MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-196P09
Chromosome	19 (Build37)	18 (Build37)
Map Location	12,874,878 - 12,876,017	44,069,030 - 44,069,356
singlet/doublet	singlet	singlet
Overlap gene	Lpxn
Upstream gene	Stx3, Olfr1417, Olfr1418, Olfr1419, EG622845, EG666985, Olfr1420, AV312086, Osbp, GA_x5J8B7W6KF8-6942124-6941700, Olfr1422-ps1, Olfr1423, Olfr1424, Olfr1425, Olfr1426, Olfr1427, Olfr1428, Olfr76, Olfr1555-ps1, Olfr1430-ps1, Olfr1431, Olfr1429-ps1, Olfr262, Olfr232, Olfr1433, Olfr1435-ps1, Olfr1436, Olfr1437, Olfr1438-ps1, Olfr1439-ps1, Olfr1440, Olfr1441, Pfpl, Mpeg1, Dtx4, EG625046, 4632417K18Rik, EG240549, Glyat, Olfr1442, Olfr1443, Keg1, Zfp91, Cntf
Downstream gene	EG383436, Olfr1444, Olfr1445, Olfr1446, Olfr1447, EG433224, Olfr1448, Olfr1449, Olfr1450, Olfr1451, Olfr1452-ps1, Olfr1453, Olfr1454, Olfr1455-ps1, Olfr1456-ps1, Olfr1457, EG667271, Olfr1459, Olfr1460-ps1, Olfr1461, Olfr1462, Olfr1463, LOC667300, Olfr1465, Olfr1466, Olfr1467, Olfr1468-ps1, Olfr1469, Olfr1470-ps1, Olfr1471, GA_x5J8B7W6KF8-5605544-5605301, Olfr1472, Olfr1473-ps1, Olfr1474, Olfr1475, GA_x5J8B7W6KF8-5563315-5562883, Olfr1477, GA_x5J8B7W6KF8-5546505-5545716, GA_x5J8B7W6KF8-5539992-5539494, LOC100041185, Olfr1480, GA_x5J8B7W6KF8-5515896-5515561, GA_x5J8B7W6KF8-5488050-5488655, Olfr1483-ps1, Olfr1484, GA_x5J8B7W6KF8-5463415-5462623, Olfr1486-ps1, LOC671653, Olfr1487, GA_x5J8B7W6KF8-5425983-5425664, Olfr1489, Olfr1490, Olfr1491, Olfr1492-ps1, Olfr1493-ps1, Olfr1494, Olfr1495, Olfr1496, Olfr1497
Link	Open Mouse BAC browser

Click to get alignment info.

name	Stx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20908 MGI:103077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Olfr1417 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258938 MGI:3031251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1418 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258227 MGI:3031252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1419 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257938 MGI:3031253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622845 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622845 MGI:3643502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 99 ESTs, 6 Proteins

name	EG666985 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666985 MGI:3644364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Olfr1420 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258405 MGI:3031254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AV312086 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225929 MGI:2147679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Osbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76303 MGI:97447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-6942124-6941700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257719
definition	note : olfactory receptor GA_x5J8B7W6KF8-6942124-6941700 pseudo : _no_value

name	Olfr1422-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258005 MGI:3031256
definition	gene_synonym : MOR239-8P note : olfactory receptor 1422, pseudogene 1 pseudo : _no_value

name	Olfr1423 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258675 MGI:3031257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1424 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258676 MGI:3031258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1425 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258155 MGI:3031259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1426 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258805 MGI:3031260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1427 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258674 MGI:3031261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1428 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258673 MGI:3031262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr76 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258677 MGI:2153205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1555-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257954 MGI:3031389
definition	gene_synonym : MOR0-15P; MOR202-43 note : olfactory receptor 1555, pseudogene 1 pseudo : _no_value

name	Olfr1430-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257992 MGI:3031264
definition	gene_synonym : MOR214-8P note : olfactory receptor 1430, pseudogene 1 pseudo : _no_value

name	Olfr1431 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258409 MGI:3031265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1429-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257955 MGI:3031263
definition	gene_synonym : GA_x5J8B7W20A2-6027-5647; MOR0-14P note : olfactory receptor 1429, pseudogene 1 pseudo : _no_value

name	Olfr262 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258683 MGI:3030096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr232 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258681 MGI:3030066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1433 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258680 MGI:3031267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr1435-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258004 MGI:3031269
definition	gene_synonym : MOR133-4P note : olfactory receptor 1435, pseudogene 1 pseudo : _no_value

name	Olfr1436 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258682 MGI:3031270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1437 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258117 MGI:3031271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1438-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258116 MGI:3031272
definition	gene_synonym : MOR215-4 note : olfactory receptor 1438, pseudogene 1 pseudo : _no_value

name	Olfr1439-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258015 MGI:3031273
definition	gene_synonym : MOR214-7P note : olfactory receptor 1439, pseudogene 1 pseudo : _no_value

name	Olfr1440 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258679 MGI:3031274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1441 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258678 MGI:3031275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56093 MGI:1860266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpeg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17476 MGI:1333743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dtx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207521 MGI:2672905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625046 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625046 MGI:3643874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	4632417K18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107373 MGI:1915508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG240549 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240549 MGI:3643569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glyat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107146 MGI:2147502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1442 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258692 MGI:3031276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1443 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258693 MGI:3031277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Keg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64697 MGI:1928492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp91 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109910 MGI:104854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Cntf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12803 MGI:88439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lpxn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107321 MGI:2147677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG383436 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383436 MGI:3646958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	Olfr1444 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258697 MGI:3031278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1445 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258694 MGI:3031279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1446 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258699 MGI:3031280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1447 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258698 MGI:3031281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433224 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433224 MGI:3645436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 47 ESTs, 8 Proteins pseudo : _no_value

name	Olfr1448 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258696 MGI:3031282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1449 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258300 MGI:3031283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1450 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258368 MGI:3031284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1451 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258700 MGI:3031285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1452-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258126 MGI:3031286
definition	gene_synonym : MOR202-23 note : olfactory receptor 1452, pseudogene 1 pseudo : _no_value

name	Olfr1453 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258695 MGI:3031287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1454 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258687 MGI:3031288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1455-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404515 MGI:3031289
definition	note : olfactory receptor 1455, pseudogene 1 pseudo : _no_value

name	Olfr1456-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404516 MGI:3031290
definition	note : olfactory receptor 1456, pseudogene 1 pseudo : _no_value

name	Olfr1457 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258568 MGI:3031291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667271 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667271 MGI:3645607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2279 Proteins

name	Olfr1459 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258684 MGI:3031293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1460-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258118 MGI:3031294
definition	gene_synonym : MOR202-31P note : olfactory receptor 1460, pseudogene 1 pseudo : _no_value

name	Olfr1461 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258299 MGI:3031295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1462 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258688 MGI:3031296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1463 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258120 MGI:3031297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667300 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667300
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1315 Proteins pseudo : _no_value

