaca tctggtcagcaagtacttgcaagagccatgggtcacccagaaagactcct ccctgactaccaagagtaaacaacatgcttgtctgcatcctgggctgccc tccagtcaatgtcactggagaccgcttttctattctagctggcaagtggt cacactaagaaagtgccagctactagctggcctcgacttcaagtgcgttg aggaaactggggttcccaatgttttaaggatggcttccatggcgacccag tggagcacctgtagcatttttctgcacccctgggactactggtggatggg actactattcgcacagcctacatacactctttgtaagagcttcgtagtct ccaaatagcatctccaaatcctaaatccagggaggagggggtccacatta ttatagtcttctctaagtggaggttcctaactgccaaatccagtgtaggg acactggaggtgaaaccccaaagagagcagctcccagctacatgtgtgga ggctcccgatgtataggaactctcacgtttggggactttgtcagtcccct ctgtcggtacccgacagcagccacgcgggtactgagaaactcaaactttt cacaaacatcgcctacgcacgcctctgtgcatgaggccagcagacaaagg ccaagctcgcggtcttgcaagcagcaccacccgtagcgcttgggggcggg gaaaaaatagaggggagaactg	gaattcaatccctcaatgtctgtaagcccgctgctttgtgatagtgatcc accaagctggtaccctgcttgccaccaggaggtgcccttggaccgcaaca gagagtctggagcctgacaattgcctgtgcctcaggcagcttgggacgga tgcggaacccttgtcactcattccccaaacctggattctccctggacctc tggacaacgtattccttggtaatgctcaccacatttcaggaaccaggata gacagatactacgagggaaagccagcccacgtatattcatgaataaacat gacaaagtatagtttggatagagaaatgcctccctcagacctaacctagt tctaacccagattatctttctactccactctcagtctcagcttcttcacc aatgaacaacactatgccctaggaaaattaaattgttttacgggaattct taccccttcctacccaaacaagggagagattaggttaagatgtggtagtg cctgggtttctgaagtatcgctctcagcagccagaggttgagaaaacccc cttctagcgggcccagtgacacaaccctttgtcatcagccccctcgacag tgcgcccaataccacgatccattgtgatgcttagagactcccccgggcct tacggttttgccaaggcaatggttgcttcctgagcccccttgacgcgcaa gccgcgacccactcccaaggcggtgattggctagcccgggctgggggcgg gctgaccttcgctccgcagtgccgttcaccacatgaccccgcccccgcac gggggcggacagttgtgtgcggccgcaggattggtcgccccgctcctgcg agggggagggggaggcaggcagcgcgactcgcgcgtgctgagctggcgcg cgagaaagcgcccggtcgcgccgagcctcgagcggccttcgcattttgta aggtctctctgacgcggacccgccgcaccg
quality values	Open. Hide. 42 34 17 35 53 61 50 50 50 52 52 43 43 50 43 50 35 35 50 45 35 49 43 38 43 50 9 11 16 11 14 8 7 20 13 12 15 37 36 34 59 52 59 59 52 52 52 49 38 45 41 59 59 59 59 59 49 52 59 59 59 49 52 52 61 45 59 59 59 36 49 36 31 27 29 18 29 29 31 45 52 59 59 59 59 59 59 59 59 59 59 59 52 59 59 55 61 61 59 59 61 59 61 59 59 61 59 59 61 59 61 59 59 59 59 55 55 59 59 61 59 61 61 61 61 61 61 59 61 61 59 59 59 40 37 59 59 59 59 43 59 52 52 59 52 59 59 59 61 61 61 61 61 59 59 59 49 59 52 59 59 61 59 59 49 52 59 59 59 61 59 52 52 59 52 59 59 59 59 59 59 59 59 59 59 59 59 59 59 52 59 59 59 59 59 52 59 59 59 59 59 59 61 59 59 59 59 49 59 59 59 59 52 43 59 59 59 59 59 59 59 37 59 52 52 59 49 49 59 52 59 49 41 44 52 59 59 59 59 59 52 39 61 45 59 59 59 49 61 49 59 59 52 59 59 59 59 59 61 59 61 59 59 59 59 59 59 59 59 52 59 52 59 52 49 59 59 61 59 49 52 37 59 59 52 61 59 52 36 59 52 43 59 49 