MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-194J10
Chromosome	19 (Build37)
Map Location	56,974,434 - 57,159,126
singlet/doublet	doublet
Overlap gene	Vwa2, Afap1l2, Ablim1
Upstream gene	Tcf7l2, LOC100043484, Habp2, Nrap, Casp7, 9930023K05Rik, Dclre1a, Nhlrc2, Adrb1, EG629643, A630007B06Rik, 1700010L13Rik, Tdrd1
Downstream gene	EG668259, AI450540, Trub1, LOC100043038, Atrnl1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tcf7l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21416 MGI:1202879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Habp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226243 MGI:1196378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18175 MGI:1098765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Casp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12369 MGI:109383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9930023K05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226245 MGI:2443041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dclre1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55947 MGI:1930042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nhlrc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66866 MGI:1914116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adrb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11554 MGI:87937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG629643 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629643 MGI:3648860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins

name	A630007B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213993 MGI:2445022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700010L13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75628 MGI:1922878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Tdrd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83561 MGI:1933218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Vwa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240675 MGI:2684334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Afap1l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226250 MGI:2147658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ablim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226251 MGI:1194500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668259 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668259 MGI:3644656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	AI450540 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226252 MGI:2147545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trub1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72133 MGI:1919383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043038 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043038
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Atrnl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226255 MGI:2147749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcf7l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543848 GeneID:21416 MGI:1202879
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 7-like 2, T-cell specific, HMG-box transcript_id : NM_009333.2

name	LOC100043484 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270578 GeneID:100043484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043484 transcript_id : XM_001480640.1

name	Habp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122612 GeneID:226243 MGI:1196378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronic acid binding protein 2 transcript_id : NM_146101.1

name	Nrap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606371 GeneID:18175 MGI:1098765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nebulin-related anchoring protein transcript_id : NM_198059.2

name	Nrap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606367 GeneID:18175 MGI:1098765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nebulin-related anchoring protein transcript_id : NM_008733.3

name	Casp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891757 GeneID:12369 MGI:109383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase 7 transcript_id : NM_007611.2

name	9930023K05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803052 GeneID:226245 MGI:2443041
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9930023K05 gene transcript_id : NM_172641.2

name	Dclre1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145468 GeneID:55947 MGI:1930042
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA cross-link repair 1A, PSO2 homolog (S. cerevisiae) transcript_id : NM_018831.3

name	Nhlrc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384823 GeneID:66866 MGI:1914116
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NHL repeat containing 2 transcript_id : NM_025811.2

name	Adrb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680665 GeneID:11554 MGI:87937
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor, beta 1 transcript_id : NM_007419.1

name	EG629643 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270580 GeneID:629643 MGI:3648860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : predicted gene, EG629643 transcript_id : XM_894554.2

name	A630007B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25072200 GeneID:213993 MGI:2445022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630007B06 gene transcript_id : NM_170757.1

name	1700010L13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270523 GeneID:75628 MGI:1922878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700010L13 gene transcript_id : XM_001479353.1

name	Tdrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355695 GeneID:83561 MGI:1933218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tudor domain containing 1 transcript_id : NM_001002238.1

name	Tdrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355699 GeneID:83561 MGI:1933218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tudor domain containing 1 transcript_id : NM_001002240.1

name	Tdrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355697 GeneID:83561 MGI:1933218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tudor domain containing 1 transcript_id : NM_001002241.1

name	Tdrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475714 GeneID:83561 MGI:1933218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tudor domain containing 1 transcript_id : NM_031387.2

name	Vwa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42741660 GeneID:240675 MGI:2684334
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : von Willebrand factor A domain containing 2 transcript_id : NM_172840.2

name	Afap1l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122606 GeneID:226250 MGI:2147658
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin filament associated protein 1-like 2 transcript_id : NM_146102.1

name	Ablim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38016177 GeneID:226251 MGI:1194500
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin-binding LIM protein 1 transcript_id : NM_178688.2

