MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-208N18
Chromosome	19 (Build37)
Map Location	5,740,306 - 5,893,338
singlet/doublet	doublet
Overlap gene	Ltbp3, Scyl1, 2310043N10Rik, 1200004M23Rik, Slc25a45, Tigd3
Upstream gene	Spnb3, Rbm4b, Rbm4, Rbm14, Ccs, Ccdc87, Ctsf, Actn3, Zdhhc24, Bbs1, Dpp3, Peli3, Mrpl11, Npas4, Slc29a2, B3gnt1, Brms1, Rin1, Cd248, Tmem151, Yif1a, Cnih2, Rab1b, Klc2, LOC383424, Pacs1, Sf3b2, Gal3st3, EG631868, Catsper1, Cst6, Banf1, 2010003J03Rik, Sart1, Tsga10ip, EG622178, Drap1, AI837181, LOC383425, Fosl1, Ccdc85b, Fibp, Ctsw, Efemp2, Mus81, Cfl1, B930037P14Rik, 1700020D05Rik, Ovol1, Gm962, Rnaseh2c, Htatip, Rela, Sipa1, Pcnxl3, Map3k11, Kcnk7, Ehbp1l1, Mtvr2, Sssca1
Downstream gene	Dpf2, Cdc42ep2, Pola2, Slc22a20, Capn1, EG666300, Syvn1, Mrpl49, Fau, Znhit2, Tm7sf2, 1110014N23Rik, LOC100039773, Zfpl1, Cdca5, Gm550, Naaladl1, Sac3d1, Snx15, Arl2, EG433216, Batf2, LOC622554, Gpha2, Ppp2r5b, 1810013C15Rik, Ehd1, Cdc42bpg, Men1, Map4k2, Sf1, Pygm, Rasgrp2, Nrxn2, Slc22a12, LOC629372
Link	Open Mouse BAC browser

Click to get alignment info.

name	Spnb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20743 MGI:1313261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66704 MGI:1913954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19653 MGI:1100865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56275 MGI:1929092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12460 MGI:1333783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc87 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399599 MGI:3026882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56464 MGI:1861434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11474 MGI:99678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70605 MGI:1917855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bbs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52028 MGI:1277215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75221 MGI:1922471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Peli3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240518 MGI:1924963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66419 MGI:2137215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npas4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225872 MGI:2664186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc29a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13340 MGI:1345278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gnt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108902 MGI:1919680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brms1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107392 MGI:2388804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225870 MGI:2385695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd248 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70445 MGI:1917695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem151 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381199 MGI:2147713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yif1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68090 MGI:1915340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnih2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12794 MGI:1277225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76308 MGI:1923558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16594 MGI:107953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383424 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 13 Proteins pseudo : _no_value

name	Pacs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107975 MGI:1277113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sf3b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319322 MGI:2441856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gal3st3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545276 MGI:3617843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG631868 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631868 MGI:3645420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Catsper1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225865 MGI:2179947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cst6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73720 MGI:1920970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Banf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23825 MGI:1346330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2010003J03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69860 MGI:1917110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sart1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20227 MGI:1309453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsga10ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78306 MGI:1925556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein

name	EG622178 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622178 MGI:3649011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 4 Proteins

name	Drap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66556 MGI:1913806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI837181 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107242 MGI:2147598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383425 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 191 ESTs, 5 Proteins pseudo : _no_value

name	Fosl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14283 MGI:107179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc85b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240514 MGI:2147607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fibp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58249 MGI:1926233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsw (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13041 MGI:1338045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efemp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58859 MGI:1891209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mus81 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71711 MGI:1918961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cfl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12631 MGI:101757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B930037P14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225861 MGI:2444704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700020D05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75555 MGI:1922805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ovol1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18426 MGI:1330290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm962 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381201 MGI:2685808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnaseh2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68209 MGI:1915459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htatip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81601 MGI:1932051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rela (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19697 MGI:103290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sipa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20469 MGI:107576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcnxl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104401 MGI:1861733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map3k11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26403 MGI:1346880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnk7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16530 MGI:1341841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ehbp1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114601 MGI:3612340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtvr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17826 MGI:106595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Sssca1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56390 MGI:1913482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltbp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16998 MGI:1101355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scyl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78891 MGI:1931787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310043N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66961 MGI:1914211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 254 ESTs

