MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-208M19
Chromosome	19 (Build37)
Map Location	44,220,217 - 44,271,992
singlet/doublet	doublet
Overlap gene	Bloc1s2, Pkd2l1
Upstream gene	LOC545291, EG627624, Cnnm1, Got1, Nkx2-3, LOC100042700, LOC100043245, Slc25a28, Entpd7, Cox15, Cutc, Abcc2, Dnmbp, LOC668408, Cpn1, Cyp2c44, Erlin1, Chuk, Cwf19l1
Downstream gene	Scd3, LOC629152, Scd2, Scd4, Scd1, Wnt8b, Sec31b, Ndufb8, Hif1an, Pax2, LOC383450, LOC100042752, 6030443O07Rik, Sema4g, Mrpl43, Peo1, Lzts2, Pdzd7, EG435601, LOC100042760, Sfxn3, Kazald1, Tlx1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC545291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627624 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627624 MGI:3647201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 68 ESTs, 3 Proteins

name	Cnnm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83674 MGI:1891366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Got1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14718 MGI:95791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkx2-3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18089 MGI:97348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043245 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Slc25a28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246696 MGI:2180509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Entpd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93685 MGI:2135885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226139 MGI:1920112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cutc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66388 MGI:1913638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12780 MGI:1352447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnmbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71972 MGI:1917352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668408 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668408
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Cpn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93721 MGI:2135874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226143 MGI:1888897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Erlin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226144 MGI:2387613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chuk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12675 MGI:99484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cwf19l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72502 MGI:1919752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bloc1s2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73689 MGI:1920939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 52 ESTs, 5 Proteins

name	Pkd2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329064 MGI:1352448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30049 MGI:1353437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629152 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Scd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20250 MGI:98240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329065 MGI:2670997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20249 MGI:98239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt8b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22423 MGI:109485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec31b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240667 MGI:2685187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67264 MGI:1914514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hif1an (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319594 MGI:2442345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pax2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18504 MGI:97486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383450 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins pseudo : _no_value

name	LOC100042752 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	6030443O07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226151 MGI:1924968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema4g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26456 MGI:1347047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94067 MGI:2137229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Peo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226153 MGI:2137410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lzts2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226154 MGI:2385095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdzd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212684 MGI:3608325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG435601 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435601 MGI:3645766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042760 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Sfxn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94280 MGI:2137679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kazald1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107250 MGI:2147606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21908 MGI:98769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545291 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:124486930 GeneID:545291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : similar to Heparanase-2 (Hpa2) transcript_id : NM_001081257.1

name	EG627624 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270554 GeneID:627624 MGI:3647201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 68 ESTs, 3 Proteins product : predicted gene, EG627624 transcript_id : XM_894499.3

name	Cnnm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878234 GeneID:83674 MGI:1891366
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin M1 transcript_id : NM_031396.1

name	Got1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754033 GeneID:14718 MGI:95791
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate oxaloacetate transaminase 1, soluble transcript_id : NM_010324.1

name	Nkx2-3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49274620 GeneID:18089 MGI:97348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NK2 transcription factor related, locus 3 (Drosophila) transcript_id : NM_008699.2

name	LOC100043245 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270555 GeneID:100043245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043245 transcript_id : XM_001480053.1

name	Slc25a28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553114 GeneID:246696 MGI:2180509
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 28 transcript_id : NM_145156.1

name	Entpd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380877 GeneID:93685 MGI:2135885
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 7 transcript_id : NM_053103.4

name	Cox15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384028 GeneID:226139 MGI:1920112
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COX15 homolog, cytochrome c oxidase assembly protein (yeast) transcript_id : NM_144874.3

name	Cutc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379763 GeneID:66388 MGI:1913638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cutC copper transporter homolog (E.coli) transcript_id : NM_025530.2

name	Abcc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063565 GeneID:12780 MGI:1352447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 2 transcript_id : NM_013806.2

name	Dnmbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130402 GeneID:71972 MGI:1917352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynamin binding protein transcript_id : NM_028029.2

name	LOC668408 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94406015 GeneID:668408
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : similar to sterile alpha motif domain containing 1 transcript_id : XM_001001317.1

name	Cpn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507643 GeneID:93721 MGI:2135874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase N, polypeptide 1 transcript_id : NM_030703.1

name	Cyp2c44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48374084 GeneID:226143 MGI:1888897
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 44 transcript_id : NM_001001446.2

name	Erlin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981798 GeneID:226144 MGI:2387613
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ER lipid raft associated 1 transcript_id : NM_145502.2

name	Chuk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680941 GeneID:12675 MGI:99484
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : conserved helix-loop-helix ubiquitous kinase transcript_id : NM_007700.1

name	Cwf19l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487290 GeneID:72502 MGI:1919752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CWF19-like 1, cell cycle control (S. pombe) transcript_id : NM_001081077.1

name	Bloc1s2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405946 GeneID:73689 MGI:1920939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 52 ESTs, 5 Proteins product : biogenesis of lysosome-related organelles complex-1, subunit 2, transcript variant 1 transcript_id : XM_193940.6

name	Bloc1s2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405948 GeneID:73689 MGI:1920939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 3 Proteins product : biogenesis of lysosome-related organelles complex-1, subunit 2, transcript variant 7 transcript_id : XM_901658.2