name	EG668259 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405995 GeneID:668259 MGI:3644656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG668259 transcript_id : XM_001004102.1

name	AI450540 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380140 GeneID:226252 MGI:2147545
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI450540 transcript_id : NM_145505.3

name	Trub1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754011 GeneID:72133 MGI:1919383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TruB pseudouridine (psi) synthase homolog 1 (E. coli) transcript_id : NM_028115.2

name	Trub1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353903 GeneID:72133 MGI:1919383
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TruB pseudouridine (psi) synthase homolog 1 (E. coli) transcript_id : NM_029839.2

name	LOC100043038 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270527 GeneID:100043038
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Sm protein G transcript_id : XM_001479390.1

name	Atrnl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699441 GeneID:226255 MGI:2147749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : attractin like 1 transcript_id : NM_181415.3

name	Tcf7l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543849 CCDS:CCDS29911.1 GeneID:21416 MGI:1202879
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : transcription factor 7-like 2 product : transcription factor 7-like 2, T-cell specific, HMG-box protein_id : NP_033359.2

name	LOC100043484 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270579 GeneID:100043484
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480690.1

name	Habp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122613 GeneID:226243 MGI:1196378
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence ISS] [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 note : hyaduronic acid-binding protein 2 product : hyaluronic acid binding protein 2 protein_id : NP_666213.1

name	Nrap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606372 CCDS:CCDS29914.1 GeneID:18175 MGI:1098765
definition	GO_component : GO:0005916 - fascia adherens [Evidence IDA]; GO:0005927 - muscle tendon junction [Evidence IDA]; GO:0030016 - myofibril [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IPI] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051371 - muscle alpha-actinin binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0017166 - vinculin binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence TAS] codon_start : 1 note : isoform C is encoded by transcript variant 1 product : nebulin-related anchoring protein isoform C protein_id : NP_932307.2

name	Nrap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606368 CCDS:CCDS29913.1 GeneID:18175 MGI:1098765
definition	GO_component : GO:0005916 - fascia adherens [Evidence IDA]; GO:0005927 - muscle tendon junction [Evidence IDA]; GO:0030016 - myofibril [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IPI] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051371 - muscle alpha-actinin binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0017166 - vinculin binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence TAS] codon_start : 1 note : isoform S is encoded by transcript variant 2 product : nebulin-related anchoring protein isoform S protein_id : NP_032759.3

name	Casp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680850 CCDS:CCDS29915.1 GeneID:12369 MGI:109383
definition	GO_function : GO:0030693 - caspase activity [Evidence IDA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007507 - heart development [Evidence IGI]; GO:0006917 - induction of apoptosis [Evidence IEA] [Evidence IGI]; GO:0001836 - release of cytochrome c from mitochondria [Evidence IGI]; GO:0009411 - response to UV [Evidence IGI] codon_start : 1 product : caspase 7 protein_id : NP_031637.1

name	9930023K05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369924 CCDS:CCDS29916.1 GeneID:226245 MGI:2443041
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC226245 protein_id : NP_766229.1

name	Dclre1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145469 CCDS:CCDS29917.1 GeneID:55947 MGI:1930042
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006289 - nucleotide-excision repair [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : DNA cross-link repair 1A, PSO2 homolog protein_id : NP_061301.2

name	Nhlrc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789158 CCDS:CCDS29918.1 GeneID:66866 MGI:1914116
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA] codon_start : 1 product : NHL repeat containing 2 protein_id : NP_080087.1