name	Olfr1465 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258121 MGI:3031299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1466 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258689 MGI:3031300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1467 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258686 MGI:3031301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1468-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258192 MGI:3031302
definition	gene_synonym : MOR202-21 note : olfactory receptor 1468, pseudogene 1 pseudo : _no_value

name	Olfr1469 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258690 MGI:3031303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1470-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258119 MGI:3031304
definition	gene_synonym : MOR202-30P note : olfactory receptor 1470, pseudogene 1 pseudo : _no_value

name	Olfr1471 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258231 MGI:3031305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-5605544-5605301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257729
definition	note : olfactory receptor GA_x5J8B7W6KF8-5605544-5605301 pseudo : _no_value

name	Olfr1472 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258685 MGI:3031306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1473-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258124 MGI:3031307
definition	gene_synonym : MOR202-25P note : olfactory receptor 1473, pseudogene 1 pseudo : _no_value

name	Olfr1474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258123 MGI:3031308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1475 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258298 MGI:3031309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-5563315-5562883 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257761
definition	note : olfactory receptor GA_x5J8B7W6KF8-5563315-5562883 pseudo : _no_value

name	Olfr1477 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258691 MGI:3031311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-5546505-5545716 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257762
definition	note : olfactory receptor GA_x5J8B7W6KF8-5546505-5545716 pseudo : _no_value

name	GA_x5J8B7W6KF8-5539992-5539494 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257763
definition	note : olfactory receptor GA_x5J8B7W6KF8-5539992-5539494 pseudo : _no_value

name	LOC100041185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr1480 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404339 MGI:3031314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-5515896-5515561 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257764
definition	note : olfactory receptor GA_x5J8B7W6KF8-5515896-5515561 pseudo : _no_value

name	GA_x5J8B7W6KF8-5488050-5488655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257765
definition	note : olfactory receptor GA_x5J8B7W6KF8-5488050-5488655 pseudo : _no_value

name	Olfr1483-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404522 MGI:3031317
definition	note : olfactory receptor 1483, pseudogene 1 pseudo : _no_value

name	Olfr1484 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258288 MGI:3031318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-5463415-5462623 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257767
definition	note : olfactory receptor GA_x5J8B7W6KF8-5463415-5462623 pseudo : _no_value

name	Olfr1486-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404524 MGI:3031320
definition	note : olfactory receptor 1486, pseudogene 1 pseudo : _no_value

name	LOC671653 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	Olfr1487 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258629 MGI:3031321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-5425983-5425664 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257768
definition	note : olfactory receptor GA_x5J8B7W6KF8-5425983-5425664 pseudo : _no_value

name	Olfr1489 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258628 MGI:3031323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1490 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258098 MGI:3031324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1491 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258342 MGI:3031325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1492-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404526 MGI:3031326
definition	note : olfactory receptor 1492, pseudogene 1 pseudo : _no_value

name	Olfr1493-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258735 MGI:3031327
definition	gene_synonym : MOR266-3 note : olfactory receptor 1493, pseudogene 1 pseudo : _no_value

name	Olfr1494 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258992 MGI:3031328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1495 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258341 MGI:3031329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1496 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258991 MGI:3031330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1497 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258736 MGI:3031331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778801 GeneID:20908 MGI:103077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 3 transcript_id : NM_001025307.1

name	Stx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778979 GeneID:20908 MGI:103077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 3 transcript_id : NM_011502.2

name	Stx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778910 GeneID:20908 MGI:103077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 3 transcript_id : NM_152220.1

name	Olfr1417 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129038 GeneID:258938 MGI:3031251
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1417 transcript_id : NM_146936.1

name	Olfr1418 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372129 GeneID:258227 MGI:3031252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1418 transcript_id : NM_001011524.1

name	Olfr1419 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801325 GeneID:257938 MGI:3031253
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1419 transcript_id : NM_001011775.1

name	EG622845 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270394 GeneID:622845 MGI:3643502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 83 ESTs, 4 Proteins product : predicted gene, EG622845, transcript variant 1 transcript_id : XM_001476608.1

name	EG622845 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270396 GeneID:622845 MGI:3643502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 29 ESTs, 2 Proteins product : predicted gene, EG622845, transcript variant 2 transcript_id : XM_001476626.1

name	Olfr1420 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238899 GeneID:258405 MGI:3031254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1420 transcript_id : NM_146410.1

name	AV312086 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802695 GeneID:225929 MGI:2147679
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AV312086 transcript_id : NM_172635.2

name	Osbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133504508 GeneID:76303 MGI:97447
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein transcript_id : NM_001033174.1

name	Olfr1423 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239021 GeneID:258675 MGI:3031257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1423 transcript_id : NM_146680.1

name	Olfr1424 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239019 GeneID:258676 MGI:3031258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1424 transcript_id : NM_146681.1

name	Olfr1425 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801463 GeneID:258155 MGI:3031259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1425 transcript_id : NM_001011853.1

name	Olfr1426 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254188 GeneID:258805 MGI:3031260
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1426 transcript_id : NM_146809.2

name	Olfr1427 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239015 GeneID:258674 MGI:3031261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1427 transcript_id : NM_146679.1

name	Olfr1428 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239017 GeneID:258673 MGI:3031262
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1428 transcript_id : NM_146678.1

name	Olfr76 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239079 GeneID:258677 MGI:2153205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 76 transcript_id : NM_146682.1

name	Olfr1431 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239081 GeneID:258409 MGI:3031265
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1431 transcript_id : NM_146414.1

name	Olfr262 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239089 GeneID:258683 MGI:3030096
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 262 transcript_id : NM_146688.1

name	Olfr232 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239085 GeneID:258681 MGI:3030066
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 232 transcript_id : NM_146686.1

name	Olfr1433 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239087 GeneID:258680 MGI:3031267
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 1433 transcript_id : NM_146685.1

name	Olfr1436 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239091 GeneID:258682 MGI:3031270
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1436 transcript_id : NM_146687.1

name	Olfr1437 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801437 GeneID:258117 MGI:3031271
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1437 transcript_id : NM_001011839.1

name	Olfr1440 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239083 GeneID:258679 MGI:3031274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1440 transcript_id : NM_146684.1

name	Olfr1441 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239077 GeneID:258678 MGI:3031275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1441 transcript_id : NM_146683.1

name	Pfpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506576 GeneID:56093 MGI:1860266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pore forming protein-like transcript_id : NM_019540.1

name	Mpeg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133506752 GeneID:17476 MGI:1333743
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage expressed gene 1 transcript_id : NM_010821.1

name	Dtx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254206 GeneID:207521 MGI:2672905
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deltex 4 homolog (Drosophila) transcript_id : NM_172442.2

name	EG625046 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270390 GeneID:625046 MGI:3643874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG625046 transcript_id : XM_889589.2

name	4632417K18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360571 GeneID:107373 MGI:1915508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632417K18 gene transcript_id : NM_026640.2

