MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-207I05
Chromosome	6 (Build37)	19 (Build37)
Map Location	127,878,456 - 127,878,490	52,958,189 - 52,958,723
singlet/doublet	singlet	singlet
Overlap gene	Tspan11
Upstream gene	Rad51ap1, D6Wsu163e, LOC667473, LOC624256, Fgf6, Fgf23, 9630033F20Rik, Ccnd2, Tpi-rs11, EG243642, LOC100043578, EG640703, LOC100043848, Parp11, Efcab4b, Prmt8
Downstream gene	Tspan9, LOC100043853, LOC667560, Tead4, LOC652986, Tulp3, 5930416I19Rik, Foxm1, Nrip2, Itfg2, Fkbp4, EG667598, Pzp, LOC384494, EG667610, BC048546, Klrb1a, EG545878, LOC677440, Clec2h, LOC100043863, LOC100043861, Klrb1c, LOC100043862, Klrb1d, LOC667706, Clec2i
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rad51ap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19362 MGI:1098224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D6Wsu163e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28040 MGI:107893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667473 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC624256 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins pseudo : _no_value

name	Fgf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14177 MGI:95520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64654 MGI:1891427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9630033F20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319801 MGI:2442752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccnd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12444 MGI:88314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpi-rs11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:111223 MGI:98799
definition	note : triosephosphate isomerase related sequence 11 pseudo : _no_value

name	EG243642 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243642 MGI:3647516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 620 ESTs, 8 Proteins

name	LOC100043578 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG640703 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640703 MGI:3644558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 451 ESTs, 78 Proteins

name	LOC100043848 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 315 ESTs, 12 Proteins pseudo : _no_value

name	Parp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101187 MGI:2141505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efcab4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381812 MGI:2685919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prmt8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381813 MGI:3043083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68498 MGI:1915748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109246 MGI:1924558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043853 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 94 mRNAs, 2834 ESTs, 23 Proteins pseudo : _no_value

name	LOC667560 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Tead4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21679 MGI:106907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC652986 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:652986
definition	note : ribosomal protein L18 pseudogene pseudo : _no_value

name	Tulp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22158 MGI:1329045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5930416I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72440 MGI:1915315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14235 MGI:1347487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60345 MGI:1891884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itfg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101142 MGI:1915450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14228 MGI:95543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667598 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667598 MGI:3647551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 72 ESTs, 41 Proteins

name	Pzp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11287 MGI:87854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384494 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384494
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG667610 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667610 MGI:3644570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 239 ESTs, 10 Proteins pseudo : _no_value

name	BC048546 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232400 MGI:3039594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrb1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17057 MGI:107540
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545878 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545878 MGI:3644646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 189 ESTs, 10 Proteins

name	LOC677440 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	Clec2h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94071 MGI:2136934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs

name	LOC100043861 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 3 Proteins

name	Klrb1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17059 MGI:107538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043862 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043862
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Klrb1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80782 MGI:1931428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	Clec2i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93675 MGI:2136650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rad51ap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347569 GeneID:19362 MGI:1098224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD51 associated protein 1 transcript_id : NM_009013.3

name	D6Wsu163e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372851 GeneID:28040 MGI:107893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 6, Wayne State University 163, expressed transcript_id : NM_138594.3

name	Fgf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363075 GeneID:14177 MGI:95520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 6 transcript_id : NM_010204.1

name	Fgf23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625790 GeneID:64654 MGI:1891427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 23 transcript_id : NM_022657.3

name	9630033F20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802664 GeneID:319801 MGI:2442752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630033F20 gene transcript_id : NM_177003.4

name	Ccnd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80751174 GeneID:12444 MGI:88314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D2 transcript_id : NM_009829.3

name	EG243642 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255334 GeneID:243642 MGI:3647516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 620 ESTs, 8 Proteins product : predicted gene, EG243642 transcript_id : XM_145024.8

name	LOC100043578 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255336 GeneID:100043578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043578 transcript_id : XM_001480445.1

name	EG640703 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255338 GeneID:640703 MGI:3644558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 451 ESTs, 78 Proteins product : predicted gene, EG640703 transcript_id : XM_990939.2

name	Parp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130650 GeneID:101187 MGI:2141505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (ADP-ribose) polymerase family, member 11 transcript_id : NM_181402.3