name	Adrb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680666 CCDS:CCDS29919.1 GeneID:11554 MGI:87937
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IMP] GO_function : GO:0004940 - beta1-adrenergic receptor activity [Evidence IMP] [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0050873 - brown fat cell differentiation [Evidence IGI]; GO:0002024 - diet induced thermogenesis [Evidence IGI]; GO:0042596 - fear response [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IMP]; GO:0031649 - heat generation [Evidence IGI]; GO:0001997 - increased strength of heart contraction by epinephrine-norepinephrine [Evidence IMP] [Evidence IDA]; GO:0040015 - negative regulation of body size [Evidence IGI]; GO:0002025 - norepinephrine-epinephrine vasodilation during regulation of blood pressure [Evidence IGI] [Evidence IMP]; GO:0001996 - positive regulation of heart contraction rate by epinephrine-norepinephrine [Evidence IMP]; GO:0009409 - response to cold [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : beta 1-AR; cardiac beta adrenergic receptor product : adrenergic receptor, beta 1 protein_id : NP_031445.1

name	EG629643 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998772 GeneID:629643 MGI:3648860
definition	codon_start : 1 product : similar to macrophage migration inhibitory factor protein_id : XP_899647.1

name	A630007B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25072201 CCDS:CCDS29921.1 GeneID:213993 MGI:2445022
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : oocyte-testis gene 1 protein_id : NP_739563.1

name	1700010L13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270524 GeneID:75628 MGI:1922878
definition	codon_start : 1 product : hypothetical protein LOC75628 protein_id : XP_001479403.1

name	Tdrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355696 CCDS:CCDS29922.1 GeneID:83561 MGI:1933218
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0018994 - polar granule [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : tudor domain containing 1 isoform 1 protein_id : NP_001002238.1

name	Tdrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355700 CCDS:CCDS29922.1 GeneID:83561 MGI:1933218
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0018994 - polar granule [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : tudor domain containing 1 isoform 2 protein_id : NP_001002240.1

name	Tdrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355698 CCDS:CCDS29922.1 GeneID:83561 MGI:1933218
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0018994 - polar granule [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : tudor domain containing 1 isoform 3 protein_id : NP_001002241.1

name	Tdrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878217 GeneID:83561 MGI:1933218
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0018994 - polar granule [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 4 is encoded by transcript variant 4 product : tudor domain containing 1 isoform 4 protein_id : NP_113564.1

name	Vwa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42741661 CCDS:CCDS29923.1 GeneID:240675 MGI:2684334
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : VWA-like domains, matrilins and collagens product : von Willebrand factor A domain containing 2 protein_id : NP_766428.2

name	Afap1l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122607 CCDS:CCDS29924.1 GeneID:226250 MGI:2147658
definition	codon_start : 1 product : actin filament associated protein 1-like 2 protein_id : NP_666214.1

name	Ablim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016178 GeneID:226251 MGI:1194500
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007411 - axon guidance [Evidence IDA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : actin-binding double zinc finger protein product : actin-binding LIM protein 1 protein_id : NP_848803.2

name	EG668259 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94405996 GeneID:668259 MGI:3644656
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004102.1

name	AI450540 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542081 CCDS:CCDS29925.1 GeneID:226252 MGI:2147545
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC226252 protein_id : NP_663480.2

name	Trub1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312414 CCDS:CCDS29926.1 GeneID:72133 MGI:1919383
definition	GO_function : GO:0004730 - pseudouridylate synthase activity [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA]; GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : TruB pseudouridine (psi) synthase homolog 1 isoform 1 protein_id : NP_082391.1

name	Trub1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943926 CCDS:CCDS29927.1 GeneID:72133 MGI:1919383
definition	GO_function : GO:0004730 - pseudouridylate synthase activity [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA]; GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : TruB pseudouridine (psi) synthase homolog 1 isoform 2 protein_id : NP_084115.1

name	LOC100043038 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270528 GeneID:100043038
definition	codon_start : 1 product : similar to Sm protein G protein_id : XP_001479440.1

name	Atrnl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699442 CCDS:CCDS29928.1 GeneID:226255 MGI:2147749
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IPI] codon_start : 1 exception : mismatches in translation note : attractin-like protein product : attractin-like 1 protein_id : NP_852080.2