59 59 59 59 59 59 59 59 59 59 59 59 59 35 59 59 52 52 52 59 59 52 52 41 59 52 52 36 61 59 59 59 59 59 43 59 61 61 55 55 61 55 55 55 49 55 61 55 61 55 55 55 55 52 55 52 61 55 55 55 61 52 55 55 52 52 52 52 52 55 55 61 55 55 55 52 52 52 52 61 49 52 55 52 55 55 52 52 52 52 52 52 52 52 52 37 61 55 50 50 61 55 55 61 61 61 61 61 50 50 55 55 47 55 50 50 41 41 33 33 55 49 43 49 50 50 50 41 55 55 47 55 55 61 61 61 61 61 55 55 55 55 49 55 55 61 61 61 55 61 55 61 61 55 61 61 61 61 61 61 50 53 53 50 53 61 61 50 52 50 53 53 61 50 47 37 61 53 50 53 61 61 61 61 61 61 47 50 61 61 61 61 53 61 53 53 50 61 45 50 50 50 52 61 43 43 50 50 52 50 52 52 39 52 39 61 50 61 42 30 42 53 61 61 47 61 61 53 52 50 47 27 50 50 53 61 61 61 61 61 45 53 61 61 53 53 43 46 47 53 53 53 39 40 43 38 46 38 39 47 47 53 45 53 53 47 47 53 45 53 53 53 53 35 50 53 53 35 53 50 47 43 47 38 42 45 39 53 57 45 57 57 53 47 42 53 53 53 50 38 47 40 47 47 47 38 52 53 50 53 32 53 45 53 53 57 50 50 50 45 50 28 53 46 41 57 57 52 38 38 38 38 47 53 57 52 52 39 53 47 47 42 53 45 53 50 50 50 45 47 44 39 26 47 57 57 53 32 50 36 48 38 31 38 57 43 21 52 52 52 37 35 36 43 39 34 40 30 57 32 42 30 50 50 41 29 57 57 53 21 12 47 24 52 24 53 53 38 57 36 36 37 18 37 52 30 38 16 9 21 42 42 36 30 50 24 40 52 42 44 53 14 53 42 38 50 52 34 30 53 37 39 40 53 30 33 53 52 37 23 34 38 10 57 46 46 39 19 53 37 24 34 20 25 34 29 28 52 27 40 37 18 18 52 32 33 37 33 37 26 34 35 16 28 27 13 20 13 30 14 34 29 32 27 16 51 35 33 40 31 41 29 33 31 28 27 29 28 17 4 18 13 28 17 46 21 35 31 30 27 24 29 26 24 6 36 22 27 30 47 31 29 47 44 15 14 30 29 22 26 10 31 17 23 7 8 8 18 33 51 29 28 9 28 32 31 34 19 35 33 26 29 26 14 25 7 5 32 17 37 39 48 29 21 27 14 29 27 14 29 21 20 8 25 13 20 29 28 28 26 15 29 28 28 29 26 23 39 39 25 29 8 5 9 31 30 14 28 27 17 25 33 46 46 20 27 21 29 27 31 38 24 31 22 22 33 51 39 29 29 12 6 8 25 21 18 29 28 15 16 10 25 30 36 29 18 27 29 20 27 18 16 24 46 33 16 12 33 25 41 21 29 43 38 31 31 7 7 30 7 38 12 12 6 7 18 7 15 19 9 17 15 12 32 11 19 8 30 15 31 16 10 10 9 21 13 29 9 9 7 5 19 7 21 27 12 14 9 5 8 10 26 28 13 11 15 7 18 19 14 19 11 11 18 5 5 9 14 7 34 15 28 24 11 17 13 22 6 20 14 5 9 27 14 15 9 34 31 20 16 25 10 17 13 23 12 7 12 34 34 34 18 12 9 30 21 11 16 9 8 17 12 7 4 6 6 6 6 10 29 17 10 3 7 18 10 7 4	Open. Hide. 43 61 37 49 55 40 38 19 16 35 22 13 26 8 13 12 18 59 52 52 59 59 59 45 41 44 49 52 52 45 52 59 59 59 59 55 55 52 52 59 59 59 44 37 52 59 59 59 52 59 28 36 36 18 18 18 22 27 35 55 52 52 59 61 59 59 61 52 59 61 59 59 59 52 59 59 52 49 43 59 59 61 59 61 59 59 59 59 59 59 59 59 59 59 49 52 49 45 52 52 29 55 32 59 52 59 59 59 59 59 59 52 59 59 50 55 44 52 45 