name	Efcab4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802883 GeneID:381812 MGI:2685919
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF-hand calcium binding domain 4B transcript_id : NM_001033464.2

name	Prmt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235766 GeneID:381813 MGI:3043083
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein arginine N-methyltransferase 8 transcript_id : NM_201371.1

name	Tspan11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893231 GeneID:68498 MGI:1915748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 11 transcript_id : NM_026743.3

name	Tspan9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129877 GeneID:109246 MGI:1924558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 9 transcript_id : NM_175414.4

name	Tead4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430567 GeneID:21679 MGI:106907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TEA domain family member 4 transcript_id : NM_001080979.1

name	Tead4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430565 GeneID:21679 MGI:106907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TEA domain family member 4 transcript_id : NM_011567.2

name	Tulp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490352 GeneID:22158 MGI:1329045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubby-like protein 3 transcript_id : NM_011657.2

name	5930416I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574051 GeneID:72440 MGI:1915315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5930416I19 gene transcript_id : NM_197981.1

name	Foxm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517696 GeneID:14235 MGI:1347487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box M1 transcript_id : NM_008021.4

name	Nrip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468976 GeneID:60345 MGI:1891884
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor interacting protein 2 transcript_id : NM_021717.1

name	Itfg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527141 GeneID:101142 MGI:1915450
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha FG-GAP repeat containing 2 transcript_id : NM_133927.1

name	Fkbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129940 GeneID:14228 MGI:95543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 4 transcript_id : NM_010219.3

name	EG667598 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378120 GeneID:667598 MGI:3647551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 72 ESTs, 41 Proteins product : predicted gene, EG667598 transcript_id : XM_991392.1

name	Pzp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124256485 GeneID:11287 MGI:87854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy zone protein transcript_id : NM_007376.4

name	BC048546 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375259 GeneID:232400 MGI:3039594
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048546 transcript_id : NM_001001179.2

name	Klrb1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981643 GeneID:17057 MGI:107540
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily B member 1A transcript_id : NM_010737.2

name	EG545878 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378130 GeneID:545878 MGI:3644646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 189 ESTs, 9 Proteins product : predicted gene, EG545878, transcript variant 1 transcript_id : XM_620367.3

name	EG545878 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378128 GeneID:545878 MGI:3644646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 170 ESTs, 4 Proteins product : predicted gene, EG545878, transcript variant 6 transcript_id : XM_001003823.1

name	LOC677440 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255340 GeneID:677440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to C-type lectin domain family 2, member g transcript_id : XM_001480476.1

name	Clec2h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353148 GeneID:94071 MGI:2136934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 2, member h transcript_id : NM_053165.3

name	LOC100043863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255438 GeneID:100043863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs product : hypothetical protein LOC100043863 transcript_id : XM_001481112.1

name	LOC100043861 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255433 GeneID:100043861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 3 Proteins product : similar to natural killer lectin-like receptor protein 1 e transcript_id : XM_001481108.1

name	Klrb1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678745 GeneID:17059 MGI:107538
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily B member 1C transcript_id : NM_008527.1

name	LOC100043862 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255436 GeneID:100043862
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : similar to polyprotein transcript_id : XM_001481111.1

name	Klrb1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328453 GeneID:80782 MGI:1931428
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily B member 1D transcript_id : NM_030599.3

name	Clec2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9933349 GeneID:93675 MGI:2136650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 2, member i transcript_id : NM_020257.1

name	Rad51ap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626102 GeneID:19362 MGI:1098224
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003690 - double-stranded DNA binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence ISS] GO_process : GO:0006310 - DNA recombination [Evidence IPI]; GO:0006281 - DNA repair [Evidence IEA] [Evidence ISS]; GO:0000724 - double-strand break repair via homologous recombination [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : RAD51 associated protein 1 protein_id : NP_033039.2

name	D6Wsu163e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070406 CCDS:CCDS20560.1 GeneID:28040 MGI:107893
definition	codon_start : 1 product : hypothetical protein LOC28040 protein_id : NP_613060.1

name	Fgf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363076 CCDS:CCDS20561.1 GeneID:14177 MGI:95520
definition	GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : fibroblast growth factor 6 protein_id : NP_034334.1