clone name	MSMg01-137M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528E16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-502P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330P02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-194J10.b	B6Ng01-194J10.g
ACC	GA017240	GA017241
length	912	1,036
definition	B6Ng01-194J10.b	B6Ng01-194J10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(57,158,211 - 57,159,126)	(56,974,434 - 56,975,619)
sequence	gaattctgtagagcctcctcagaaaatgccttctctgagatctctgacaa taagaccctgttaaagtatggatgtaagcagcataaaagagaatctcagt tttaccacaaaggcagtaaatgatgttttttaaaaggactttcagtcctt ggtacaagctggatacagctgattattttctgagaacttagccaaggtta aattgtgtgtgtgcgcgtgtgcgcgcaggtgcaagttcatatgtgtgtgt atgtgtgcacatatttgtgtgcccatgcacatgtgtgtgtacctgtgcac atgtgtgtgtacccgtgcacatgtgtgtgtgcttatacacatgtgtgtgc ttgtgcacatatttgtgtgtccatgcacatgtgtgtgtacccatgcacat gtgtgtgtgcccatgcacatgtgtgcatgtatctggagccttgaggtcat gttcagatccatacacttggctttttgaggtagcttttgtagcttggccc tgaacttgccaagcaggctaggccggtggcacatgagccccagggatcca tgtgtctccacctccatggtaccttccctggccattggatgccaggtgct tgttaactgggcattcttcccatcccagtgccactggtttttagtgggtt aatactacccagctttaacctccactataaactactatgttagtcgtaag gtggagctttgggaagacacagtggatgtctctcatgtttgagttgtatg accgacaacccttcaaaaaacctagatcatgaagattaggtgccagaaac ctgaaagacaaggccaccgtcattctggggatgagctgccctgagagccc ctttcaggccggtagggcaacattttaccattttgggccaacagagtggg gagtctggccaa	gaattcactttgtagaccaggctggcctcgaactgagaaatctgcttgcc tctgcctcccaagtgctgggattaaaggcgtgcgccaccaccgtgcagct cagaccagagacagttatgttcaaagcactaagctgctggtgtatgctgg gcacactggtaggggctggggggtcactggggcacactggggtgtgctgg ggcatactggggcatggctggacctgagctgtgtggtaaaagtcaagaag ggtaatggctgtagagtcacatgtggactgggagtgaagactggagcgtc ctggcctgaaccctagagtgaatggtgatgtcatttttcaacatggcaga gaattaaaaaaaaaaaaaaaaaagaacaggaagccatctgaaagtatgct ctttccatctccagccccctttcctgctggttgagcctctttgtgacgct tctccattctagtcagcacctaagtttcttgggcagcttttgagaaagtc tgctgctgggccaaaacagtggaggggggaaccagcgggccacatgtgag aagccccctctgtgtgccaagggataactgggaagtgggtgaaagcttag cctgcatggagtcgaataagatgaagagttaaacaaacgctagtcaagtt tgcagcgtgatgaccttctcttcctgtctggctgagtttcaacacttctt tcctttcacatcacagactccctcattttcattaatttataaactatttc tctgcaccagggtctgggcacacatgcttgccgaggtacacttgaggtca ggacaactgtgggagtctatccttcctctctaccatgcgggtcccaggga tcaaagtcaggtcattcagcctgggcaatggcaccctgacctgctgagcc ttctcactggctcttaagaacaatggaaaattgaaattagcatttattgc tttgccttattaaacaaagatctctctccggacttagggtcatccactta ccatttgtcctgagcaacggtgataatgctttctga
quality values	Open. Hide. 46 35 21 26 62 62 35 32 62 62 56 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 59 59 59 62 62 56 41 28 28 27 34 49 27 54 38 45 32 45 45 56 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 59 62 62 62 59 62 62 59 59 62 62 62 62 62 51 43 39 48 45 59 59 56 43 42 48 54 46 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 62 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 43 62 59 62 62 59 62 56 59 56 56 51 62 62 59 59 62 59 59 59 56 38 56 56 62 62 62 62 62 62 54 51 62 62 51 62 62 62 62 62 51 54 62 54 56 62 56 62 56 62 56 62 62 62 62 62 56 62 62 54 56 62 56 62 54 47 42 54 56 56 47 47 38 62 54 62 62 47 56 38 56 43 47 46 56 56 62 56 47 56 56 56 62 62 52 52 42 52 54 54 52 62 47 43 54 52 48 54 52 52 14 14 7 