59 59 59 59 52 59 59 61 59 59 59 59 59 59 59 37 61 59 59 49 59 59 59 59 52 59 59 59 52 59 61 59 59 59 44 59 61 59 59 59 59 59 59 59 59 59 59 59 55 59 52 59 59 59 59 59 59 59 59 61 59 59 52 59 45 59 59 59 61 61 61 59 59 59 59 50 59 59 59 59 59 59 59 55 59 59 52 59 59 49 59 59 59 59 59 59 59 59 59 52 59 59 59 59 59 52 59 59 49 52 52 52 59 52 59 59 59 52 41 37 61 59 52 52 49 38 30 36 59 52 52 37 59 49 49 37 59 52 39 52 52 45 49 26 59 45 59 52 59 59 59 52 52 59 49 44 52 59 59 52 52 41 59 59 61 61 59 59 59 52 59 59 61 59 59 59 59 59 59 49 59 59 59 52 49 59 59 52 59 59 59 59 49 59 59 59 61 59 61 59 59 59 61 59 61 61 59 59 61 61 61 61 61 61 52 59 52 44 30 61 59 59 59 52 59 59 52 59 52 43 52 59 59 59 59 59 59 59 52 36 31 59 59 59 61 61 61 61 55 59 59 59 59 61 59 59 59 59 59 61 59 59 59 52 43 59 59 52 49 35 24 49 52 61 52 59 59 59 36 59 59 49 52 59 59 59 59 52 43 43 49 37 38 24 12 5 9 4 4 4 4 6 9 7 15 23 59 52 61 55 55 52 55 55 55 61 61 61 61 61 61 61 55 55 50 55 55 49 55 61 61 47 55 61 61 61 61 61 61 61 55 55 55 55 55 55 55 55 55 61 55 61 55 61 61 61 55 61 50 61 39 40 55 55 61 55 55 61 61 55 61 61 55 48 55 55 50 55 55 61 61 55 61 61 61 55 61 61 55 61 61 61 55 61 61 41 61 50 61 61 55 55 61 61 61 43 55 23 61 53 35 50 43 43 35 50 31 50 38 43 34 37 43 50 50 50 39 39 43 50 50 50 47 61 50 45 50 36 45 42 50 50 38 38 42 35 32 39 45 47 42 43 52 47 50 50 61 50 61 61 43 61 35 39 42 53 52 50 27 43 53 61 61 61 50 43 27 39 33 27 38 34 45 45 31 52 50 30 13 47 52 38 43 43 45 50 45 37 33 43 50 27 43 39 50 32 40 38 21 42 38 47 30 45 33 53 45 45 33 42 52 57 53 53 53 24 47 47 23 38 42 40 33 33 27 37 36 47 57 42 30 16 28 18 24 20 47 27 35 28 31 43 36 32 30 33 33 36 36 34 52 33 34 42 11 50 53 53 53 45 53 12 25 41 20 33 38 28 42 42 50 27 38 52 45 41 21 42 22 50 24 22 30 52 53 52 52 26 16 18 39 30 38 29 21 42 42 33 14 23 17 14 40 38 24 39 53 50 37 57 57 29 17 7 46 53 53 38 23 28 53 34 30 29 28 29 13 27 27 32 36 22 30 32 30 41 23 33 26 10 17 37 24 38 16 9 7 26 27 41 41 29 38 19 32 27 34 30 57 57 43 21 14 57 57 57 53 28 36 32 32 40 37 37 37 45 35 25 20 37 14 28 18 39 25 23 24 38 31 35 25 22 29 29 37 23 20 24 12 25 11 7 41 18 27 21 40 14 33 47 57 35 17 29 33 40 32 28 36 25 10 41 28 40 26 38 23 14 6 37 47 39 12 30 8 40 19 26 8 9 5 17 15 27 9 12 7 7 9 23 48 17 11 11 29 15 28 36 9 8 8 23 14 33 29 47 17 16 10 7 7 9 6 23 11 7 51 44 6 7 5 7 17 14 13 18 7 10 10 29 15 13 29 8 15 14 9 12 21 20 6 9 15 14 29 18 10 12 9 8 18 11 13 6 30 29 24 29 14 11 5 11 29 34 30 10 11 10 14 15 11 17 29 15 20 11 18 16 26 8 36 17 28 31 21 10 7 8 17 26 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_4928365_4929450
seq2: B6Ng01-064F13.b_46_1117 (reverse)