name	Fgf23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12083589 CCDS:CCDS20562.1 GeneID:64654 MGI:1891427
definition	GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence TAS]; GO:0008083 - growth factor activity [Evidence TAS] GO_process : GO:0030643 - phosphate ion homeostasis [Evidence IMP]; GO:0030500 - regulation of bone mineralization [Evidence IMP] codon_start : 1 product : fibroblast growth factor 23 protein_id : NP_073148.1

name	9630033F20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892859 CCDS:CCDS20563.1 GeneID:319801 MGI:2442752
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA] codon_start : 1 product : RIKEN cDNA 9630033F20 gene protein_id : NP_795977.1

name	Ccnd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753310 CCDS:CCDS20564.1 GeneID:12444 MGI:88314
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] [Evidence IMP] codon_start : 1 product : cyclin D2 protein_id : NP_033959.1

name	EG243642 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255335 GeneID:243642 MGI:3647516
definition	codon_start : 1 product : hypothetical protein protein_id : XP_145024.7

name	LOC100043578 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255337 GeneID:100043578
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480495.1

name	EG640703 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255339 GeneID:640703 MGI:3644558
definition	codon_start : 1 product : similar to calmodulin protein_id : XP_996033.2

name	Parp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088906 CCDS:CCDS20565.1 GeneID:101187 MGI:2141505
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 product : poly (ADP-ribose) polymerase family, member 11 protein_id : NP_852067.1

name	Efcab4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701989 CCDS:CCDS20566.1 GeneID:381812 MGI:2685919
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : EF-hand calcium binding domain 4B protein_id : NP_001028636.1

name	Prmt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235767 GeneID:381813 MGI:3043083
definition	GO_component : GO:0005634 - nucleus [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0008469 - histone-arginine N-methyltransferase activity [Evidence ISS]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0035241 - protein-arginine omega-N monomethyltransferase activity [Evidence ISS]; GO:0008757 - S-adenosylmethionine-dependent methyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016571 - histone methylation [Evidence ISS]; GO:0018216 - peptidyl-arginine methylation [Evidence ISS]; GO:0019919 - peptidyl-arginine methylation, to asymmetrical-dimethyl arginine [Evidence ISS]; GO:0043393 - regulation of protein binding [Evidence ISS] codon_start : 1 note : HMT1 hnRNP methyltransferase-like 3; protein arginine N-methyltransferase 4 product : heterogeneous nuclear ribonucleoprotein methyltransferase-like 4 protein_id : NP_958759.1

name	Tspan11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507385 CCDS:CCDS20567.1 GeneID:68498 MGI:1915748
definition	codon_start : 1 product : tetraspanin 11 protein_id : NP_081019.1

name	Tspan9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425124 CCDS:CCDS20568.1 GeneID:109246 MGI:1924558
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : tetraspan NET-5 protein_id : NP_780623.1

name	Tead4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:148352316 GeneID:21679 MGI:106907
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IGI] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : alternative start codon note : isoform b is encoded by transcript variant 2; FGF-regulated 19; ETF-related factor-2; TEF-1-related factor product : TEA domain family member 4 isoform b protein_id : NP_001074448.2 transl_except : (pos:complement(128221088..128221090),aa:Met)

name	Tead4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:148352315 GeneID:21679 MGI:106907
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IGI] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : alternative start codon note : isoform a is encoded by transcript variant 1; FGF-regulated 19; ETF-related factor-2; TEF-1-related factor product : TEA domain family member 4 isoform a protein_id : NP_035697.3 transl_except : (pos:complement(128221088..128221090),aa:Met)

name	Tulp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755905 GeneID:22158 MGI:1329045
definition	codon_start : 1 product : tubby-like protein 3 protein_id : NP_035787.1

name	5930416I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574052 GeneID:72440 MGI:1915315
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72440 protein_id : NP_932098.1

name	Foxm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517697 CCDS:CCDS20570.1 GeneID:14235 MGI:1347487
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IEA] [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence ISS]; GO:0001889 - liver development [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0001558 - regulation of cell growth [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 note : trident; forkhead homolog 16 product : forkhead box M1 protein_id : NP_032047.4

name	Nrip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468977 CCDS:CCDS20571.1 GeneID:60345 MGI:1891884
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IDA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 exception : mismatches in translation function : nuclear receptor interacting protein note : neuronal interacting factor 1 product : nuclear receptor interacting protein 2 protein_id : NP_068363.1