name	Pkd2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340854 GeneID:329064 MGI:1352448
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycystic kidney disease 2-like 1 transcript_id : NM_181422.2

name	Scd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86439985 GeneID:30049 MGI:1353437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stearoyl-coenzyme A desaturase 3 transcript_id : NM_024450.2

name	Scd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677862 GeneID:20250 MGI:98240
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stearoyl-Coenzyme A desaturase 2 transcript_id : NM_009128.1

name	Scd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130727 GeneID:329065 MGI:2670997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stearoyl-coenzyme A desaturase 4 transcript_id : NM_183216.3

name	Scd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130513 GeneID:20249 MGI:98239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stearoyl-Coenzyme A desaturase 1 transcript_id : NM_009127.3

name	Wnt8b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389070 GeneID:22423 MGI:109485
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless related MMTV integration site 8b transcript_id : NM_011720.2

name	Sec31b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133504850 GeneID:240667 MGI:2685187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sec31 homolog B (S. cerevisiae) transcript_id : NM_001033343.1

name	Ndufb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892869 GeneID:67264 MGI:1914514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8 transcript_id : NM_026061.2

name	Hif1an (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909331 GeneID:319594 MGI:2442345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypoxia-inducible factor 1, alpha subunit inhibitor transcript_id : NM_176958.3

name	Pax2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34536824 GeneID:18504 MGI:97486
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired box gene 2 transcript_id : NM_011037.2

name	6030443O07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487014 GeneID:226151 MGI:1924968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6030443O07 gene transcript_id : NM_001081225.1

name	Sema4g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755461 GeneID:26456 MGI:1347047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G transcript_id : NM_011976.1

name	Mrpl43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55769544 GeneID:94067 MGI:2137229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L43 transcript_id : NM_053164.3

name	Peo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48976074 GeneID:226153 MGI:2137410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : progressive external ophthalmoplegia 1 (human) transcript_id : NM_153796.3

name	Lzts2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703989 GeneID:226154 MGI:2385095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine zipper, putative tumor suppressor 2 transcript_id : NM_145503.1

name	Pdzd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130455 GeneID:212684 MGI:3608325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ domain containing 7 transcript_id : NM_177605.3

name	EG435601 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270488 GeneID:435601 MGI:3645766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG435601 transcript_id : XM_487568.5

name	LOC100042760 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270490 GeneID:100042760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100042760 transcript_id : XM_001478770.1

name	Sfxn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981487 GeneID:94280 MGI:2137679
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sideroflexin 3 transcript_id : NM_053197.2

name	Kazald1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353193 GeneID:107250 MGI:2147606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kazal-type serine peptidase inhibitor domain 1 transcript_id : NM_178929.3

name	Tlx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543873 GeneID:21908 MGI:98769
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia, homeobox 1 transcript_id : NM_021901.2

name	LOC545291 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:124486931 GeneID:545291
definition	codon_start : 1 product : similar to Heparanase-2 (Hpa2) protein_id : NP_001074726.1

name	EG627624 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998566 GeneID:627624 MGI:3647201
definition	codon_start : 1 product : similar to leucine zipper transcription factor-like 1 protein_id : XP_899592.1

name	Cnnm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878235 GeneID:83674 MGI:1891366
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : ancient conserved domain protein 1; cyclin-like protein 1 product : cyclin M1 protein_id : NP_113573.1

name	Got1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754034 CCDS:CCDS29832.1 GeneID:14718 MGI:95791
definition	GO_function : GO:0004069 - aspartate transaminase activity [Evidence IDA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytosolic aspartate aminotransferase product : glutamate oxaloacetate transaminase 1, soluble protein_id : NP_034454.1

name	Nkx2-3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46849702 CCDS:CCDS29833.1 GeneID:18089 MGI:97348
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030183 - B cell differentiation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0006955 - immune response [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Drosophila NK2 transcription factor related, locus 3 product : NK2 transcription factor related, locus 3 protein_id : NP_032725.1

name	LOC100043245 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270556 GeneID:100043245
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480103.1

name	Slc25a28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553115 CCDS:CCDS29834.1 GeneID:246696 MGI:2180509
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : putative mitochondrial solute carrier product : solute carrier family 25, member 28 protein_id : NP_660138.1

name	Entpd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82617566 CCDS:CCDS29835.1 GeneID:93685 MGI:2135885
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence ISS]; GO:0017111 - nucleoside-triphosphatase activity [Evidence ISS] GO_process : GO:0009191 - ribonucleoside diphosphate catabolism [Evidence ISS]; GO:0009203 - ribonucleoside triphosphate catabolism [Evidence ISS] codon_start : 1 note : lysosomal apyrase-like 2 product : ectonucleoside triphosphate diphosphohydrolase 7 protein_id : NP_444333.3

name	Cox15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541932 CCDS:CCDS29836.1 GeneID:226139 MGI:1920112
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] codon_start : 1 product : COX15 homolog, cytochrome c oxidase assembly protein protein_id : NP_659123.2

name	Cutc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384952 CCDS:CCDS29837.1 GeneID:66388 MGI:1913638
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : cutC copper transporter homolog protein_id : NP_079806.1

name	Abcc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063566 CCDS:CCDS29838.1 GeneID:12780 MGI:1352447
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0046581 - intercellular canaliculus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : multidrug resistance protein 2; canalicular multispecific organic anion transporter product : ATP-binding cassette, sub-family C, member 2 protein_id : NP_038834.2