name	EG240549 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000639 GeneID:240549 MGI:3643569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG240549 transcript_id : NM_001013762.1

name	Glyat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802788 GeneID:107146 MGI:2147502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycine-N-acyltransferase transcript_id : NM_145935.3

name	Olfr1442 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129446 GeneID:258692 MGI:3031276
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1442 transcript_id : NM_146697.1

name	Olfr1443 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41056105 GeneID:258693 MGI:3031277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1443 transcript_id : NM_146698.2

name	Keg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387486 GeneID:64697 MGI:1928492
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kidney expressed gene 1 transcript_id : NM_029550.2

name	Zfp91 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90669975 GeneID:109910 MGI:104854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : zinc finger protein 91 transcript_id : NM_001039718.1

name	Cntf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90669424 GeneID:12803 MGI:88439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ciliary neurotrophic factor transcript_id : NM_170786.2

name	Zfp91 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90669982 GeneID:109910 MGI:104854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 91 transcript_id : NM_053009.2

name	Lpxn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352336 GeneID:107321 MGI:2147677
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leupaxin transcript_id : NM_134152.2

name	EG383436 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38084913 GeneID:383436 MGI:3646958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG383436, transcript variant 1 transcript_id : XM_357052.1

name	EG383436 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82998210 GeneID:383436 MGI:3646958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG383436, transcript variant 2 transcript_id : XM_899309.1

name	Olfr1444 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129432 GeneID:258697 MGI:3031278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1444 transcript_id : NM_146702.1

name	Olfr1445 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129442 GeneID:258694 MGI:3031279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1445 transcript_id : NM_146699.1

name	Olfr1446 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129428 GeneID:258699 MGI:3031280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1446 transcript_id : NM_146704.1

name	Olfr1447 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129434 GeneID:258698 MGI:3031281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1447 transcript_id : NM_146703.1

name	Olfr1448 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129438 GeneID:258696 MGI:3031282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1448 transcript_id : NM_146701.1

name	Olfr1449 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129680 GeneID:258300 MGI:3031283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1449 transcript_id : NM_146303.1

name	Olfr1450 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129558 GeneID:258368 MGI:3031284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1450 transcript_id : NM_146371.1

name	Olfr1451 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129430 GeneID:258700 MGI:3031285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1451 transcript_id : NM_146705.1

name	Olfr1453 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129436 GeneID:258695 MGI:3031287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1453 transcript_id : NM_146700.1

name	Olfr1454 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239135 GeneID:258687 MGI:3031288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1454 transcript_id : NM_146692.1

name	Olfr1457 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129494 GeneID:258568 MGI:3031291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1457 transcript_id : NM_146575.1

name	EG667271 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270392 GeneID:667271 MGI:3645607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2279 Proteins product : predicted gene, EG667271 transcript_id : XM_001475614.1

name	Olfr1459 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239133 GeneID:258684 MGI:3031293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1459 transcript_id : NM_146689.1

name	Olfr1461 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170041 GeneID:258299 MGI:3031295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1461 transcript_id : NM_146302.1

name	Olfr1462 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239141 GeneID:258688 MGI:3031296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1462 transcript_id : NM_146693.1

name	Olfr1463 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801439 GeneID:258120 MGI:3031297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1463 transcript_id : NM_001011840.1

name	Olfr1465 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801441 GeneID:258121 MGI:3031299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1465 transcript_id : NM_001011841.1

name	Olfr1466 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239139 GeneID:258689 MGI:3031300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1466 transcript_id : NM_146694.1

name	Olfr1467 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239137 GeneID:258686 MGI:3031301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1467 transcript_id : NM_146691.1

name	Olfr1469 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239145 GeneID:258690 MGI:3031303
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1469 transcript_id : NM_146695.1

name	Olfr1471 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821661 GeneID:258231 MGI:3031305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1471 transcript_id : NM_207132.2

name	Olfr1472 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671325 GeneID:258685 MGI:3031306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1472 transcript_id : NM_146690.2

name	Olfr1474 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801443 GeneID:258123 MGI:3031308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1474 transcript_id : NM_001011842.1

name	Olfr1475 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129686 GeneID:258298 MGI:3031309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1475 transcript_id : NM_146301.1

name	Olfr1477 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983619 GeneID:258691 MGI:3031311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1477 transcript_id : NM_146696.2

name	Olfr1480 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430751 GeneID:404339 MGI:3031314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1480 transcript_id : NM_207575.1

name	Olfr1484 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129706 GeneID:258288 MGI:3031318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1484 transcript_id : NM_146291.1

name	Olfr1487 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239127 GeneID:258629 MGI:3031321
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1487 transcript_id : NM_146636.1

name	Olfr1489 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239129 GeneID:258628 MGI:3031323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1489 transcript_id : NM_146635.1

name	Olfr1490 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801427 GeneID:258098 MGI:3031324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1490 transcript_id : NM_001011832.1

name	Olfr1491 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129607 GeneID:258342 MGI:3031325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1491 transcript_id : NM_146345.1

name	Olfr1494 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128952 GeneID:258992 MGI:3031328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1494 transcript_id : NM_146990.1

name	Olfr1495 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129613 GeneID:258341 MGI:3031329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1495 transcript_id : NM_146344.1

name	Olfr1496 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128958 GeneID:258991 MGI:3031330
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1496 transcript_id : NM_146989.1

name	Olfr1497 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129358 GeneID:258736 MGI:3031331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1497 transcript_id : NM_146741.1

name	Stx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22726207 CCDS:CCDS29612.1 GeneID:20908 MGI:103077
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform C is encoded by transcript variant C; syntaxin 3A; syntaxin 3B product : syntaxin 3 isoform C protein_id : NP_035632.1

name	Stx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778802 CCDS:CCDS29611.1 GeneID:20908 MGI:103077
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform B is encoded by transcript variant B; syntaxin 3A; syntaxin 3B product : syntaxin 3 isoform B protein_id : NP_001020478.1

name	Stx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778911 CCDS:CCDS29613.1 GeneID:20908 MGI:103077
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform A is encoded by transcript variant A; syntaxin 3A; syntaxin 3B product : syntaxin 3 isoform A protein_id : NP_689344.1

name	Olfr1417 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129039 CCDS:CCDS29614.1 GeneID:258938 MGI:3031251
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2172809-2171862; olfactory receptor MOR266-2 product : olfactory receptor 1417 protein_id : NP_667147.1

name	Olfr1418 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372130 CCDS:CCDS29615.1 GeneID:258227 MGI:3031252
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2207258-2206302; olfactory receptor MOR266-5 product : olfactory receptor 1418 protein_id : NP_001011524.1

name	Olfr1419 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801326 CCDS:CCDS29616.1 GeneID:257938 MGI:3031253
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2222521-2221490; olfactory receptor MOR266-10 product : olfactory receptor 1419 protein_id : NP_001011775.1

name	EG622845 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270397 GeneID:622845 MGI:3643502
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476676.1