name	Itfg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527142 CCDS:CCDS20572.1 GeneID:101142 MGI:1915450
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 product : integrin alpha FG-GAP repeat containing 2 protein_id : NP_598688.1

name	Fkbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753882 CCDS:CCDS20573.1 GeneID:14228 MGI:95543
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IDA]; GO:0005488 - binding [Evidence IEA]; GO:0035259 - glucocorticoid receptor binding [Evidence IDA]; GO:0005525 - GTP binding [Evidence IDA]; GO:0031072 - heat shock protein binding [Evidence IDA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA]; GO:0051219 - phosphoprotein binding [Evidence IDA] GO_process : GO:0007566 - embryo implantation [Evidence IMP]; GO:0046661 - male sex differentiation [Evidence IMP]; GO:0031503 - protein complex localization [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0006463 - steroid hormone receptor complex assembly [Evidence IDA] codon_start : 1 product : FK506 binding protein 4 protein_id : NP_034349.1

name	EG667598 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255431 GeneID:667598 MGI:3647551
definition	codon_start : 1 product : similar to U-snRNP-associated cyclophilin protein_id : XP_996486.2

name	Pzp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347469 GeneID:11287 MGI:87854
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IDA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0017114 - wide-spectrum protease inhibitor activity [Evidence IEA] codon_start : 1 note : alpha 1 macroglobulin product : pregnancy zone protein protein_id : NP_031402.3

name	BC048546 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677551 GeneID:232400 MGI:3039594
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cDNA sequence BC048546 protein_id : NP_001001179.1

name	Klrb1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981644 CCDS:CCDS20574.1 GeneID:17057 MGI:107540
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : lymphocyte antigen 55 complex, locus A; natural killer cell receptor protein NKR-P1A; natural killer cell receptor-P1 product : killer cell lectin-like receptor subfamily B member 1A protein_id : NP_034867.2

name	EG545878 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63546142 GeneID:545878 MGI:3644646
definition	codon_start : 1 product : similar to TOM1 isoform 1 protein_id : XP_620367.1

name	EG545878 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378129 GeneID:545878 MGI:3644646
definition	codon_start : 1 product : similar to TOM1 isoform 6 protein_id : XP_001003823.1

name	LOC677440 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255341 GeneID:677440
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480526.1

name	Clec2h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745110 CCDS:CCDS20576.1 GeneID:94071 MGI:2136934
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS] GO_function : GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] GO_process : GO:0006968 - cellular defense response [Evidence TAS] codon_start : 1 note : C-type lectin related f product : C-type lectin domain family 2, member h protein_id : NP_444395.2

name	LOC100043863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255439 GeneID:100043863
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481162.1

name	LOC100043861 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255434 GeneID:100043861
definition	codon_start : 1 product : similar to natural killer lectin-like receptor protein 1 e protein_id : XP_001481158.1

name	LOC100043862 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255437 GeneID:100043862
definition	codon_start : 1 product : similar to polyprotein protein_id : XP_001481161.1

name	Klrb1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678746 GeneID:17059 MGI:107538
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0045954 - positive regulation of natural killer cell mediated cytotoxicity [Evidence IDA] codon_start : 1 note : lymphocyte antigen 59; natural killer cell-associated antigen 1; lymphocyte antigen 55 complex, locus C; killer cell lectin-like receptor subfamily A member 1C; natural killer cell receptor protein NKR-P1C; natural killer cell receptor-P1 product : killer cell lectin-like receptor subfamily B member 1C protein_id : NP_032553.1

name	Klrb1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328454 GeneID:80782 MGI:1931428
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0045953 - negative regulation of natural killer cell mediated cytotoxicity [Evidence IDA] codon_start : 1 exception : mismatches in translation note : lymphocyte antigen 55 complex, locus D; killer cell lectin-like receptor subfamily A member 1D product : killer cell lectin-like receptor subfamily B member 1D protein_id : NP_085102.3

name	Clec2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9933350 GeneID:93675 MGI:2136650
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA] GO_function : GO:0046703 - natural killer cell lectin-like receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] GO_process : GO:0043113 - receptor clustering [Evidence IMP]; GO:0030833 - regulation of actin filament polymerization [Evidence IMP]; GO:0045076 - regulation of interleukin-2 biosynthesis [Evidence IMP]; GO:0042129 - regulation of T cell proliferation [Evidence IMP]; GO:0050852 - T cell receptor signaling pathway [Evidence IMP] codon_start : 1 note : osteoclast inhibitory lectin related protein 2; C-type lectin 1 product : C-type lectin domain family 2, member i protein_id : NP_064653.1