seq1  CAGTTCCTCCCCTC-ATCTTCTCCCCGCCCCCAAGCGCTACGGGTGGTGC  49
      ||||| |||||||| || || |||||||||||||||||||||||||||| 
seq2  CAGTT-CTCCCCTCTATTTTTTCCCCGCCCCCAAGCGCTACGGGTGGTG-  48

seq1  CTGCCTTGCAAGGACCGCGAGGCCTTGGCCTTTTGTCTGCTGGCCCTCAC  99
      ||| ||||||| |||||||||  ||||||| |||||||||||| ||||| 
seq2  CTG-CTTGCAA-GACCGCGAG--CTTGGCC-TTTGTCTGCTGG-CCTCA-  91

seq1  TGCACAGAGGCGTGGCGTAGGGCGATGTTTGGTGAAAAAGTTTGAGTTTC  149
      ||||||||||||| ||||| |||||||||| ||| |||||||||||||||
seq2  TGCACAGAGGCGT-GCGTA-GGCGATGTTT-GTG-AAAAGTTTGAGTTTC  137

seq1  TCAGTACCCCGCGTGGCTGCTGTCGGGTACCGACAGAGGGGACTGACAAG  199
      |||||| |||||||||||||||||||||||||||||||||||||||||| 
seq2  TCAGTA-CCCGCGTGGCTGCTGTCGGGTACCGACAGAGGGGACTGACAAA  186

seq1  GTCCCCAAACGTGAGAGTTCCTATACATCGGGAGCCTCCACACATGTAGC  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCCCAAACGTGAGAGTTCCTATACATCGGGAGCCTCCACACATGTAGC  236

seq1  TGGGAGCCTGCTCTCTTTGGGGTTTCACCTCCAGTGTCCCTACCCTGGAT  299
      |||||| |||||||||||||||||||||||||||||||||||| ||||||
seq2  TGGGAG-CTGCTCTCTTTGGGGTTTCACCTCCAGTGTCCCTACACTGGAT  285

seq1  TTGGCAGTTAGGAACCTCCACTTAGAGAAGACTATAATAATGTGGACCCC  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGCAGTTAGGAACCTCCACTTAGAGAAGACTATAATAATGTGGACCCC  335

seq1  CTCCTCCCTGGATTTAGGATTTGGAGATGCTATTTGGAGACTACGAAGCT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTCCCTGGATTTAGGATTTGGAGATGCTATTTGGAGACTACGAAGCT  385

seq1  CTTACAAAGAGTGTATGTAGGCTGTGCGAATAGTAGTCCCATCCACCAGT  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACAAAGAGTGTATGTAGGCTGTGCGAATAGTAGTCCCATCCACCAGT  435

seq1  AGTCCCAGGGGTGCAGAAAAATGCTACAGGTGCTCCACTGGGTCGCCATG  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCCAGGGGTGCAGAAAAATGCTACAGGTGCTCCACTGGGTCGCCATG  485