name	EG622845 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270395 GeneID:622845 MGI:3643502
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476658.1

name	Olfr1420 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238900 CCDS:CCDS29617.1 GeneID:258405 MGI:3031254
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2247227-2248156; olfactory receptor MOR266-4 product : olfactory receptor 1420 protein_id : NP_666522.1

name	AV312086 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369916 GeneID:225929 MGI:2147679
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC225929 protein_id : NP_766223.1

name	Osbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133504509 GeneID:76303 MGI:97447
definition	GO_function : GO:0008142 - oxysterol binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : oxysterol binding protein protein_id : NP_001028346.1

name	Olfr1423 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239022 CCDS:CCDS29618.1 GeneID:258675 MGI:3031257
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2393361-2392429; olfactory receptor MOR239-3 product : olfactory receptor 1423 protein_id : NP_666891.1

name	Olfr1424 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239020 CCDS:CCDS29619.1 GeneID:258676 MGI:3031258
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2418550-2417609; olfactory receptor MOR239-2 product : olfactory receptor 1424 protein_id : NP_666892.1

name	Olfr1425 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801464 GeneID:258155 MGI:3031259
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2433425-2432490; olfactory receptor MOR239-7 product : olfactory receptor 1425 protein_id : NP_001011853.1

name	Olfr1426 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129241 CCDS:CCDS29620.1 GeneID:258805 MGI:3031260
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2447610-2446675; olfactory receptor MOR239-1 product : olfactory receptor 1426 protein_id : NP_667020.1

name	Olfr1427 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239016 CCDS:CCDS29621.1 GeneID:258674 MGI:3031261
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2458473-2457538; olfactory receptor MOR239-4 product : olfactory receptor 1427 protein_id : NP_666890.1

name	Olfr1428 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239018 CCDS:CCDS29622.1 GeneID:258673 MGI:3031262
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RE5P-2468394-2467450; olfactory receptor MOR239-5 product : olfactory receptor 1428 protein_id : NP_666889.1

name	Olfr76 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239080 CCDS:CCDS29623.1 GeneID:258677 MGI:2153205
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS] [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS] [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2479601-2478648 product : olfactory receptor 76 protein_id : NP_666893.1

name	Olfr1431 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239082 CCDS:CCDS29624.1 GeneID:258409 MGI:3031265
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2573738-2574676; olfactory receptor MOR214-5 product : olfactory receptor 1431 protein_id : NP_666526.1

name	Olfr262 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239090 CCDS:CCDS29625.1 GeneID:258683 MGI:3030096
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2N4A9-18144-19082; olfactory receptor MOR214-1 product : olfactory receptor 262 protein_id : NP_666899.1

name	Olfr232 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239086 CCDS:CCDS29626.1 GeneID:258681 MGI:3030066
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T03CT6-1-477 product : olfactory receptor 232 protein_id : NP_666897.1

name	Olfr1433 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239088 GeneID:258680 MGI:3031267
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RE5P-2610001-2610414 product : olfactory receptor 1433 protein_id : NP_666896.1

name	Olfr1436 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239092 CCDS:CCDS29627.1 GeneID:258682 MGI:3031270
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RE5P-2634596-2633658; olfactory receptor MOR214-2 product : olfactory receptor 1436 protein_id : NP_666898.1

name	Olfr1437 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801438 CCDS:CCDS29628.1 GeneID:258117 MGI:3031271
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2658227-2657289; olfactory receptor MOR214-6 product : olfactory receptor 1437 protein_id : NP_001011839.1

name	Olfr1440 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239084 CCDS:CCDS29629.1 GeneID:258679 MGI:3031274
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2725206-2726153; olfactory receptor MOR215-1 product : olfactory receptor 1440 protein_id : NP_666895.1

name	Olfr1441 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239078 CCDS:CCDS29630.1 GeneID:258678 MGI:3031275
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2753221-2754177; olfactory receptor MOR215-2 product : olfactory receptor 1441 protein_id : NP_666894.1

name	Pfpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506577 GeneID:56093 MGI:1860266
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : ectoplacental cone, invasive trophoblast giant cells, extraembryonic ectoderm and chorion sequence 50 product : pore forming protein-like protein_id : NP_062413.1

name	Mpeg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133506753 GeneID:17476 MGI:1333743
definition	codon_start : 1 product : macrophage expressed gene 1 protein_id : NP_034951.1

name	Dtx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254207 CCDS:CCDS29631.1 GeneID:207521 MGI:2672905
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : deltex 4 homolog protein_id : NP_766030.2

name	EG625046 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270391 GeneID:625046 MGI:3643874
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894682.2

name	4632417K18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386132 CCDS:CCDS29632.1 GeneID:107373 MGI:1915508
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC107373 protein_id : NP_080916.1

name	EG240549 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000640 GeneID:240549 MGI:3643569
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC240549 protein_id : NP_001013784.1

name	Glyat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122359 CCDS:CCDS29633.1 GeneID:107146 MGI:2147502
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0047961 - glycine N-acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : glycine-N-acyltransferase protein_id : NP_666047.1

name	Olfr1442 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129447 CCDS:CCDS29634.1 GeneID:258692 MGI:3031276
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RE5P-3000589-3001527; olfactory receptor MOR202-9 product : olfactory receptor 1442 protein_id : NP_666908.1

name	Olfr1443 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129441 CCDS:CCDS29635.1 GeneID:258693 MGI:3031277
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3006492-3007430; olfactory receptor MOR202-8 product : olfactory receptor 1443 protein_id : NP_666909.1

name	Keg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19482166 CCDS:CCDS29636.1 GeneID:64697 MGI:1928492
definition	GO_component : GO:0005813 - centrosome [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0043015 - gamma-tubulin binding [Evidence ISS] GO_process : GO:0000074 - regulation of progression through cell cycle [Evidence ISS] codon_start : 1 product : hypothetical protein LOC64697 protein_id : NP_083826.1

name	Cntf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25952141 CCDS:CCDS29637.1 GeneID:12803 MGI:88439
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0040007 - growth [Evidence IEA]; GO:0048644 - muscle morphogenesis [Evidence IGI]; GO:0046533 - negative regulation of photoreceptor cell differentiation [Evidence IDA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0048666 - neuron development [Evidence IGI]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0042517 - positive regulation of tyrosine phosphorylation of Stat3 protein [Evidence IDA]; GO:0046668 - regulation of retinal programmed cell death [Evidence IDA] codon_start : 1 product : ciliary neurotrophic factor protein_id : NP_740756.1

name	Zfp91 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90669976 GeneID:109910 MGI:104854
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : zinc finger protein 91 isoform b protein_id : NP_001034807.1

name	Zfp91 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90669983 GeneID:109910 MGI:104854
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : zinc finger protein 91 isoform a protein_id : NP_443735.2

name	Lpxn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26080416 CCDS:CCDS29638.1 GeneID:107321 MGI:2147677
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : leupaxin protein_id : NP_598913.1