9 19 14 52 50 47 54 47 39 25 54 58 52 30 54 46 52 52 44 54 50 26 26 49 49 33 46 37 37 39 46 52 42 42 53 58 58 58 54 58 54 54 52 46 31 39 47 22 25 48 31 58 48 47 42 49 50 50 54 52 54 33 27 37 21 22 25 30 24 33 51 25 51 27 45 19 58 32 50 49 47 34 19 28 40 50 50 27 37 13 27 32 42 30 31 48 33 34 13 54 39 53 52 41 40 34 42 39 39 11 48 40 36 41 33 41 27 46 21 25 30 26 49 13 40 29 47 31 22 41 51 54 31 30 35 37 42 30 37 29 31 40 33 29 29 26 9 19 27 18 19 9 37 47 23 12 24 14 28 21 11 27 22 35 27 17 9 5 20 26 53 31 21 21 35 25 12 14 17 19 15 16 32 24 49 6 40 32 32 20 17 35 37 29 53 26 52 39 41 49 40 37 28 28 32 39 11 33 26 38 14 40 17 19 20 24 6 13 8 13 44 40 42 19 18 31 23 24 16 11 14 28 8 9 8 6 6 9 18 30 11 36 7 9 12 32 31 34 26 29 18 13 10 27 30 6 15 25 21 12 27 14 15 31 24 18 8 6 9 15 21 17 14 8 5 6 13 28 41 26 18 25 7 13	Open. Hide. 62 49 56 47 62 39 31 47 62 62 51 35 22 19 18 28 25 21 14 24 27 28 34 46 46 62 62 62 62 62 59 62 62 62 62 54 59 59 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 46 32 34 48 62 54 49 49 49 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 59 59 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 54 49 54 62 62 62 62 54 62 62 62 62 59 62 54 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 50 62 59 59 59 59 62 62 59 59 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 56 62 56 46 62 56 62 62 62 62 56 62 62 62 62 62 62 62 62 56 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 56 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 56 62 62 62 52 52 52 33 52 52 62 62 51 62 52 62 62 62 62 62 62 62 62 62 54 62 46 62 62 62 54 54 52 52 58 54 54 46 58 54 54 52 52 58 44 43 58 54 54 49 58 58 58 51 54 42 46 54 48 58 52 54 58 28 58 54 50 58 54 52 52 41 48 54 54 58 52 54 52 42 46 36 26 54 54 58 54 32 39 58 49 52 47 58 48 48 58 50 48 42 47 47 48 50 49 58 48 49 50 53 39 42 51 27 51 58 34 51 49 50 40 58 48 52 32 50 51 11 58 43 40 46 37 26 39 29 46 49 41 32 58 39 36 21 20 54 50 40 26 51 37 51 53 58 47 51 24 54 51 49 25 28 32 58 40 50 42 42 26 34 23 5 20 39 29 44 37 41 39 50 51 58 39 53 41 39 38 40 19 52 20 29 40 58 51 11 31 35 53 19 26 51 51 37 33 37 42 42 39 51 49 47 39 33 52 30 45 22 53 16 32 19 33 32 53 35 42 35 50 28 44 19 23 18 54 41 35 32 29 14 54 54 35 30 31 40 53 51 35 37 54 42 53 43 53 51 31 47 29 33 45 54 45 52 40 40 37 33 32 30 33 31 32 32 53 40 33 33 30 45 52 33 14 30 32 31 30 30 35 40 31 40 40 40 22 47 8 45 26 29 28 29 31 19 26 38 37 32 40 18 36 17 19 26 20 45 26 18 26 22 30 26 31 17 29 45 30 39 16 28 30 23 17 32 28 31 33 12 14 42 32 24 38 33 25 31 21 27 32 31 23 18 24 46 31 25 25 46 25 22 23 43 38 18 14 12 18 42 42 30 18 15 14 27 46 16 21 26 7 9 11 10 8 6 10 31 31 35 19 7 10 7 9 28 15 13 13 34 46 10 22 26 38 19 29 31 44 13 31 23 22 7 18 18 13 8 16 9 8 14 7 19 30 30 29 29 10 15 30 27 20 16 33 11 6 20 25 13 16 12 38 36 41 16 10 10 19 14 44 24 5 15 8 19 31 31 31 38 9 5 5 29 7 11 10 47 5 6 4 6 15 10 10 11 19 25 31 13 17 10 34 11 10 7 22 14 33 21 25 9 6 5 6 9 4 16 18 10 15 15 9 11 7 15 13 15 13 19 15 10 7 11 17 7 13 8 12 24 21 5 14 11 22 13 12 23 8 7 4 5 5 7 6 17 24 7 27 11 11 11 13 16 17 11 26 15 11 12 18 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_57158211_57159126
seq2: B6Ng01-194J10.b_44_955 (reverse)