name	LOC667473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667473
definition	number : 2 pseudo : _no_value

name	LOC667473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667473
definition	number : 1 pseudo : _no_value

name	LOC667560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667560
definition	number : 1 pseudo : _no_value

name	LOC384494 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384494
definition	number : 2 pseudo : _no_value

name	LOC384494 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384494
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:235557
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161454
definition	standard_name : RH124632

name	(CDS detail)
type	STS
link
xref	UniSTS:142651
definition	standard_name : D6Wsu163e

name	(CDS detail)
type	STS
link
xref	UniSTS:156193
definition	standard_name : GDB:214840

name	(CDS detail)
type	STS
link
xref	UniSTS:143094
definition	standard_name : Fgf6

name	(CDS detail)
type	STS
link
xref	UniSTS:125000
definition	standard_name : M92416

name	(CDS detail)
type	STS
link
xref	UniSTS:159574
definition	standard_name : M92416

name	(CDS detail)
type	STS
link
xref	UniSTS:142642
definition	standard_name : D6Uwa1

name	(CDS detail)
type	STS
link
xref	UniSTS:130763
definition	standard_name : D6Mit218

name	(CDS detail)
type	STS
link
xref	UniSTS:165491
definition	standard_name : AI595337

name	(CDS detail)
type	STS
link
xref	UniSTS:208032
definition	standard_name : RH126720

name	(CDS detail)
type	STS
link
xref	UniSTS:208031
definition	standard_name : C85509

name	(CDS detail)
type	STS
link
xref	UniSTS:235559
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235558
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:210096
definition	standard_name : RH136101

name	(CDS detail)
type	STS
link
xref	UniSTS:208030
definition	standard_name : C86853

name	(CDS detail)
type	STS
link
xref	UniSTS:141259
definition	standard_name : Ccnd2

name	(CDS detail)
type	STS
link
xref	UniSTS:130677
definition	standard_name : D6Mit133

name	(CDS detail)
type	STS
link
xref	UniSTS:165490
definition	standard_name : AI851877

name	(CDS detail)
type	STS
link
xref	UniSTS:130889
definition	standard_name : D6Mit335

name	(CDS detail)
type	STS
link
xref	UniSTS:130922
definition	standard_name : D6Mit368

name	(CDS detail)
type	STS
link
xref	UniSTS:123777
definition	standard_name : 27.MMHAP24FLA6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:124176
definition	standard_name : 36.MMHAP26FLD6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:125450
definition	standard_name : MHAa97a7.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130954
definition	standard_name : D6Mit52

name	(CDS detail)
type	STS
link
xref	UniSTS:130891
definition	standard_name : D6Mit337

name	(CDS detail)
type	STS
link
xref	UniSTS:142592
definition	standard_name : D6Mit377

name	(CDS detail)
type	STS
link
xref	UniSTS:165492
definition	standard_name : AU067806

name	(CDS detail)
type	STS
link
xref	UniSTS:210216
definition	standard_name : RH136222

name	(CDS detail)
type	STS
link
xref	UniSTS:130737
definition	standard_name : D6Mit194

name	(CDS detail)
type	STS
link
xref	UniSTS:235560
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179469
definition	standard_name : D87966

name	(CDS detail)
type	STS
link
xref	UniSTS:124888
definition	standard_name : L26343

name	(CDS detail)
type	STS
link
xref	UniSTS:124241
definition	standard_name : 37.MMHAP65FLE4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:257787
definition	standard_name : px-42h6

name	(CDS detail)
type	STS
link
xref	UniSTS:209708
definition	standard_name : RH126589

name	(CDS detail)
type	STS
link
xref	UniSTS:162960
definition	standard_name : RH126252

name	(CDS detail)
type	STS
link
xref	UniSTS:270887
definition	standard_name : PMC139238P1

name	(CDS detail)
type	STS
link
xref	UniSTS:185685
definition	standard_name : BB238854

name	(CDS detail)
type	STS
link
xref	UniSTS:159577
definition	standard_name : Y11245

name	(CDS detail)
type	STS
link
xref	UniSTS:179479
definition	standard_name : AW554517