name	EG383436 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38084914 GeneID:383436 MGI:3646958
definition	codon_start : 1 product : similar to 60S acidic ribosomal protein P1 isoform 1 protein_id : XP_357052.1

name	EG383436 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998211 GeneID:383436 MGI:3646958
definition	codon_start : 1 product : similar to 60S acidic ribosomal protein P1 isoform 2 protein_id : XP_904402.1

name	Olfr1444 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129433 CCDS:CCDS29640.1 GeneID:258697 MGI:3031278
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3191201-3192160; olfactory receptor MOR202-4 product : olfactory receptor 1444 protein_id : NP_666913.1

name	Olfr1445 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129443 CCDS:CCDS29641.1 GeneID:258694 MGI:3031279
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3213352-3214296; olfactory receptor MOR202-7 product : olfactory receptor 1445 protein_id : NP_666910.1

name	Olfr1446 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129429 CCDS:CCDS29642.1 GeneID:258699 MGI:3031280
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3220047-3219130; olfactory receptor MOR202-2 product : olfactory receptor 1446 protein_id : NP_666915.1

name	Olfr1447 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129435 CCDS:CCDS29643.1 GeneID:258698 MGI:3031281
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3231251-3230331; olfactory receptor MOR202-3 product : olfactory receptor 1447 protein_id : NP_666914.1

name	Olfr1448 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129439 CCDS:CCDS29644.1 GeneID:258696 MGI:3031282
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3249780-3248836; olfactory receptor MOR202-5 product : olfactory receptor 1448 protein_id : NP_666912.1

name	Olfr1449 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129681 CCDS:CCDS29645.1 GeneID:258300 MGI:3031283
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3264213-3265157; olfactory receptor MOR202-34 product : olfactory receptor 1449 protein_id : NP_666415.1

name	Olfr1450 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129559 CCDS:CCDS29646.1 GeneID:258368 MGI:3031284
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3283121-3284098; olfactory receptor MOR202-33 product : olfactory receptor 1450 protein_id : NP_666483.1

name	Olfr1451 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129431 CCDS:CCDS29647.1 GeneID:258700 MGI:3031285
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3328502-3329434; olfactory receptor MOR202-1 product : olfactory receptor 1451 protein_id : NP_666916.1

name	Olfr1453 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129437 CCDS:CCDS29648.1 GeneID:258695 MGI:3031287
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3357666-3356743; olfactory receptor MOR202-6 product : olfactory receptor 1453 protein_id : NP_666911.1

name	Olfr1454 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239136 CCDS:CCDS29649.1 GeneID:258687 MGI:3031288
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3390804-3391727; olfactory receptor MOR202-14 product : olfactory receptor 1454 protein_id : NP_666903.1

name	Olfr1457 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129495 CCDS:CCDS29650.1 GeneID:258568 MGI:3031291
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3423041-3422097; olfactory receptor MOR202-20 product : olfactory receptor 1457 protein_id : NP_666786.1

name	EG667271 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270393 GeneID:667271 MGI:3645607
definition	codon_start : 1 product : similar to olfactory receptor Olfr1458 protein_id : XP_001475664.1

name	Olfr1459 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239134 CCDS:CCDS29651.1 GeneID:258684 MGI:3031293
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3473421-3472498; olfactory receptor MOR202-17 product : olfactory receptor 1459 protein_id : NP_666900.1

name	Olfr1461 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170042 CCDS:CCDS29652.1 GeneID:258299 MGI:3031295
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3491834-3492772; olfactory receptor MOR202-35 product : olfactory receptor 1461 protein_id : NP_666414.1

name	Olfr1462 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239142 CCDS:CCDS29653.1 GeneID:258688 MGI:3031296
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3517488-3518411; olfactory receptor MOR202-13 product : olfactory receptor 1462 protein_id : NP_666904.1

name	Olfr1463 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801440 CCDS:CCDS29654.1 GeneID:258120 MGI:3031297
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3560863-3561795; olfactory receptor MOR202-29P product : olfactory receptor 1463 protein_id : NP_001011840.1

name	Olfr1465 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801442 CCDS:CCDS29655.1 GeneID:258121 MGI:3031299
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3645346-3644423; olfactory receptor MOR202-28 product : olfactory receptor 1465 protein_id : NP_001011841.1

name	Olfr1466 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239140 CCDS:CCDS29656.1 GeneID:258689 MGI:3031300
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3672907-3673839; olfactory receptor MOR202-12 product : olfactory receptor 1466 protein_id : NP_666905.1

name	Olfr1467 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239138 CCDS:CCDS29657.1 GeneID:258686 MGI:3031301
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3695694-3696620; olfactory receptor MOR202-15 product : olfactory receptor 1467 protein_id : NP_666902.1

name	Olfr1469 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239146 CCDS:CCDS29658.1 GeneID:258690 MGI:3031303
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3743369-3744289; olfactory receptor MOR202-11 product : olfactory receptor 1469 protein_id : NP_666906.1

name	Olfr1471 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821662 CCDS:CCDS29659.1 GeneID:258231 MGI:3031305
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3777626-3778570; MOR202-47_p; olfactory receptor MOR202-38 product : olfactory receptor 1471 protein_id : NP_997015.2

name	Olfr1472 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110671326 CCDS:CCDS29660.1 GeneID:258685 MGI:3031306
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3787124-3786180; olfactory receptor MOR202-16 product : olfactory receptor 1472 protein_id : NP_666901.2

name	Olfr1474 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801444 CCDS:CCDS29661.1 GeneID:258123 MGI:3031308
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3803583-3804527; olfactory receptor MOR202-26P product : olfactory receptor 1474 protein_id : NP_001011842.1

name	Olfr1475 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129687 CCDS:CCDS29662.1 GeneID:258298 MGI:3031309
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3812807-3811863; olfactory receptor MOR202-36 product : olfactory receptor 1475 protein_id : NP_666413.1

name	Olfr1477 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983620 CCDS:CCDS29663.1 GeneID:258691 MGI:3031311
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3834960-3835907; olfactory receptor MOR202-10 product : olfactory receptor 1477 protein_id : NP_666907.2

name	Olfr1480 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430752 CCDS:CCDS29664.1 GeneID:404339 MGI:3031314
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3862389-3863336 product : olfactory receptor 1480 protein_id : NP_997458.1

name	Olfr1484 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129707 CCDS:CCDS29665.1 GeneID:258288 MGI:3031318
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3917859-3918806; olfactory receptor MOR202-37 product : olfactory receptor 1484 protein_id : NP_666403.1

name	Olfr1487 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239128 CCDS:CCDS29666.1 GeneID:258629 MGI:3031321
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3951719-3952666; olfactory receptor MOR202-18 product : olfactory receptor 1487 protein_id : NP_666847.1

name	Olfr1489 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239130 CCDS:CCDS29667.1 GeneID:258628 MGI:3031323
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3965668-3966609; olfactory receptor MOR202-19 product : olfactory receptor 1489 protein_id : NP_666846.1