name	Dnmbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:36796741 CCDS:CCDS29839.1 GeneID:71972 MGI:1917352
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : dynamin binding protein protein_id : NP_082305.1

name	LOC668408 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94406016 GeneID:668408
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001317.1

name	Cpn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507644 CCDS:CCDS29840.1 GeneID:93721 MGI:2135874
definition	EC_number : 3.4.17.3 GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA]; GO:0004180 - carboxypeptidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004184 - lysine carboxypeptidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : carboxypeptidase N, polypeptide 1, 50kD; kininase I; anaphylatoxin inactivator product : carboxypeptidase N, polypeptide 1 protein_id : NP_109628.1

name	Cyp2c44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48374085 CCDS:CCDS29841.1 GeneID:226143 MGI:1888897
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 2c44 product : cytochrome P450, family 2, subfamily c, polypeptide 44 protein_id : NP_001001446.2

name	Erlin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981799 CCDS:CCDS29842.1 GeneID:226144 MGI:2387613
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SPFH domain family, member 1 protein_id : NP_663477.2

name	Chuk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680942 CCDS:CCDS29843.1 GeneID:12675 MGI:99484
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004702 - receptor signaling protein serine/threonine kinase activity [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007252 - I-kappaB phosphorylation [Evidence TAS]; GO:0002011 - morphogenesis of an epithelial sheet [Evidence IMP]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0030316 - osteoclast differentiation [Evidence IMP] [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : IKK 1; IKK alpha; IkappaB kinase alpha product : conserved helix-loop-helix ubiquitous kinase protein_id : NP_031726.1

name	Cwf19l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487291 GeneID:72502 MGI:1919752
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : CWF19-like 1, cell cycle control protein_id : NP_001074546.1

name	Bloc1s2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998585 GeneID:73689 MGI:1920939
definition	codon_start : 1 product : biogenesis of lysosome-related organelles complex-1, subunit 2 isoform 7 protein_id : XP_906751.1

name	Bloc1s2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25055365 GeneID:73689 MGI:1920939
definition	codon_start : 1 product : biogenesis of lysosome-related organelles complex-1, subunit 2 isoform 1 protein_id : XP_193940.1

name	Pkd2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088870 CCDS:CCDS29846.1 GeneID:329064 MGI:1352448
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IPI] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005261 - cation channel activity [Evidence IPI]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : polycystin-L product : polycystic kidney disease 2-like 1 protein_id : NP_852087.1

name	Scd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277368 CCDS:CCDS29847.1 GeneID:30049 MGI:1353437
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA]; GO:0004768 - stearoyl-CoA 9-desaturase activity [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0006636 - fatty acid desaturation [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 product : stearoyl-coenzyme A desaturase 3 protein_id : NP_077770.1

name	Scd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677863 CCDS:CCDS29848.1 GeneID:20250 MGI:98240
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA]; GO:0004768 - stearoyl-CoA 9-desaturase activity [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0006636 - fatty acid desaturation [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : stearoyl-Coenzyme A desaturase 2 protein_id : NP_033154.1

name	Scd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38261958 CCDS:CCDS29849.1 GeneID:329065 MGI:2670997
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA]; GO:0004768 - stearoyl-CoA 9-desaturase activity [Evidence IDA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IDA]; GO:0006636 - fatty acid desaturation [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 product : stearoyl-CoA desaturase 4 protein_id : NP_899039.2

name	Scd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543675 CCDS:CCDS29850.1 GeneID:20249 MGI:98239
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA]; GO:0004768 - stearoyl-CoA 9-desaturase activity [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IMP]; GO:0006636 - fatty acid desaturation [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 note : asebia; stearoyl-CoA desaturase product : stearoyl-Coenzyme A desaturase 1 protein_id : NP_033153.2

name	Wnt8b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756005 GeneID:22423 MGI:109485
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : wingless related MMTV integration site 8b protein_id : NP_035850.1

name	Sec31b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133504851 GeneID:240667 MGI:2685187
definition	codon_start : 1 product : SEC31-like 2 protein_id : NP_001028515.1

name	Ndufb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385558 CCDS:CCDS29851.1 GeneID:67264 MGI:1914514
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8 protein_id : NP_080337.1

name	Hif1an (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909332 CCDS:CCDS29852.1 GeneID:319594 MGI:2442345
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0004597 - peptide-aspartate beta-dioxygenase activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : hypoxia-inducible factor 1, alpha subunit inhibitor protein_id : NP_795932.2

name	Pax2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34536825 GeneID:18504 MGI:97486
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0001709 - cell fate determination [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP]; GO:0001656 - metanephros development [Evidence IGI]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006350 - transcription [Evidence IEA]; GO:0001657 - ureteric bud development [Evidence IGI] codon_start : 1 exception : unclassified translation discrepancy product : paired box gene 2 protein_id : NP_035167.2

name	6030443O07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487015 GeneID:226151 MGI:1924968
definition	codon_start : 1 product : hypothetical protein LOC226151 protein_id : NP_001074694.1

name	Sema4g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755462 CCDS:CCDS29853.1 GeneID:26456 MGI:1347047
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 product : semaphorin 4G protein_id : NP_036106.1