name	(CDS detail)
type	STS
link
xref	UniSTS:161520
definition	standard_name : RH124698

name	(CDS detail)
type	STS
link
xref	UniSTS:162540
definition	standard_name : RH125794

name	(CDS detail)
type	STS
link
xref	UniSTS:179471
definition	standard_name : AW491344

name	(CDS detail)
type	STS
link
xref	UniSTS:179472
definition	standard_name : AI646725

name	(CDS detail)
type	STS
link
xref	UniSTS:224369
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179470
definition	standard_name : AW208983

name	(CDS detail)
type	STS
link
xref	UniSTS:235561
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162174
definition	standard_name : RH125352

name	(CDS detail)
type	STS
link
xref	UniSTS:179477
definition	standard_name : AI893533

name	(CDS detail)
type	STS
link
xref	UniSTS:130963
definition	standard_name : D6Mit61

name	(CDS detail)
type	STS
link
xref	UniSTS:143803
definition	standard_name : Ly55a

name	(CDS detail)
type	STS
link
xref	UniSTS:235931
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:210474
definition	standard_name : RH136490

name	(CDS detail)
type	STS
link
xref	UniSTS:130806
definition	standard_name : D6Mit257

name	(CDS detail)
type	STS
link
xref	UniSTS:179475
definition	standard_name : AI462337

name	(CDS detail)
type	STS
link
xref	UniSTS:130893
definition	standard_name : D6Mit338.1

name	(CDS detail)
type	STS
link
xref	UniSTS:130679
definition	standard_name : D6Mit135

name	(CDS detail)
type	STS
link
xref	UniSTS:130892
definition	standard_name : D6Mit338

name	(CDS detail)
type	STS
link
xref	UniSTS:130836
definition	standard_name : D6Mit289

name	(CDS detail)
type	STS
link
xref	UniSTS:208037
definition	standard_name : BE692208

name	(CDS detail)
type	STS
link
xref	UniSTS:91341
definition	standard_name : RH93287

name	(CDS detail)
type	STS
link
xref	UniSTS:161003
definition	standard_name : RH124109

name	LOC624256 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255428 GeneID:624256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to small nuclear ribonucleoprotein E pseudo : _no_value transcript_id : XR_034994.1

name	LOC100043848 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255429 GeneID:100043848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 315 ESTs, 12 Proteins product : similar to high mobility group protein pseudo : _no_value transcript_id : XR_034996.1

name	LOC100043853 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255430 GeneID:100043853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 94 mRNAs, 2834 ESTs, 23 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_034999.1

name	EG667610 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255432 GeneID:667610 MGI:3644570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 239 ESTs, 10 Proteins product : predicted gene, EG667610 pseudo : _no_value transcript_id : XR_035003.1

name	LOC667706 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255435 GeneID:667706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to ATP binding protein associated with cell differentiation pseudo : _no_value transcript_id : XR_035006.1

clone name	MSMg01-359L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481O24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-292F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328C16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-505C11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-500F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-516B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357F19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-348H15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-080J06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-082N24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-404P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095B22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-212P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-291J07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-289B18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-523G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099J21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-090N10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-148H08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-132D08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-517O03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-316P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409L15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-481N03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-046J07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-046H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063N12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-155G08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-344K22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482G22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090M04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-207I05.b	B6Ng01-207I05.g
ACC	GA026641	GA026642
length	316	529
definition	B6Ng01-207I05.b	B6Ng01-207I05.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(127,878,456 - 127,878,490)	(52,958,189 - 52,958,723)
sequence	acatcagttggaactacatgcacagggcctgaacatgatcagtccagcca aaatgccagcatgggtggaggagggggccatgaagttccatccctatctg aggagctatgagcagttgatgactacactgggagagggagagtcacttcc cttcagggatgtggatcctgggatactagccatgtgccagactagccatg tgccaaactagactacccatgtgtcagttccacacccatgaacacacagg ccacactaaatgtattcagtcagtattcagagaggaaagagagagagaga gagagagagagaatga	ttactctgtccttagccggggaccagcactctccattctatttagaatct gtctcatttgtgatattatttggttgataataatagtccttcagcagtat ataccaagggctatttctcttattcgggagagggctcagctcagcttcat ataagaaaaatgaatgatggagactctcacctctgggaacatttttcttt cctcatctcagggattagcagaaagcctgaggagggattggacattagcc agagagattaaaggctttaatttaatttttcactgaccttaggtgtcagt gtggtcttcatggacatctgtagaactcaaataagaggataattagaatg taagaagagaggtatgcggaagtgaggataagtcagtcaaacagtagaga tgctcagatgtctgtactctttcctcaggtacccagagtctagcctgcct gccagcaaaactgtcaggatctcaggcacatctgaaaggtgtgcatacgt gtgtgtgtgtgtgtgtgtgtgtgtgtgtg
quality values	Open. Hide. 31 56 44 62 41 41 59 62 62 62 62 59 62 62 62 46 62 51 62 62 59 62 62 59 62 59 59 59 62 59 54 33 43 59 51 62 62 54 59 59 59 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 59 59 62 62 59 62 62 49 54 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 59 59 54 62 62 62 62 59 59 62 62 59 59 59 59 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 54 54 54 62 59 62 62 59 62 62 62 62 62 62 62 37 37 62 62 62 62 62 59 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 26 49 58 58 49 43 58 40 38 58 58 58 58	Open. Hide. 62 62 62 59 62 62 59 62 48 56 59 62 62 62 59 59 62 62 54 49 54 59 49 59 59 62 62 62 59 62 62 62 62 59 59 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 38 54 58 58 58 54 54 58 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 28 19