name	Olfr1490 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801428 CCDS:CCDS29668.1 GeneID:258098 MGI:3031324
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3987000-3987950; olfactory receptor MOR266-6P product : olfactory receptor 1490 protein_id : NP_001011832.1

name	Olfr1491 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129608 CCDS:CCDS29669.1 GeneID:258342 MGI:3031325
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4037809-4038768; olfactory receptor MOR266-8 product : olfactory receptor 1491 protein_id : NP_666457.1

name	Olfr1494 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128953 CCDS:CCDS29670.1 GeneID:258992 MGI:3031328
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4082427-4083374; olfactory receptor MOR266-1 product : olfactory receptor 1494 protein_id : NP_667201.1

name	Olfr1495 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129614 CCDS:CCDS29671.1 GeneID:258341 MGI:3031329
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4101369-4102328; olfactory receptor MOR266-9 product : olfactory receptor 1495 protein_id : NP_666456.1

name	Olfr1496 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128959 CCDS:CCDS29672.1 GeneID:258991 MGI:3031330
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RE5P-4112771-4113718; olfactory receptor MOR127-1 product : olfactory receptor 1496 protein_id : NP_667200.1

name	Olfr1497 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129359 CCDS:CCDS29673.1 GeneID:258736 MGI:3031331
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4127765-4126821; olfactory receptor MOR212-1 product : olfactory receptor 1497 protein_id : NP_666952.1

name	EG666985 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666985
definition	number : 1 pseudo : _no_value

name	EG666985 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666985
definition	number : 2 pseudo : _no_value

name	LOC667300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667300
definition	number : 4 pseudo : _no_value

name	LOC667300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667300
definition	number : 3 pseudo : _no_value

name	LOC667300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667300
definition	number : 2 pseudo : _no_value

name	LOC667300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667300
definition	number : 1 pseudo : _no_value

name	LOC100041185 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041185
definition	number : 3 pseudo : _no_value

name	LOC100041185 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041185
definition	number : 2 pseudo : _no_value

name	LOC100041185 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041185
definition	number : 1 pseudo : _no_value

name	LOC671653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671653
definition	number : 3 pseudo : _no_value

name	LOC671653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671653
definition	number : 2 pseudo : _no_value

name	LOC671653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671653
definition	number : 1 pseudo : _no_value

name	EG433224 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:86198299 GeneID:433224 MGI:3645436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 47 ESTs, 8 Proteins product : predicted gene, EG433224 pseudo : _no_value transcript_id : NR_002891.1