name	1200004M23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67457 MGI:1914707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107375 MGI:2147731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tigd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332359 MGI:2681860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19708 MGI:109529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc42ep2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104252 MGI:1929744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pola2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18969 MGI:99690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc22a20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381203 MGI:2685809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12333 MGI:88263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666300 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666300 MGI:3644144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Syvn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74126 MGI:1921376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl49 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18120 MGI:108180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fau (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14109 MGI:102547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Znhit2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29805 MGI:1352481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tm7sf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73166 MGI:1920416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110014N23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68505 MGI:1915755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039773 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Zfpl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81909 MGI:1891017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdca5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67849 MGI:1915099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm550 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225852 MGI:2685396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Naaladl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381204 MGI:2685810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sac3d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66406 MGI:1913656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69024 MGI:1916274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56327 MGI:1928393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433216 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433216 MGI:3648472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 179 ESTs, 5 Proteins

name	Batf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74481 MGI:1921731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622554 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Gpha2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170458 MGI:2156541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225849 MGI:2388480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810013C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329015 MGI:1916291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ehd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13660 MGI:1341878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc42bpg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240505 MGI:2652845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 20 Proteins

name	Men1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17283 MGI:1316736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map4k2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26412 MGI:1346883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22668 MGI:1095403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pygm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19309 MGI:97830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasgrp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19395 MGI:1333849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrxn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18190 MGI:1096362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc22a12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20521 MGI:1195269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629372
definition	note : high mobility group protein 1-like pseudo : _no_value

name	Spnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55926126 GeneID:20743 MGI:1313261
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spectrin beta 3 transcript_id : NM_021287.1

name	Rbm4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909366 GeneID:66704 MGI:1913954
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 4B transcript_id : NM_025717.3

name	Rbm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262143 GeneID:19653 MGI:1100865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 4 transcript_id : NM_009032.2

name	Rbm14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262141 GeneID:56275 MGI:1929092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 14 transcript_id : NM_019869.2

name	Ccs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326534 GeneID:12460 MGI:1333783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : copper chaperone for superoxide dismutase transcript_id : NM_016892.3

name	Ccdc87 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803415 GeneID:399599 MGI:3026882
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 87 transcript_id : NM_207268.2

name	Ctsf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9845245 GeneID:56464 MGI:1861434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin F transcript_id : NM_019861.1

name	Actn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304854 GeneID:11474 MGI:99678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actinin alpha 3 transcript_id : NM_013456.1

name	Zdhhc24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363793 GeneID:70605 MGI:1917855
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 24 transcript_id : NM_027476.2

name	Bbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366848 GeneID:52028 MGI:1277215
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bardet-Biedl syndrome 1 homolog (human) transcript_id : NM_001033128.2

name	Dpp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527017 GeneID:75221 MGI:1922471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dipeptidylpeptidase 3 transcript_id : NM_133803.1

name	Peli3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982118 GeneID:240518 MGI:1924963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pellino 3 transcript_id : NM_172835.2

name	Mrpl11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376910 GeneID:66419 MGI:2137215
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L11 transcript_id : NM_025553.2

name	Npas4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365106 GeneID:225872 MGI:2664186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal PAS domain protein 4 transcript_id : NM_153553.3

name	Slc29a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892139 GeneID:13340 MGI:1345278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 29 (nucleoside transporters), member 2 transcript_id : NM_007854.2

name	B3gnt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92110030 GeneID:108902 MGI:1919680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 transcript_id : NM_175383.2

name	Brms1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527391 GeneID:107392 MGI:2388804
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : breast cancer metastasis-suppressor 1 transcript_id : NM_134155.1