name	Mrpl43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17298676 GeneID:94067 MGI:2137229
definition	GO_component : GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006412 - protein biosynthesis [Evidence TAS] codon_start : 1 product : mitochondrial ribosomal protein L43 protein_id : NP_444394.1

name	Peo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24962647 CCDS:CCDS29854.1 GeneID:226153 MGI:2137410
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003678 - DNA helicase activity [Evidence ISS] [Evidence IDA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0006268 - DNA unwinding during replication [Evidence IDA] codon_start : 1 note : T7 gp4-like protein with intramitochondrial nucleoid localization product : twinkle protein_id : NP_722491.2

name	Lzts2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703990 CCDS:CCDS29855.1 GeneID:226154 MGI:2385095
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : putative tumor suppressor LAPSER1 product : leucine zipper, putative tumor suppressor 2 protein_id : NP_663478.1

name	Pdzd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243974 GeneID:212684 MGI:3608325
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : PDZ domain containing 7 protein_id : NP_808273.1

name	EG435601 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270489 GeneID:435601 MGI:3645766
definition	codon_start : 1 product : hypothetical protein protein_id : XP_487568.5

name	LOC100042760 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270491 GeneID:100042760
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478820.1

name	Sfxn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716499 CCDS:CCDS29856.1 GeneID:94280 MGI:2137679
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sideroflexin 3 protein_id : NP_444427.1

name	Kazald1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725806 CCDS:CCDS29857.1 GeneID:107250 MGI:2147606
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005520 - insulin-like growth factor binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0001503 - ossification [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Kazal-type serine protease inhibitor domain 1 protein_id : NP_849260.1

name	Tlx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11276073 CCDS:CCDS29858.1 GeneID:21908 MGI:98769
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045165 - cell fate commitment [Evidence IMP]; GO:0007417 - central nervous system development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0048535 - lymph node development [Evidence TAS]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0048645 - organ formation [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048536 - spleen development [Evidence IGI] [Evidence IMP] codon_start : 1 product : T-cell leukemia, homeobox 1 protein_id : NP_068701.1

name	LOC100042700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042700
definition	number : 2 pseudo : _no_value

name	LOC100042700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042700
definition	number : 1 pseudo : _no_value

name	LOC629152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629152
definition	number : 1 pseudo : _no_value

name	LOC629152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629152
definition	number : 2 pseudo : _no_value

name	LOC629152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629152
definition	number : 3 pseudo : _no_value

name	LOC629152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629152
definition	number : 4 pseudo : _no_value

name	LOC629152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629152
definition	number : 5 pseudo : _no_value

name	LOC629152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629152
definition	number : 6 pseudo : _no_value

name	LOC629152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629152
definition	number : 7 pseudo : _no_value

name	LOC629152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629152
definition	number : 8 pseudo : _no_value

name	LOC629152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629152
definition	number : 9 pseudo : _no_value

name	LOC629152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629152
definition	number : 10 pseudo : _no_value

name	LOC100042752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042752
definition	number : 1 pseudo : _no_value

name	LOC100042752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042752
definition	number : 2 pseudo : _no_value

name	LOC100042752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042752
definition	number : 3 pseudo : _no_value

name	LOC100042752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042752
definition	number : 4 pseudo : _no_value

name	LOC100042752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042752
definition	number : 5 pseudo : _no_value

name	LOC383450 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270487 GeneID:383450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to 3-phosphoglycerate dehydrogenase pseudo : _no_value transcript_id : XR_033860.1