clone name	MSMg01-450H14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-501A03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-261H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523N08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-432P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372I05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-494K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457J14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-330L15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-053D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-109J24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-106O12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-509E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-121F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361A18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-211K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-156O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518B15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-113G03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-097J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-114O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461G02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-191C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-129F24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-091P16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-094F14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-094D16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137A08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-401E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-444G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444P15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-304B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338B21
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-196P09.b	B6Ng01-196P09.g
ACC	GA018960	GA018961
length	1,166	641
definition	B6Ng01-196P09.b	B6Ng01-196P09.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(12,874,878 - 12,876,017)	(44,069,030 - 44,069,356)
sequence	gaattccaacactttgcatgttagaatgcaaccattctcttttctgtttt ctaagcttcactccaatcagaaatgagagtccttcctggaccaagagaac tcatgtatattaaacatgatgggacaggagtatcactgagcagaggatgt gaagttatcctcggaagcatcagctcaccaaatctattataactctcctt tctgctcacgagttaccaggactttcacttcctgtttccaatgaacacat atttcaccagctcctgaagctactcctttggcttcatgcagactctaaaa tttaaattagatgactaattttggtgtgacaaatatgagattactggcag tgaagtctctgggcgtctccatgtgttagagtcatctcatccctaaattg agaagatttaggtaaaaccttctaggtgaatacatgctactaacatccaa ggcagtattgcataaaggaaatatttgcccacttgagccagcctgtcctt gataaaatttctacacaagtagaaagagaaatccaccccaagtcttgggt ttggattttagtcctgttgctgtttgttaaggcagggtctcattctagcc caagctgacctggaactaacaaggtagcccaggctgaccttacactgtgg ccagtcattcaacctagtctcaagtgctggctgggatcgtgggtacaaac tactgtgcctggcagacactacctgccttttgtttcattttggttttttg agacagggcctcagtacatagcccttgtttgggctacaacttgctatgta acataaaccagactggcctcaattcataggagatctatctgcttctgcct tccatgtctgactttttaaagataggatcgtacattagatagcctaggct ggcctcaaatttttccatacaaacaaaaataaccattagtttttgatcct tcctgcttccaccttctggagccataaggattgaaggcaagcaacactac atttccattgcaaattgttacaattttgaagaagaccattgaagggttaa ctactagcagttaattaaacctgttagcaaattgggattatcctacagtc cagcttccaaagttggcttatttttcctacatttctgtgaaaaaagattt tcttaaacaacctatg	gaattcttgaatcaaatatgtgtccataacctgggaatatggattcaggt taccccaactaacacgttctgacagcgaaaacatttcatgaagttctaca gtcacattactataaaggtcagaagtcagagcaatctccaagtatgtagg tagaaacatcatgtaggcttggtcacagcaaagtggagacatctctgcta taggtctcaggtgctatctgatgacaatcgtagcttttgagttagaagat gtcagagcctcctaagttcatagatacccaaaggttttccagacagttaa aacatcaaaagaagccgggcatggtggtgcacgcttttcatcccagcact cgggaggcagtggcaggcggatttttgagttcgaggccagcctggtctac aaagtgagttccaggacagccagggctatacagagaaaaccctgtctcaa aaaacaaaacaaaacaaaaacaaaaaaaaacaaaacaaaaaaaaaacatc aaaagagtctttagattggagacagaggtgagaaatgtgtggctggaagg gttctgaaatagctagagataatttttgcctctgagtgtacaatatctca gttctcctcaactacagacttctgataatatgtccagcttt
quality values	Open. Hide. 58 24 29 22 58 58 28 13 36 28 30 62 62 62 62 62 39 62 47 62 62 62 62 62 62 47 41 49 62 62 62 62 47 42 56 38 38 45 38 34 38 49 38 49 33 59 59 62 62 62 49 46 62 62 62 62 62 62 59 51 59 62 62 59 49 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 54 42 42 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 59 59 59 59 62 62 54 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 49 54 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 59 62 62 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 56 45 44 56 56 56 62 62 47 45 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 54 51 62 62 62 62 62 56 62 54 62 56 62 62 62 62 62 62 62 62 62 62 49 56 56 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 52 62 62 62 62 47 62 62 62 54 62 62 62 62 62 62 62 52 62 62 54 33 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 41 54 54 54 37 38 46 58 54 58 58 58 58 58 58 54 58 58 54 47 58 54 58 58 52 46 54 43 52 58 54 54 34 46 37 54 58 58 54 52 52 54 45 41 58 54 54 58 52 54 50 58 58 42 54 54 58 54 54 54 54 34 54 32 42 50 52 50 52 54 54 42 45 45 52 49 52 42 34 49 52 49 47 42 18 37 41 58 54 54 49 51 51 52 50 46 42 50 50 58 49 58 53 51 35 49 58 49 47 32 16 51 52 40 58 39 39 42 27 39 13 49 46 46 50 50 51 49 58 40 50 47 50 50 50 48 33 50 18 39 39 46 47 36 46 40 48 50 54 53 53 42 36 58 26 46 26 58 51 35 39 32 58 58 46 58 32 13 58 58 58 53 42 46 50 21 41 33 31 37 58 41 47 32 41 42 35 39 34 35 37 40 40 34 23 23 31 33 37 50 50 10 53 15 32 58 25 29 42 42 42 18 33 39 51 44 52 39 47 39 39 53 34 35 49 41 31 32 18 54 16 15 42 32 23 51 19 19 41 38 25 40 37 22 11 17 13 25 19 27 35 40 9 9 23 29 27 21 28 28 35 37 12 5 9 11 9 10 10 8 6 5 9 47 21 44 9 11 31 45 31 40 37 32 41 16 6 54 54 54 54 35 54 37 21 28 7 14 7 49 28 35 39 30 32 35 31 15 7 15 11 22 33 30 40 32 14 27 33 33 27 28 28 39 34 53 21 31 24 45 35 45 31 29 52 52 52 8 9 21 16 12 30 30 29 32 28 19 14 40 45 51 22 16 18 22 27 27 24 25 51 29 16 31 45 45 40 30 23 30 20 18 28 22 9 9 18 33 43 26 21 32 22 28 18 15 30 6 18 9 9 25 20 9 13 25 24 9 10 31 21 12 9 12 11 31 24 20 26 31 46 13 15 46 20 29 27 14 9 8 18 9 5 6 5 12 39 15 26 18 32 8 6 14 27 21 46 14 13 10 15 15 22 6 6 5 24 8 46 44 11 22 27 31 11 12 6 5 5 5 8 13 14 23 22 10 10 38 36 29 5 11 37 17 17 21 11 14 7 26 10 30 21 19 17 44 15 11 25 38 13 30 7 23 16 21 13 5 8 13 19 21 20 22 19 9 9 33 32 10 21 11 15 11 9 5 6 5 7 15 8 13 6 8 7 8 13 7 5 16 11 9 5 16 15 8 7 18 17 8 11 15 9 6 4 26 12 28 15 6 8 7 6 6 4 4 25 22 4 12 6 7 5 13 13 28 27 28 7 8 23 13 27 33 13 24 5 4 3 7 11 5 7 5 4 6 8 18 8 7	Open. Hide. 62 47 31 39 62 62 62 62 62 49 56 47 31 20 16 20 20 24 22 22 22 30 34 32 24 44 56 62 62 62 62 62 62 62 62 59 62 62 59 59 62 49 46 59 62 59 59 62 62 62 59 62 62 62 62 62 62 59 59 59 33 43 38 56 59 59 62 54 54 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 59 59 59 56 59 51 43 44 36 59 51 59 62 59 59 59 59 47 56 56 59 43 59 38 39 30 59 43 39 16 30 16 24 18 34 30 43 20 13 25 24 24 27 15 17 27 22 31 38 56 56 29 29 29 39 32 21 42 47 42 32 29 29 37 31 22 31 56 35 44 26 35 16 22 16 22 38 32 30 30 38 14 39 51 14 14 22 10 13 17 39 17 20 31 11 10 14 14 10 14 22 24 24 10 23 31 14 20 15 10 18 14 38 39 24 30 20 22 10 20 23 24 17 17 14 20 20 24 27 16 21 14 25 27 24 13 17 27 22 17 23 36 30 17 24 47 17 9 38 14 9 22 13 23 12 38 27 52 47 43 40 21 38 23 50 43 46 33 52 27 35 14 23 38 22 34 35 35 32 42 20 15 17 19 13 9 62 39 31 38 41 22 28 24 31 38 42 54 52 36 46 12 13 15 13 19 39 42 42 47 16 41 20 20 29 8 29 37 42 21 30 20 17 18 16 16 13 27 22 10 26 14 14 21 12 21 27 35 25 39 42 31 28 10 16 13 18 13 13 19 12 20 20 24 14 25 22 22 7 9 25 16 17 22 30 30 39 46 52 20 28 10 7 15 38 8 16 16 10 8 8 30 34 46

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_12874878_12876017
seq2: B6Ng01-196P09.b_44_1209 (reverse)

seq1  CATA-GTTG-TTAAGGAAATCTTTTT---CAGAAATGTAG--AAAATAAG  43
      |||| |||| ||||| ||||||||||   |||||||||||  ||||||||
seq2  CATAGGTTGTTTAAGAAAATCTTTTTTCACAGAAATGTAGGAAAAATAAG  50

seq1  -CAACTTTGGAAGCT-GACTGTA-GATAAT-CCAATTTGCT-ACAGG-TT  87
       |||||||||||||| ||||||| |||||| |||||||||| ||||| ||
seq2  CCAACTTTGGAAGCTGGACTGTAGGATAATCCCAATTTGCTAACAGGTTT  100

seq1  AATAAACTGCTAGTAGTT-ACCCCTCAATGGTC-TCTTC-AAATTGTAAC  134
      ||| |||||||||||||| |||| ||||||||| ||||| ||||||||||
seq2  AATTAACTGCTAGTAGTTAACCCTTCAATGGTCTTCTTCAAAATTGTAAC  150

seq1  AATTTGC-ATGG-AATGTAGTGTTGCTTGCCTTCAATCCTTAT-GCTCCA  181
      ||||||| |||| |||||||||||||||||||||||||||||| ||||||
seq2  AATTTGCAATGGAAATGTAGTGTTGCTTGCCTTCAATCCTTATGGCTCCA  200

seq1  G-AGGTGGAAGCAGG-AGGATCAAAAACTAATGGTTATTTTTGTTTGTAT  229
      | ||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  GAAGGTGGAAGCAGGAAGGATCAAAAACTAATGGTTATTTTTGTTTGTAT  250

seq1  GG-AAAATTTGAGGCCAGCCTAGGCTATCT-ATGTACGATCCTATCTTTA  277
      || ||||||||||||||||||||||||||| |||||||||||||||||||
seq2  GGAAAAATTTGAGGCCAGCCTAGGCTATCTAATGTACGATCCTATCTTTA  300

seq1  AAAAGTCAGACATGGAAGGCAGAAGCAGATAGATCT-CTATGAATTGAGG  326
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  AAAAGTCAGACATGGAAGGCAGAAGCAGATAGATCTCCTATGAATTGAGG  350