seq1  GAAGCCATCCTTAAAACATTGGGAACCCCAGTTTCCTCAACGCACTTGAA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCCATCCTTAAAACATTGGGAACCCCAGTTTCCTCAACGCACTTGAA  535

seq1  GTCGAGGCCAGCTAGTAGCTGGCACTTTCTTAGTGTGACCACTTGCCAGC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCGAGGCCAGCTAGTAGCTGGCACTTTCTTAGTGTGACCACTTGCCAGC  585

seq1  TAGAATAGAAAAGCGGTCTCCAGTGACATTGACTGGAGGGCAGCCCAGGA  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAATAGAAAAGCGGTCTCCAGTGACATTGACTGGAGGGCAGCCCAGGA  635

seq1  TGCAGACAAGCATGTTGTTTACTCTTGGTAGTCAGGGAGGAGTCTTTCTG  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGACAAGCATGTTGTTTACTCTTGGTAGTCAGGGAGGAGTCTTTCTG  685

seq1  GGTGACCCATGGCTCTTGCAAGTACTTGCTGACCAGATGTGGTAAGCACT  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGACCCATGGCTCTTGCAAGTACTTGCTGACCAGATGTGGTAAGCACT  735

seq1  GCAAAGAGCTGGGGCCTGACTTAGGCTGTCTAGGGTTCAATCAGATGTCT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAGAGCTGGGGCCTGACTTAGGCTGTCTAGGGTTCAATCAGATGTCT  785

seq1  GTCTCCTACCAGCTGTGTGACTTTAGATAGCTCACTTCTCTTACTCTGGA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTCCTACCAGCTGTGTGACTTTAGATAGCTCACTTCTCTTACTCTGGA  835

seq1  ACACTGTCAGCTTTACTTCAGGACTAAGTCTACCCAAGGGATGGGCAGCC  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACTGTCAGCTTTACTTCAGGACTAAGTCTACCCAAGGGATGGGCAGCC  885

seq1  ATCAAGAGGTAGTGCTGTCCCCTAGAGTTGTGTAGGAGGTAGTGTTTCGG  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAAGAGGTAGTGCTGTCCCCTAGAGTTGTGTAGGAGGTAGTGTTTCGG  935

seq1  GACTGAAATCCAACACACCTTCCTTACCTTGCCTATTTAGAGGGGCCAGA  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGAAATCCAACACACCTTCCTTACCTTGCCTATTTAGAGGGGCCAGA  985

seq1  GCAACCATGTGCTTAAGGCCAGCCTTGTCACCACAGCGCTAGTAGCTCTT  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAACCATGTGCTTAAGGCCAGCCTTGTCACCACAGCGCTAGTAGCTCTT  1035

seq1  GGTTCTGATTGGTGAGTGTCATTATAAGGGGGAATTC  1086
      |||||||||||||||||||||||||||||||||||||
seq2  GGTTCTGATTGGTGAGTGTCATTATAAGGGGGAATTC  1072

seq1: chr19_4755662_4756645
seq2: B6Ng01-064F13.g_68_1047

seq1  GAATTCAATCCCTCAATGTCTGTAAGCCCGCTGCTTTGTGATAGTGATCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAATCCCTCAATGTCTGTAAGCCCGCTGCTTTGTGATAGTGATCC  50

seq1  ACCAAGCTGGTACCCTGCTTGCCACCAGGAGGTGCCCTTGGACCGCAACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAAGCTGGTACCCTGCTTGCCACCAGGAGGTGCCCTTGGACCGCAACA  100

seq1  GAGAGTCTGGAGCCTGACAATTGCCTGTGCCTCAGGCAGCTTGGGACGGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGTCTGGAGCCTGACAATTGCCTGTGCCTCAGGCAGCTTGGGACGGA  150

seq1  TGCGGAACCCTTGTCACTCATTCCCCAAACCTGGATTCTCCCTGGACCTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCGGAACCCTTGTCACTCATTCCCCAAACCTGGATTCTCCCTGGACCTC  200

seq1  TGGACAACGTATTCCTTGGTAATGCTCACCACATTTCAGGAACCAGGATA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGACAACGTATTCCTTGGTAATGCTCACCACATTTCAGGAACCAGGATA  250