clone name	MSMg01-518E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263C15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-448N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341L10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-496G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283I09
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-208M19.b	B6Ng01-208M19.g
ACC	GA027583	GA027584
length	1,116	1,167
definition	B6Ng01-208M19.b	B6Ng01-208M19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(44,220,217 - 44,221,331)	(44,270,807 - 44,271,992)
sequence	gaattcttgttgttggcctttatgacaagaggcctgcagatttgtgtttc aaaagtggttggtgtgcttccctggggaaagacaagggggagagcggctc ctttcctcccattcaaccatggactgaccagaggctgctaaagcaccatt cagatttccgtgaagtcaaatgcaaatacacagctgggatcagccagaag gggttgcgtatcacctgtcagttccccagtcaaatatgtggccattttgg agaacatgtcccggcagagctcattgatgtcagcttcggcaggctccttt gcttcctcggctgtctccaccgcagcatcatctggcaaggtgtgggtggg aggtgaggagtaaacgtcctatccccagacctaatccagccaaagcggac ggttcctaagtccctcccgacttgggctcccgccgccttcgttctcctcc tgccaccatcccgtcccttctcctcgcacccgcccacctgaaacgccaac tccgttcccatgctcaggagctaggctttcgtctcagtgccctgactgcg gtagacaggtccaccggctcctgcatccggacctagcctccccaccatca gccgccgcatctccatccacacagggtagtacctcgaggtggctgctcct cccgtcgcgtcgccgggacgccctccgcagccgccgccatgcccgaccca aggctgcttccggttctaagggcatctgcgcgtgcgccccgcgggtgccc cgccccgccgcttgctcacagcttccttgctttgatcggcttgcccaagt cacacctcaaataaggaccttttatcaaagtccaagcatgaagctgaaac tgaagctaggctattgcgaattagcccgttactgagatcacagtacctgg ttggcaatgcgttcgtccctgcagccacactctagaacggtcacttgtgc cagccacggcctgtcttgggttgtggacccatcataacatgtcagctaaa gttattggaagagaaggtggcctcttcctcagaactccagcaccctgaac tgttttgttcatcaaagattggttcaaggaattcgcttttcagattcttc cacaagaaattcggcc	gaattccacagaaggttccagagctggacatgtagctattgctaaccaga aagtttgaagtgtattcattagcacttgtttctctcagtcccaccatcca cccttgtctcatgaacccactccaggatgcagacaccctggactgtggtt ctgatctttcagcaagagacagtttgaagttccccttaggctaactgcgg aggtcttctacccccctctctgacctagttcgccttcttatctttcctgc ccatgaggagaaaggaaaacccacagtgccctcagctttgcctttggcgt ccaaagcacacatgactgtaacctggtgcatttccagacttcacagctac cttgccaggtctgggaaattccccttcaaagctcagggttaactcactct ggatttgcaatactctctggtccagatgtgatcgtggggtccgggtttct ccatgtcctctgctaaagcagcagagagttggtttcatttatcccctttt aagctgaggacagcagttgagaagagctaagcccaggacccatgctcagt gggccctcgatgccaccacagaacttcagccttcaggagcactcacagaa gcccagagtcagcttgggaccctaactgtggccaccctaggacaaggcag gcagctactggctcatcccccagtactctgcttacaaattgttgttttcc acagacaaatattagcacctacatattacagatacatgacatcagcctcc agaccctctgggccacctggcaaagctgtggctgatttgtcacctacttg gccttgcttagatgtcccagttagggttatcattgctgtgatgaaacacc atgactagagcgacttgggaagaaacagtttatttgtcttgtgcttccat atcactgaaggaagccaaggcaaaaactcaaacaaggcatgaacctggag gcaggggctgatttggagtccgtgaggggtaccgcttactggcttggttc cacatggcttgctcagctgctttcttatagaacccaggactaccagcagg gatagccatcacacaagctgggtcctcccatcaactcttataagaaaatg cctccacgtttggctgtgacacaggtatagagcatttctcatgagtatct tattctcaatgattcta
quality values	Open. Hide. 58 26 21 26 58 58 58 58 49 58 58 39 41 58 58 36 41 62 62 62 54 52 47 62 62 47 42 54 62 62 62 23 16 32 14 20 13 20 13 17 21 21 21 21 19 43 56 62 62 47 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 50 59 43 32 31 35 46 56 59 59 62 54 54 62 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 54 62 62 59 59 62 59 59 62 59 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 49 59 59 38 32 59 56 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 56 62 62 62 62 62 62 56 62 62 62 62 47 62 62 62 62 62 62 54 62 62 46 62 62 62 62 62 62 62 62 62 62 52 62 62 62 54 62 49 52 62 54 62 62 54 47 47 62 58 58 58 49 58 52 54 42 58 50 58 58 58 54 51 54 52 54 45 54 58 58 58 52 58 54 54 52 52 54 48 52 52 58 54 54 54 54 54 54 58 54 54 52 54 41 52 47 54 52 52 58 54 45 48 54 58 54 48 58 53 58 58 52 54 47 54 54 42 52 52 52 49 52 58 42 49 51 58 58 38 51 50 49 40 38 58 51 51 50 51 50 58 33 58 42 31 50 49 47 50 50 51 51 51 47 43 49 50 52 53 49 51 50 41 41 48 58 33 58 49 51 32 48 41 49 50 39 51 51 50 39 53 28 50 50 37 52 51 39 35 41 25 52 53 34 43 42 32 53 22 35 37 34 53 32 58 37 52 53 42 51 50 40 44 49 51 16 49 52 39 39 33 30 49 33 25 29 39 39 37 49 39 32 44 43 37 50 30 32 30 50 50 43 50 37 51 47 54 34 53 45 54 54 49 40 35 54 52 51 37 38 51 31 42 50 16 37 31 35 35 30 35 35 26 41 38 29 39 31 28 33 41 28 32 51 40 37 28 24 35 35 31 24 51 25 47 26 54 28 13 46 31 32 34 32 33 33 22 37 28 28 33 47 27 32 46 30 23 35 42 37 37 27 51 51 32 31 31 37 31 42 33 31 32 20 41 32 31 33 32 26 29 32 52 29 21 31 32 19 40 33 41 21 27 35 28 33 22 31 24 14 6 28 21 35 31 30 26 32 21 23 31 30 24 30 25 13 31 45 46 30 22 31 22 31 24 26 23 6 21 26 33 28 31 26 12 14 26 31 27 32 18 14 6 26 31 32 13 16 31 26 37 28 16 12 18 30 21 31 29 46 32 34 36 24 26 9 8 26 14 31 24 26 31 34 24 31 11 38 27 13 30 32 16 31 23 24 25 21 27 21 31 16 23 25 19 31 24 16 24 22 30 32 22 22 32 31 21 31 31 41 46 27 19 6 13 17 33 37 26 16 33 30 12 24 17 18 24 31 16 7 6 13 21 25 35 9 5 17 19 10 44 33 27 30 18 27 11 33 17 25 6 25 14 9 4 6 10 7 31 18 27 24 8 7 8 18 7 8 22 32 14 32 10 11 13 9 5 5 32 23 19 10 32 17 4 11 12 25 18 12 16 8 10 10 25 43 36 6 7 24 9 10 16 32 27 26 33 16 5 21 6 29 8 13 14 8 5 4 5 7 12 11 7 3 6 6 4 5 16 30 15 6 3 5 3 3 3 3 4 12 9 27 14 8 7 15 21 6 27 20 5 3 5 3 3 6 3 3	Open. Hide. 62 47 39 47 62 62 44 33 62 47 62 44 32 24 33 24 27 30 24 19 28 43 40 38 49 62 62 59 56 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 43 49 54 59 59 62 62 62 54 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 54 54 62 62 62 62 62 54 62 62 62 62 62 59 59 62 54 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 42 58 58 54 58 54 58 58 54 58 54 58 58 58 54 54 58 54 41 58 54 42 58 58 58 58 58 51 54 54 58 58 58 49 58 58 58 54 52 54 49 58 54 58 52 54 58 51 53 52 50 58 51 49 58 58 51 49 52 51 58 58 58 51 50 34 58 58 40 51 49 45 58 50 50 54 49 52 58 54 37 54 47 44 51 53 58 32 49 53 51 54 58 58 50 54 49 51 48 35 41 44 54 51 50 49 51 58 53 51 28 38 49 40 49 58 58 52 52 40 58 51 33 24 54 50 58 40 52 33 49 31 42 50 51 58 40 49 50 58 25 40 53 40 34 53 50 43 24 38 44 41 43 42 38 50 51 52 50 51 46 58 30 32 41 28 54 41 41 52 54 46 44 49 25 54 54 35 47 50 37 45 45 45 49 37 32 54 49 53 40 47 35 38 28 50 39 49 51 41 40 49 39 52 42 42 53 39 39 45 42 35 31 37 51 23 51 49 46 31 32 52 40 34 42 53 53 31 19 33 32 33 53 30 51 32 31 31 33 39 54 53 32 45 31 39 33 31 34 40 25 52 53 34 31 37 52 52 31 53 53 31 53 34 22 15 53 34 41 18 32 32 27 47 31 42 40 32 45 35 46 34 31 34 31 30 35 34 22 30 23 26 19 32 24 32 51 30 31 32 32 32 35 30 47 32 27 21 25 25 31 30 30 30 38 32 36 43 28 31 34 30 31 31 46 24 31 23 30 31 19 31 31 23 21 38 31 30 42 25 30 29 30 25 27 32 30 46 31 32 38 33 42 46 32 29 32 30 35 48 37 34 38 48 32 19 23 31 27 22 30 23 31 24 22 25 14 37 19 41 21 37 29 20 26 24 15 21 15 27 20 26 25 32 31 27 11 16 27 32 33 37 48 47 43 26 25 36 25 21 44 22 20 19 20 34 30 21 16 31 21 18 21 15 21 33 16 25 9 13 21 27 12 25 48 48 25 27 32 19 26 20 48 24 14 15 33 13 24 21 22 27 16 7 9 4 32 43 20 28 28 32 23 27 15 13 13 18 27 19 21 18 23 22 15 20 26 7 9 37 12 23 21 21 28 20 19 10 21 11 18 18 27 16 19 6 11 9 27 18 27 38 16 14 18 10 24 20 24 12 19 21 11 34 17 22 15 10 32 19 11 16 19 19 22 15 19 18 13 34 7 6 15 18 6 3 3 5 3 6 17 6 11 3 6 6 27 8 14 21 27 13 4 18 11 12 14 17 15 10 10 18 7 11 21 15 21 5 5 13 2 4 12 6 14 26 17 25 5 8 12 9 5 11 13 7 10 6 12 12 12 8 5 24 5 16 6 2 1 3 3 6 3 6 3 2 4 12 5 6 9 14 6 5 12 17 7 4 3 5 2 2 4 5 1 2 2 11 16 5 11 10 5 7 15 4 11 2 9 5 4 13 5 13 12 6 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_44220217_44221331
seq2: B6Ng01-208M19.b_48_1163