seq1  TTGGCCAGACTCCCCACTCTGTTGGCCC-AAATGGTAAAATGTTGGCCTC  49
      |||||||||||||||||||||||||||| |||||||||||||||| ||| 
seq2  TTGGCCAGACTCCCCACTCTGTTGGCCCAAAATGGTAAAATGTTGCCCT-  49

seq1  ACCGGGCCTGAAAGGGGCTCTCAGGGCAGCTCATCCCCAGAATGACGGTG  99
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACC-GGCCTGAAAGGGGCTCTCAGGGCAGCTCATCCCCAGAATGACGGTG  98

seq1  GCCTTGTCTCTTCAGGTTTCTGGCACCTAATCCTTCTTGATCTAGGTTTT  149
      ||||||||| ||||||||||||||||||||| |||| ||||||||| |||
seq2  GCCTTGTCT-TTCAGGTTTCTGGCACCTAAT-CTTCATGATCTAGG-TTT  145

seq1  TTTGAAGGGTTGTCGGTCATACAACTCAAACATGAGAGACATCCACTGTG  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGAAGGGTTGTCGGTCATACAACTCAAACATGAGAGACATCCACTGTG  195

seq1  TCTTCCCAAAGCTCCACCTTACGACTAACATAGTAGTTTATAGTGGAGGT  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCCAAAGCTCCACCTTACGACTAACATAGTAGTTTATAGTGGAGGT  245

seq1  TAAAGCTGGGTAGTATTAACCCACTAAAAACCAGTGGCACTGGGATGGGA  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGCTGGGTAGTATTAACCCACTAAAAACCAGTGGCACTGGGATGGGA  295

seq1  AGAATGCCCAGTTAACAAGCACCTGGCATCCAATGGCCAGGGAAGGTACC  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATGCCCAGTTAACAAGCACCTGGCATCCAATGGCCAGGGAAGGTACC  345

seq1  ATGGAGGTGGAGACACATGGATCCCTGGGGCTCATGTGCCACCGGCCTAG  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGAGGTGGAGACACATGGATCCCTGGGGCTCATGTGCCACCGGCCTAG  395

seq1  CCTGCTTGGCAAGTTCAGGGCCAAGCTACAAAAGCTACCTCAAAAAGCCA  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCTTGGCAAGTTCAGGGCCAAGCTACAAAAGCTACCTCAAAAAGCCA  445

seq1  AGTGTATGGATCTGAACATGACCTCAAGGCTCCAGATACATGCACACATG  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTATGGATCTGAACATGACCTCAAGGCTCCAGATACATGCACACATG  495