seq1  GACAGATACTACGAGGGAAAGCCAGCCCACGTATATTCATGAATAAACAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGATACTACGAGGGAAAGCCAGCCCACGTATATTCATGAATAAACAT  300

seq1  GACAAAGTATAGTTTGGATAGAGAAATGCCTCCCTCAGACCTAACCTAGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAAAGTATAGTTTGGATAGAGAAATGCCTCCCTCAGACCTAACCTAGT  350

seq1  TCTAACCCAGATTATCTTTCTACTCCACTCTCAGTCTCAGCTTCTTCACC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAACCCAGATTATCTTTCTACTCCACTCTCAGTCTCAGCTTCTTCACC  400

seq1  AATGAACAACACTATTGCAGT--GAAAATTAAATTGTTTTACGGGAATTC  448
      |||||||||||||| |||  |  |||||||||||||||||||||||||||
seq2  AATGAACAACACTA-TGCCCTAGGAAAATTAAATTGTTTTACGGGAATTC  449

seq1  TTACCCCTTCCTACCCAAACAAGGGAGAGATTAGGTTAAGATGTGGTAGT  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCCCTTCCTACCCAAACAAGGGAGAGATTAGGTTAAGATGTGGTAGT  499

seq1  GCCTGGGTTTCTGAAGTATCGCTCTCAGCAGCCAGAGGTTGAGAAAACCC  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGGGTTTCTGAAGTATCGCTCTCAGCAGCCAGAGGTTGAGAAAACCC  549

seq1  CCTTCTAGCGGGCCCAGTGACACAACCCTTTGTCATCAGCCCCCTCGACA  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCTAGCGGGCCCAGTGACACAACCCTTTGTCATCAGCCCCCTCGACA  599

seq1  GTGCGCCCAATACCACGATCCATTGTGATGCTTAGAGACTCCCCCGGGCC  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCGCCCAATACCACGATCCATTGTGATGCTTAGAGACTCCCCCGGGCC  649

seq1  TTACGGTTTTGCCAAGGCAATGGTTGCTTCCTGAGCCCCCTTGACGCGCA  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACGGTTTTGCCAAGGCAATGGTTGCTTCCTGAGCCCCCTTGACGCGCA  699

seq1  AGCCGCGACCCACTCCCAAGGCGGTGATTGGCTAGCCCGGGCTGGGGGCG  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCGCGACCCACTCCCAAGGCGGTGATTGGCTAGCCCGGGCTGGGGGCG  749

seq1  GGCTGACCTTCGCTCCGCAGTGCCG-TCACCACATGACCCCGCCCCCGCA  797
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  GGCTGACCTTCGCTCCGCAGTGCCGTTCACCACATGACCCCGCCCCCGCA  799

seq1  CGGGGGGCGGACAGTTGTGTGCGGCCGCAGGATTGGTCGCCCCGCTCCTG  847
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  C-GGGGGCGGACAGTTGTGTGCGGCCGCAGGATTGGTCGCCCCGCTCCTG  848

seq1  CGAGGGGGA-GGGGAGGCAGGCAGCGCGCACTCGCGCGTGCGTGAGCTGG  896
      ||||||||| |||||||||||||||||| |||||||||||| ||||||||
seq2  CGAGGGGGAGGGGGAGGCAGGCAGCGCG-ACTCGCGCGTGC-TGAGCTGG  896

seq1  CGCGCGAGAAAGCGCCCGGTCGCGCCGAGGCTCGAGCGGCCGTCGCCATT  946
      ||||||||||||||||||||||||||||| ||||||||||| ||| ||||
seq2  CGCGCGAGAAAGCGCCCGGTCGCGCCGAGCCTCGAGCGGCCTTCG-CATT  945

seq1  TTGTAGGGTTCTCTCTGACGCGGGACCCGCCGCCACCG  984
      ||||| || |||||||||||| |||||||||| |||||
seq2  TTGTAAGG-TCTCTCTGACGC-GGACCCGCCG-CACCG  980

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information