seq1  GAATTCTTGTTGTTGGCCTTTATGACAAGAGGCCTGCAGATTTGTGTTTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTGTTGTTGGCCTTTATGACAAGAGGCCTGCAGATTTGTGTTTC  50

seq1  AAAAGTGGTTGGTGTGCTTCCCTGGGGAAAGACAAGGGGGAGAGCGGCTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGTGGTTGGTGTGCTTCCCTGGGGAAAGACAAGGGGGAGAGCGGCTC  100

seq1  CTTTCCTCCCATTCAACCATGGACTGACCAGAGGCTGCTAAAGCACCATT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCCTCCCATTCAACCATGGACTGACCAGAGGCTGCTAAAGCACCATT  150

seq1  CAGATTTCCGTGAAGTCAAATGCAAATACACAGCTGGGATCAGCCAGAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGATTTCCGTGAAGTCAAATGCAAATACACAGCTGGGATCAGCCAGAAG  200

seq1  GGGTTGCGTATCACCTGTCAGTTCCCCAGTCAAATATGTGGCCATTTTGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTTGCGTATCACCTGTCAGTTCCCCAGTCAAATATGTGGCCATTTTGG  250

seq1  AGAACATGTCCCGGCAGAGCTCATTGATGTCAGCTTCGGCAGGCTCCTTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACATGTCCCGGCAGAGCTCATTGATGTCAGCTTCGGCAGGCTCCTTT  300