seq1  TGCATGGGCACACACACATGTGCATGGGTACACACACATGTGCATGGACA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATGGGCACACACACATGTGCATGGGTACACACACATGTGCATGGACA  545

seq1  CACAAATATGTGCACAAGCACACACATGTGTATAAGCACACACACATGTG  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAAATATGTGCACAAGCACACACATGTGTATAAGCACACACACATGTG  595

seq1  CACGGGTACACACACATGTGCACAGGTACACACACATGTGCATGGGCACA  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACGGGTACACACACATGTGCACAGGTACACACACATGTGCATGGGCACA  645

seq1  CAAATATGTGCACACATACACACACATATGAACTTGCACCTGCGCGCACA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAATATGTGCACACATACACACACATATGAACTTGCACCTGCGCGCACA  695

seq1  CGCGCACACACACAATTTAACCTTGGCTAAGTTCTCAGAAAATAATCAGC  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCGCACACACACAATTTAACCTTGGCTAAGTTCTCAGAAAATAATCAGC  745

seq1  TGTATCCAGCTTGTACCAAGGACTGAAAGTCCTTTTAAAAAACATCATTT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATCCAGCTTGTACCAAGGACTGAAAGTCCTTTTAAAAAACATCATTT  795

seq1  ACTGCCTTTGTGGTAAAACTGAGATTCTCTTTTATGCTGCTTACATCCAT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCCTTTGTGGTAAAACTGAGATTCTCTTTTATGCTGCTTACATCCAT  845

seq1  ACTTTAACAGGGTCTTATTGTCAGAGATCTCAGAGAAGGCATTTTCTGAG  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTAACAGGGTCTTATTGTCAGAGATCTCAGAGAAGGCATTTTCTGAG  895

seq1  GAGGCTCTACAGAATTC  916
      |||||||||||||||||
seq2  GAGGCTCTACAGAATTC  912

seq1: chr19_56974434_56975619
seq2: B6Ng01-194J10.g_69_1104

seq1  GAATTCACTTTGTAGACCAGGCTGGCCTCGAACTGAGAAATCTGCTTGCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTTTGTAGACCAGGCTGGCCTCGAACTGAGAAATCTGCTTGCC  50

seq1  TCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGCGCCACCACCGTGCAGCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGCGCCACCACCGTGCAGCT  100

seq1  CAGACCAGAGACAGTTATGTTCAAAGCACTAAGCTGCTGGTGTATGCTGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACCAGAGACAGTTATGTTCAAAGCACTAAGCTGCTGGTGTATGCTGG  150

seq1  GCACACTGGTAGGGGCTGGGGGGTCACTGGGGCACACTGGGGTGTGCTGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACACTGGTAGGGGCTGGGGGGTCACTGGGGCACACTGGGGTGTGCTGG  200

seq1  GGCATACTGGGGCATGGCTGGACCTGAGCTGTGTGGTAAAAGTCAAGAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATACTGGGGCATGGCTGGACCTGAGCTGTGTGGTAAAAGTCAAGAAG  250

seq1  GGTAATGGCTGTAGAGTCACATGTGGACTGGGAGTGAAGACTGGAGCGTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAATGGCTGTAGAGTCACATGTGGACTGGGAGTGAAGACTGGAGCGTC  300

seq1  CTGGCCTGAACCCTAGAGTGAATGGTGATGTCATTTTTCAACATGGCAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCCTGAACCCTAGAGTGAATGGTGATGTCATTTTTCAACATGGCAGA  350

seq1  GAATTAAAAAAAAAAAAAAAAAAGAACAGGAAGCCATCTGAAAGTATGCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTAAAAAAAAAAAAAAAAAAGAACAGGAAGCCATCTGAAAGTATGCT  400

seq1  CTTTCCATCTCCAGCCCCCTTTCCTGCTGGTTGAGCCTCTTTGTGACGCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCCATCTCCAGCCCCCTTTCCTGCTGGTTGAGCCTCTTTGTGACGCT  450