seq1  CCAGTCTGGTTTATGTTACATAGCAAGTTGTAGCCC-AACAAGGGCTATG  375
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  CCAGTCTGGTTTATGTTACATAGCAAGTTGTAGCCCAAACAAGGGCTATG  400

seq1  TACTGAGGCCCTGTCTC-AAAAACCAAAATGAAACAAAAGGCAGGTAGTG  424
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  TACTGAGGCCCTGTCTCAAAAAACCAAAATGAAACAAAAGGCAGGTAGTG  450

seq1  TCTGCCAGGCACAGTAGTTTGTACCCACGATCCCAGCCAGCACTTGAGAC  474
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCCAGGCACAGTAGTTTGTACCCACGATCCCAGCCAGCACTTGAGAC  500

seq1  TAGGTTGAATGACTGGCCACAGTGTAAGGTCAGCCTGGGCTACCTTGTTA  524
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTTGAATGACTGGCCACAGTGTAAGGTCAGCCTGGGCTACCTTGTTA  550

seq1  GTTCCAGGTCAGCTTGGGCTAGAATGAGACCCTGCCTTAACAAACAGCAA  574
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCCAGGTCAGCTTGGGCTAGAATGAGACCCTGCCTTAACAAACAGCAA  600

seq1  CAGGACTAAAATCCAAACCCAAGACTTGGGGTGGATTTCTCTTTCTACTT  624
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGACTAAAATCCAAACCCAAGACTTGGGGTGGATTTCTCTTTCTACTT  650

seq1  GTGTAGAAATTTTATCAAGGACAGGCTGGCTCAAGTGGGCAAATATTTCC  674
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTAGAAATTTTATCAAGGACAGGCTGGCTCAAGTGGGCAAATATTTCC  700

seq1  TTTATGCAATACTGCCTTGGATGTTAGTAGCATGTATTCACCTAGAAGGT  724
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATGCAATACTGCCTTGGATGTTAGTAGCATGTATTCACCTAGAAGGT  750

seq1  TTTACCTAAATCTTCTCAATTTAGGGATGAGATGACTCTAACACATGGAG  774
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACCTAAATCTTCTCAATTTAGGGATGAGATGACTCTAACACATGGAG  800

seq1  ACGCCCAGAGACTTCACTGCCAGTAATCTCATATTTGTCACACCAAAATT  824
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGCCCAGAGACTTCACTGCCAGTAATCTCATATTTGTCACACCAAAATT  850

seq1  AGTCATCTAATTTAAATTTTAGAGTCTGCATGAAGCCAAAGGAGTAGCTT  874
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCATCTAATTTAAATTTTAGAGTCTGCATGAAGCCAAAGGAGTAGCTT  900

seq1  CAGGAGCTGGTGAAATATGTGTTCATTGGAAACAGGAAGTGAAAGTCCTG  924
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAGCTGGTGAAATATGTGTTCATTGGAAACAGGAAGTGAAAGTCCTG  950

seq1  GTAACTCGTGAGCAGAAAGGAGAGTTATAATAGATTTGGTGAGCTGATGC  974
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAACTCGTGAGCAGAAAGGAGAGTTATAATAGATTTGGTGAGCTGATGC  1000

seq1  TTCCGAGGATAACTTCACATCCTCTGCTCAGTGATACTCCTGTCCCATCA  1024
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCGAGGATAACTTCACATCCTCTGCTCAGTGATACTCCTGTCCCATCA  1050

seq1  TGTTTAATATACATGAGTTCTCTTGGTCCAGGAAGGACTCTCATTTCTGA  1074
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTAATATACATGAGTTCTCTTGGTCCAGGAAGGACTCTCATTTCTGA  1100

seq1  TTGGAGTGAAGCTTAGAAAACAGAAAAGAGAATGGTTGCATTCTAACATG  1124
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGAGTGAAGCTTAGAAAACAGAAAAGAGAATGGTTGCATTCTAACATG  1150

seq1  CAAAGTGTTGGAATTC  1140
      ||||||||||||||||
seq2  CAAAGTGTTGGAATTC  1166

seq1: chr18_44069030_44069356
seq2: B6Ng01-196P09.g_67_563 (reverse)

seq1  TGTTTGTTTTTTGTTTTTGTTTTTGTTTTTGTTTTTGTTTTTGTTTTTGT  50
      ||||| ||||||| |||||||||  ||||||||||||||||  ||| | |
seq2  TGTTTTTTTTTTG-TTTTGTTTT--TTTTTGTTTTTGTTTTGTTTTGTTT  47

seq1  TTTG-GACAGGG-TTTCTCTGTATAGCCCTAGCTGACCTGGAACTCACTT  98
      |||| ||||||| ||||||||||||||||| |||| ||||||||||||||
seq2  TTTGAGACAGGGTTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTT  97

seq1  TGTAGACCAGGCTGGCCTCAAACTCAGAAATCCGCCTGCCCCTGCCTCCC  148
      ||||||||||||||||||| |||||| ||||||||||||| |||||||||
seq2  TGTAGACCAGGCTGGCCTCGAACTCAAAAATCCGCCTGCCACTGCCTCCC  147

seq1  GAGTGCTGGGATTAAAGGCGTGCACCACCACTCCCGGC--CTACTG-TGC  195
      |||||||||||| ||| |||||||||||||  ||||||  ||  || || 
seq2  GAGTGCTGGGATGAAAAGCGTGCACCACCATGCCCGGCTTCTTTTGATGT  197

seq1  TTT-------TGGA------TTGGG-------------------------  207
      |||       ||||      |||||                         
seq2  TTTAACTGTCTGGAAAACCTTTGGGTATCTATGAACTTAGGAGGCTCTGA  247

seq1  -AT-TTCTAACTGAAA------TTTTGGGCTCAGAT---TCCTG---GCT  243
       || |||||||| |||        |||   ||||||    ||||    ||
seq2  CATCTTCTAACTCAAAAGCTACGATTGTCATCAGATAGCACCTGAGACCT  297

seq1  AT----GAAAT-TCT--------CTGGGAACCAAAAGTCT-CAT--TGTT  277
      ||    || || |||        ||| || |   ||| || |||  ||||
seq2  ATAGCAGAGATGTCTCCACTTTGCTGTGACC---AAGCCTACATGATGTT  344

seq1  CC--CAGGCAT-CTT--AAAATGGCCT-AGTTCAACCCAT-------ATT  314
       |  |   ||| |||  | | ||  || | |||   || |       || 
seq2  TCTACCTACATACTTGGAGATTGCTCTGACTTCTGACCTTTATAGTAATG  394

seq1  TGATTCAAGAATT-------------------------------------  327
      ||| |  |||| |                                     
seq2  TGACTGTAGAACTTCATGAAATGTTTTCGCTGTCAGAACGTGTTAGTTGG  444

seq1  --------------------------------------------------  327
                                                        
seq2  GGTAACCTGAATCCATATTCCCAGGTTATGGACACATATTTGATTCAAGA  494

seq1  ---  327
         
seq2  ATT  497

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information