seq1  GCTTCCTCGGCTGTCTCCACCGCAGCATCATCTGGCAAGGTGTGGGTGGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCCTCGGCTGTCTCCACCGCAGCATCATCTGGCAAGGTGTGGGTGGG  350

seq1  AGGTGAGGAGTAAACGTCCTATCCCCAGACCTAATCCAGCCAAAGCGGAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGAGGAGTAAACGTCCTATCCCCAGACCTAATCCAGCCAAAGCGGAC  400

seq1  GGTTCCTAAGTCCCTCCCGACTTGGGCTCCCGCCGCCTTCGTTCTCCTCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTCCTAAGTCCCTCCCGACTTGGGCTCCCGCCGCCTTCGTTCTCCTCC  450

seq1  TGCCACCATCCCGTCCCTTCTCCTCGCACCCGCCCACCTGAAACGCCAAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCACCATCCCGTCCCTTCTCCTCGCACCCGCCCACCTGAAACGCCAAC  500

seq1  TCCGTTCCCATGCTCAGGAGCTAGGCTTTCGTCTCAGTGCCCTGACTGCG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCGTTCCCATGCTCAGGAGCTAGGCTTTCGTCTCAGTGCCCTGACTGCG  550

seq1  GTAGACAGGTCCACCGGCTCCTGCATCCGGACCTAGCCTCCCCACCATCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGACAGGTCCACCGGCTCCTGCATCCGGACCTAGCCTCCCCACCATCA  600

seq1  GCCGCCGCATCTCCATCCACACAGGGTAGTACCTCGAGGTGGCTGCTCCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCGCCGCATCTCCATCCACACAGGGTAGTACCTCGAGGTGGCTGCTCCT  650

seq1  CCCGTCGCGTCGCCGGGACGCCCTCCGCAGCCGCCGCCATGCCCGACCCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGTCGCGTCGCCGGGACGCCCTCCGCAGCCGCCGCCATGCCCGACCCA  700

seq1  AGGCTGCTTCCGGTTCTAAGGGCATCTGCGCGTGCGCCCCGCGGGTGCCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTGCTTCCGGTTCTAAGGGCATCTGCGCGTGCGCCCCGCGGGTGCCC  750

seq1  CGCCCCGCCGCTTGCTCACAGCTTCCTTGCTTTGATCGGCTTGCCCAAGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCCCCGCCGCTTGCTCACAGCTTCCTTGCTTTGATCGGCTTGCCCAAGT  800

seq1  CACACCTCAAATAAGGACCTTTTATCAAAGTCCAAGCATGAAGCTGAAAC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACCTCAAATAAGGACCTTTTATCAAAGTCCAAGCATGAAGCTGAAAC  850

seq1  TGAAGCTAAGGCTATTGCGAATTAGCCCGTTACTGAGATCACAGTACCTG  900
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGCT-AGGCTATTGCGAATTAGCCCGTTACTGAGATCACAGTACCTG  899

seq1  GTTGGCAATGCGTTCGTCCCTGCAGCCACACTCTAGAACGGTCACTTGTG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGCAATGCGTTCGTCCCTGCAGCCACACTCTAGAACGGTCACTTGTG  949

seq1  CCAGCCACGGCCTGTCTTGGGTTGTGGACCCATCATAACATGTCAGCTAA  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCCACGGCCTGTCTTGGGTTGTGGACCCATCATAACATGTCAGCTAA  999

seq1  AGTTATTGG-AGAG-AGGTGGCCTCCTCCCCAG-ACACCAGCACCCTGAC  1047
      ||||||||| |||| |||||||||| ||| ||| || |||||||||||| 
seq2  AGTTATTGGAAGAGAAGGTGGCCTCTTCCTCAGAACTCCAGCACCCTGAA  1049

seq1  ATGTTTTGTTCATCAAAGAATTGTTC-AGGGATTCGCTTTTACAGGGTGT  1096
       |||||||||||||||||| | |||| ||| |||||||||| ||  |  |
seq2  CTGTTTTGTTCATCAAAGATTGGTTCAAGGAATTCGCTTTT-CA--GATT  1096

seq1  CTCCCACAAG-ATTTCGGCC  1115
      || ||||||| | |||||||
seq2  CTTCCACAAGAAATTCGGCC  1116

seq1: chr19_44270807_44271992
seq2: B6Ng01-208M19.g_66_1232 (reverse)

seq1  TAGAATCATTTGGGAG-ATAAGATAACTCAATTGAGAAAATGCCTTCATA  49
      ||||||||||   ||| ||||||| |||||  |||| ||||||  ||   
seq2  TAGAATCATT---GAGAATAAGAT-ACTCA--TGAG-AAATGC--TCTAT  41

seq1  ACCTGTGGCCACAGGCAAACGTGGAGGGCATTTTCTTAATTAGGAGTTGA  99
      |||||| | ||||| |||||||||| ||||||||||||  || |||||||
seq2  ACCTGT-GTCACAGCCAAACGTGGA-GGCATTTTCTTA--TAAGAGTTGA  87

seq1  TGGGGGAGGACCCAGCCTGTTGTTGATTGGGCTATCCCTGCTGGTAGTCC  149
      |  ||||||||||||| |||   ||||  |||||||||||||||||||||
seq2  T--GGGAGGACCCAGCTTGT--GTGAT--GGCTATCCCTGCTGGTAGTCC  131