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_127878456_127878490
seq2: B6Ng01-207I05.b_334_371 (reverse)

seq1  TCATTCTCTCTCTCTCTCTCTCTCTCTCT---CTCTCT  35
      |||||||||||||||||||||||||||||   ||||||
seq2  TCATTCTCTCTCTCTCTCTCTCTCTCTCTTTCCTCTCT  38

seq1: chr19_52958189_52958723
seq2: B6Ng01-207I05.g_67_601 (reverse)

seq1  CACACACACACACACACACACACACACACACGTATGCACACCTTTCAGAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACACACACACACACACACACACACACACGTATGCACACCTTTCAGAT  50

seq1  GTGCCTGAGATCCTGACAGTTTTGCTGGCAGGCAGGCTAGACTCTGGGTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCCTGAGATCCTGACAGTTTTGCTGGCAGGCAGGCTAGACTCTGGGTA  100

seq1  CCTGAGGAAAGAGTACAGACATCTGAGCATCTCTACTGTTTGACTGACTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGAGGAAAGAGTACAGACATCTGAGCATCTCTACTGTTTGACTGACTT  150

seq1  ATCCTCACTTCCGCATACCTCTCTTCTTACATTCTAATTATCCTCTTATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTCACTTCCGCATACCTCTCTTCTTACATTCTAATTATCCTCTTATT  200

seq1  TGAGTTCTACAGATGTCCATGAAGACCACACTGACACCTAAGGTCAGTGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTTCTACAGATGTCCATGAAGACCACACTGACACCTAAGGTCAGTGA  250

seq1  AAAATTAAATTAAAGCCTTTAATCTCTCTGGCTAATGTCCAATCCCTCCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATTAAATTAAAGCCTTTAATCTCTCTGGCTAATGTCCAATCCCTCCT  300

seq1  CAGGCTTTCTGCTAATCCCTGAGATGAGGAAAGAAAAATGTTCCCAGAGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCTTTCTGCTAATCCCTGAGATGAGGAAAGAAAAATGTTCCCAGAGG  350

seq1  TGAGAGTCTCCATCATTCATTTTTCTTATATGAAGCTGAGCTGAGCCCTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAGTCTCCATCATTCATTTTTCTTATATGAAGCTGAGCTGAGCCCTC  400

seq1  TCCCGAATAAGAGAAATAGCCCTTGGTATATACTGCTGAAGGACTATTAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCGAATAAGAGAAATAGCCCTTGGTATATACTGCTGAAGGACTATTAT  450

seq1  TATCAACCAAATAATATCACAAATGAGACAGATTCTAAATAGAATGGAGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCAACCAAATAATATCACAAATGAGACAGATTCTAAATAGAATGGAGA  500

seq1  GTGCTGGTCCCCGGCTAAGGACAGAGTAAGAATTC  535
      |||||||||||||||||||||||||||||||||||
seq2  GTGCTGGTCCCCGGCTAAGGACAGAGTAAGAATTC  535

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information