name	Rin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130150 GeneID:225870 MGI:2385695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras and Rab interactor 1 transcript_id : NM_145495.2

name	Cd248 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982596 GeneID:70445 MGI:1917695
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD248 antigen, endosialin transcript_id : NM_054042.2

name	Tmem151 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49457864 GeneID:381199 MGI:2147713
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 151 transcript_id : NM_001001885.1

name	Yif1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802995 GeneID:68090 MGI:1915340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Yip1 interacting factor homolog A (S. cerevisiae) transcript_id : NM_026553.3

name	Cnih2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345469 GeneID:12794 MGI:1277225
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cornichon homolog 2 (Drosophila) transcript_id : NM_009920.2

name	Rab1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373067 GeneID:76308 MGI:1923558
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB1B, member RAS oncogene family transcript_id : NM_029576.2

name	Klc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778982 GeneID:16594 MGI:107953
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin light chain 2 transcript_id : NM_008451.2

name	Pacs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54291703 GeneID:107975 MGI:1277113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphofurin acidic cluster sorting protein 1 transcript_id : NM_153129.2

name	Sf3b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794205 GeneID:319322 MGI:2441856
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor 3b, subunit 2 transcript_id : NM_030109.1

name	Gal3st3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701541 GeneID:545276 MGI:3617843
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactose-3-O-sulfotransferase 3 transcript_id : NM_001024717.1

name	Catsper1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129998 GeneID:225865 MGI:2179947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cation channel of sperm 1 transcript_id : NM_139301.2

name	Cst6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388301 GeneID:73720 MGI:1920970
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystatin E/M transcript_id : NM_028623.3

name	Banf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981404 GeneID:23825 MGI:1346330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : barrier to autointegration factor 1 transcript_id : NM_011793.2

name	Banf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84042520 GeneID:23825 MGI:1346330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : barrier to autointegration factor 1 transcript_id : NM_001038231.1

name	2010003J03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893041 GeneID:69860 MGI:1917110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010003J03 gene transcript_id : NM_027236.2

name	Sart1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244095 GeneID:20227 MGI:1309453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : squamous cell carcinoma antigen recognized by T-cells 1 transcript_id : NM_016882.3

name	EG622178 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405706 GeneID:622178 MGI:3649011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 4 Proteins product : predicted gene, EG622178 transcript_id : XM_886587.2

name	Drap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313423 GeneID:66556 MGI:1913806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Dr1 associated protein 1 (negative cofactor 2 alpha) transcript_id : NM_024176.1

name	AI837181 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527385 GeneID:107242 MGI:2147598
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI837181 transcript_id : NM_134149.1

name	Fosl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129965 GeneID:14283 MGI:107179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fos-like antigen 1 transcript_id : NM_010235.2

name	Ccdc85b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348477 GeneID:240514 MGI:2147607
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 85B transcript_id : NM_198616.1

name	Fibp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625665 GeneID:58249 MGI:1926233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor (acidic) intracellular binding protein transcript_id : NM_021438.2

name	Ctsw (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367215 GeneID:13041 MGI:1338045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin W transcript_id : NM_009985.3

name	Efemp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982689 GeneID:58859 MGI:1891209
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epidermal growth factor-containing fibulin-like extracellular matrix protein 2 transcript_id : NM_021474.2

name	Mus81 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980666 GeneID:71711 MGI:1918961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MUS81 endonuclease homolog (yeast) transcript_id : NM_027877.2

name	Cfl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369132 GeneID:12631 MGI:101757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofilin 1, non-muscle transcript_id : NM_007687.3

name	B930037P14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356128 GeneID:225861 MGI:2444704
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B930037P14 gene transcript_id : NM_001024560.2

name	1700020D05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802344 GeneID:75555 MGI:1922805
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700020D05 gene transcript_id : NM_023781.4

name	Ovol1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374732 GeneID:18426 MGI:1330290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : OVO homolog-like 1 (Drosophila) transcript_id : NM_019935.3