seq1  TGGGTTCTATAAGAAAGCAGGCTGAGCAAGCCATGTGG-ACCAAGCCAGT  198
      ||||||||||||||||||| |||||||||||||||||| |||||||||||
seq2  TGGGTTCTATAAGAAAGCA-GCTGAGCAAGCCATGTGGAACCAAGCCAGT  180

seq1  AAGCGGTACCCCTCCACGGACTCCAAATCAGCCCCTGCCTCCAGGTTCAT  248
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  AAGCGGTACCCCT-CACGGACTCCAAATCAGCCCCTGCCTCCAGGTTCAT  229

seq1  GCCTTGTTTGAGTTTTTGCCTTGGCTTCCTTCAGTGATATGGAAGCACAA  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTGTTTGAGTTTTTGCCTTGGCTTCCTTCAGTGATATGGAAGCACAA  279

seq1  GACAAATAAACTGTTTCTTCCCAAGTCGCTCTAGTCATGGTGTTTCATCA  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAAATAAACTGTTTCTTCCCAAGTCGCTCTAGTCATGGTGTTTCATCA  329

seq1  CAGCAATGATAACCCTAACTGGGACATCTAAGCAAGGCCAAGTAGGTGAC  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAATGATAACCCTAACTGGGACATCTAAGCAAGGCCAAGTAGGTGAC  379

seq1  AAATCAGCCACAGCTTTGCCAGGTGGCCCAGAGGGTCTGGAGGCTGATGT  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCAGCCACAGCTTTGCCAGGTGGCCCAGAGGGTCTGGAGGCTGATGT  429

seq1  CATGTATCTGTAATATGTAGGTGCTAATATTTGTCTGTGGAAAACAACAA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTATCTGTAATATGTAGGTGCTAATATTTGTCTGTGGAAAACAACAA  479

seq1  TTTGTAAGCAGAGTACTGGGGGATGAGCCAGTAGCTGCCTGCCTTGTCCT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTAAGCAGAGTACTGGGGGATGAGCCAGTAGCTGCCTGCCTTGTCCT  529

seq1  AGGGTGGCCACAGTTAGGGTCCCAAGCTGACTCTGGGCTTCTGTGAGTGC  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTGGCCACAGTTAGGGTCCCAAGCTGACTCTGGGCTTCTGTGAGTGC  579

seq1  TCCTGAAGGCTGAAGTTCTGTGGTGGCATCGAGGGCCCACTGAGCATGGG  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGAAGGCTGAAGTTCTGTGGTGGCATCGAGGGCCCACTGAGCATGGG  629

seq1  TCCTGGGCTTAGCTCTTCTCAACTGCTGTCCTCAGCTTAAAAGGGGATAA  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGGGCTTAGCTCTTCTCAACTGCTGTCCTCAGCTTAAAAGGGGATAA  679

seq1  ATGAAACCAACTCTCTGCTGCTTTAGCAGAGGACATGGAGAAACCCGGAC  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAACCAACTCTCTGCTGCTTTAGCAGAGGACATGGAGAAACCCGGAC  729

seq1  CCCACGATCACATCTGGACCAGAGAGTATTGCAAATCCAGAGTGAGTTAA  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACGATCACATCTGGACCAGAGAGTATTGCAAATCCAGAGTGAGTTAA  779

seq1  CCCTGAGCTTTGAAGGGGAATTTCCCAGACCTGGCAAGGTAGCTGTGAAG  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGAGCTTTGAAGGGGAATTTCCCAGACCTGGCAAGGTAGCTGTGAAG  829

seq1  TCTGGAAATGCACCAGGTTACAGTCATGTGTGCTTTGGACGCCAAAGGCA  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGAAATGCACCAGGTTACAGTCATGTGTGCTTTGGACGCCAAAGGCA  879

seq1  AAGCTGAGGGCACTGTGGGTTTTCCTTTCTCCTCATGGGCAGGAAAGATA  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTGAGGGCACTGTGGGTTTTCCTTTCTCCTCATGGGCAGGAAAGATA  929

seq1  AGAAGGCGAACTAGGTCAGAGAGGGGGGTAGAAGACCTCCGCAGTTAGCC  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGGCGAACTAGGTCAGAGAGGGGGGTAGAAGACCTCCGCAGTTAGCC  979

seq1  TAAGGGGAACTTCAAACTGTCTCTTGCTGAAAGATCAGAACCACAGTCCA  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGGGGAACTTCAAACTGTCTCTTGCTGAAAGATCAGAACCACAGTCCA  1029

seq1  GGGTGTCTGCATCCTGGAGTGGGTTCATGAGACAAGGGTGGATGGTGGGA  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGTCTGCATCCTGGAGTGGGTTCATGAGACAAGGGTGGATGGTGGGA  1079

seq1  CTGAGAGAAACAAGTGCTAATGAATACACTTCAAACTTTCTGGTTAGCAA  1148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGAGAAACAAGTGCTAATGAATACACTTCAAACTTTCTGGTTAGCAA  1129

seq1  TAGCTACATGTCCAGCTCTGGAACCTTCTGTGGAATTC  1186
      ||||||||||||||||||||||||||||||||||||||
seq2  TAGCTACATGTCCAGCTCTGGAACCTTCTGTGGAATTC  1167

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information