seq1  TCTCCATTCTAGTCAGCACCTAAGTTTCTTGGGCAGCTTTTGAGAAAGTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCATTCTAGTCAGCACCTAAGTTTCTTGGGCAGCTTTTGAGAAAGTC  500

seq1  TGCTGCTGGGCCAAAACAGTGGAGGGGGGAACCAGCGGGCCACATGTGAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGCTGGGCCAAAACAGTGGAGGGGGGAACCAGCGGGCCACATGTGAG  550

seq1  AAGCCCCCTCTGTGTGCCAAGGGATAACTGGGAAGTGGGTGAAAGCTTAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCCCCTCTGTGTGCCAAGGGATAACTGGGAAGTGGGTGAAAGCTTAG  600

seq1  CCTGCATGGAGTCGAATAAGATGAAGAGTTAAACAAACGCTAGTCAAGTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCATGGAGTCGAATAAGATGAAGAGTTAAACAAACGCTAGTCAAGTT  650

seq1  TGCAGCGTGATGACCTTCTCTTCCTGTCTGGCTGAGTTTCAACACTTCTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGCGTGATGACCTTCTCTTCCTGTCTGGCTGAGTTTCAACACTTCTT  700

seq1  TCC-TTCACATCACAGACTCCCTCATTTTCATTAATTTATAAACTATTTC  749
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTTCACATCACAGACTCCCTCATTTTCATTAATTTATAAACTATTTC  750

seq1  TCTGCACCAGGGTCTGGGCACACATGCTTGCCGAGGTACACTTGAGGTCA  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCACCAGGGTCTGGGCACACATGCTTGCCGAGGTACACTTGAGGTCA  800

seq1  GGACAACTGTGGGAGTCTATCCTTCCTCTCTACCATGCGGGTCCCAGGGA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACAACTGTGGGAGTCTATCCTTCCTCTCTACCATGCGGGTCCCAGGGA  850

seq1  TCAAAGTCAGGTCA-TCAGGCTGGGC-ATGGCACCCTGACCTGCTGAGCC  897
      |||||||||||||| |||| |||||| |||||||||||||||||||||||
seq2  TCAAAGTCAGGTCATTCAGCCTGGGCAATGGCACCCTGACCTGCTGAGCC  900

seq1  -TCTCACTGGCTCTTAAG-ACAAATGAAAAATGAAATTAGCATTTATTTG  945
       ||||||||||||||||| ||||  ||||| ||||||||||||||| |||
seq2  TTCTCACTGGCTCTTAAGAACAATGGAAAATTGAAATTAGCATTTA-TTG  949

seq1  CTTTGTCTTATTAAACAAAGATCTCTTCTTCGTGACTTAGGGTCATCCAC  995
      ||||| ||||||||||||||||||| ||| || |||||||||||||||||
seq2  CTTTGCCTTATTAAACAAAGATCTC-TCTCCG-GACTTAGGGTCATCCAC  997

seq1  TTACCATTTTGTCCTGGGCACCGGTGATAATGCCTTCTGGGCACTGAAGG  1045
      |||||| ||||||||| ||| |||||||||||| |||||           
seq2  TTACCA-TTTGTCCTGAGCAACGGTGATAATGCTTTCTGA----------  1036

seq1  ATTCTATTTCCCTTCCACGGCAGCAGAGTGCTGGCCTTGGCTGCCTTGGG  1095
                                                        
seq2  --------------------------------------------------  1036

seq1  TCTCTTTCCTATCTTGGAGTTCTGCTGTCACTGGCCATCCTTGCTTGCTC  1145
                                                        
seq2  --------------------------------------------------  1036

seq1  TCTTTCTCACTTTAAACAACTTTCTCTCATTTGCTTTCTGA  1186
                                               
seq2  -----------------------------------------  1036

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information