name	Gm962 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349236 GeneID:381201 MGI:2685808
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 962, (NCBI) transcript_id : NM_001033448.2

name	Rnaseh2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71834684 GeneID:68209 MGI:1915459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease H2, subunit C transcript_id : NM_026616.2

name	Htatip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30519990 GeneID:81601 MGI:1932051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIV-1 tat interactive protein, homolog (human) transcript_id : NM_178637.1

name	Rela (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130517 GeneID:19697 MGI:103290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-rel reticuloendotheliosis viral oncogene homolog A (avian) transcript_id : NM_009045.4

name	Sipa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61556719 GeneID:20469 MGI:107576
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal-induced proliferation associated gene 1 transcript_id : NM_011379.3

name	Pcnxl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130055 GeneID:104401 MGI:1861733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pecanex-like 3 (Drosophila) transcript_id : NM_144868.2

name	Map3k11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66392589 GeneID:26403 MGI:1346880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase kinase 11 transcript_id : NM_022012.3

name	Kcnk7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51944954 GeneID:16530 MGI:1341841
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel, subfamily K, member 7 transcript_id : NM_010609.2

name	Kcnk7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51944956 GeneID:16530 MGI:1341841
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel, subfamily K, member 7 transcript_id : NM_001004138.1

name	Ehbp1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158692 GeneID:114601 MGI:3612340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EH domain binding protein 1-like 1 transcript_id : NM_053252.2

name	Mtvr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31324533 GeneID:17826 MGI:106595
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mammary tumor virus receptor 2 transcript_id : NM_181452.1

name	Mtvr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963546 GeneID:17826 MGI:106595
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mammary tumor virus receptor 2 transcript_id : NM_023166.1

name	Sssca1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60687516 GeneID:56390 MGI:1913482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sjogren's syndrome/scleroderma autoantigen 1 homolog (human) transcript_id : NM_020491.4

name	Ltbp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487414 GeneID:16998 MGI:1101355
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : latent transforming growth factor beta binding protein 3 transcript_id : NM_008520.2

name	Scyl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130697 GeneID:78891 MGI:1931787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SCY1-like 1 (S. cerevisiae) transcript_id : NM_023912.2

name	1200004M23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367845 GeneID:67457 MGI:1914707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200004M23 gene transcript_id : NM_026169.4

name	Slc25a45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374011 GeneID:107375 MGI:2147731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 45 transcript_id : NM_134154.2

name	Tigd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348509 GeneID:332359 MGI:2681860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tigger transposable element derived 3 transcript_id : NM_198634.1

name	Dpf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625650 GeneID:19708 MGI:109529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : D4, zinc and double PHD fingers family 2 transcript_id : NM_011262.2

name	Cdc42ep2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22779863 GeneID:104252 MGI:1929744
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC42 effector protein (Rho GTPase binding) 2 transcript_id : NM_026772.1

name	Pola2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982106 GeneID:18969 MGI:99690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), alpha 2 transcript_id : NM_008893.2

name	Slc22a20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130881 GeneID:381203 MGI:2685809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic anion transporter), member 20 transcript_id : NM_198650.2

name	Capn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982478 GeneID:12333 MGI:88263
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 1 transcript_id : NM_007600.2

name	EG666300 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405708 GeneID:666300 MGI:3644144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG666300 transcript_id : XM_982884.1

name	Syvn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254387 GeneID:74126 MGI:1921376
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synovial apoptosis inhibitor 1, synoviolin transcript_id : NM_028769.4

name	Mrpl49 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354540 GeneID:18120 MGI:108180
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L49 transcript_id : NM_026246.2

name	Fau (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679752 GeneID:14109 MGI:102547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (fox derived) transcript_id : NM_007990.1

name	Znhit2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59676553 GeneID:29805 MGI:1352481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, HIT domain containing 2 transcript_id : NM_013859.2

name	Tm7sf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117414163 GeneID:73166 MGI:1920416
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane 7 superfamily member 2 transcript_id : NM_028454.2

name	1110014N23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486661 GeneID:68505 MGI:1915755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110014N23 gene transcript_id : NM_001081041.1

name	LOC100039773 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270261 GeneID:100039773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039773 transcript_id : XM_001473483.1

name	Zfpl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130277 GeneID:81909 MGI:1891017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger like protein 1 transcript_id : NM_024231.2

name	Cdca5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803003 GeneID:67849 MGI:1915099
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle associated 5 transcript_id : NM_026410.2

name	Gm550 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405710 GeneID:225852 MGI:2685396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : gene model 550, (NCBI) transcript_id : XM_148894.7

name	Naaladl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222281 GeneID:381204 MGI:2685810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylated alpha-linked acidic dipeptidase-like 1 transcript_id : NM_001009546.1

name	Sac3d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508434 GeneID:66406 MGI:1913656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SAC3 domain containing 1 transcript_id : NM_133678.3

name	Snx15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794429 GeneID:69024 MGI:1916274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 15 transcript_id : NM_026912.1

name	Arl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129285 GeneID:56327 MGI:1928393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 2 transcript_id : NM_019722.3

name	EG433216 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405711 GeneID:433216 MGI:3648472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 179 ESTs, 5 Proteins product : predicted gene, EG433216 transcript_id : XM_484764.3

name	Batf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28077032 GeneID:74481 MGI:1921731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basic leucine zipper transcription factor, ATF-like 2 transcript_id : NM_028967.1

name	LOC622554 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94405713 GeneID:622554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical LOC622554 transcript_id : XM_886988.2

name	Gpha2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475777 GeneID:170458 MGI:2156541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein hormone alpha 2 transcript_id : NM_130453.2

name	Ppp2r5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364854 GeneID:225849 MGI:2388480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2, regulatory subunit B (B56), beta isoform transcript_id : NM_198168.3

name	1810013C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112382277 GeneID:329015 MGI:1916291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810013C15 gene transcript_id : NM_194348.3

name	Ehd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359457 GeneID:13660 MGI:1341878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EH-domain containing 1 transcript_id : NM_010119.4

name	Cdc42bpg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270271 GeneID:240505 MGI:2652845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 20 Proteins product : CDC42 binding protein kinase gamma (DMPK-like) transcript_id : XM_140553.7

name	Men1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678857 GeneID:17283 MGI:1316736
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : multiple endocrine neoplasia 1 transcript_id : NM_008583.1

name	Map4k2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130565 GeneID:26412 MGI:1346883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase kinase kinase 2 transcript_id : NM_009006.2

name	Sf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106450 GeneID:22668 MGI:1095403
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor 1 transcript_id : NM_011750.1

name	Pygm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755255 GeneID:19309 MGI:97830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : muscle glycogen phosphorylase transcript_id : NM_011224.1

name	Rasgrp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131888393 GeneID:19395 MGI:1333849
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS, guanyl releasing protein 2 transcript_id : NM_011242.2

name	Nrxn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62243517 GeneID:18190 MGI:1096362
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurexin II transcript_id : NM_020253.2

name	Slc22a12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982004 GeneID:20521 MGI:1195269
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic anion/cation transporter), member 12 transcript_id : NM_009203.2

name	Spnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55926127 CCDS:CCDS29434.1 GeneID:20743 MGI:1313261
definition	GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA] codon_start : 1 note : beta-spectrin 3 product : spectrin beta 3 protein_id : NP_067262.1

name	Rbm4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754120 CCDS:CCDS29435.1 GeneID:66704 MGI:1913954
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : 4921506I22Rik protein protein_id : NP_079993.2

name	Rbm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86262144 CCDS:CCDS29436.1 GeneID:19653 MGI:1100865
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : RNA binding motif protein 4 protein_id : NP_033058.2

name	Rbm14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86262142 CCDS:CCDS29437.1 GeneID:56275 MGI:1929092
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0000119 - mediator complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030674 - protein binding, bridging [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] [Evidence ISS]; GO:0016455 - RNA polymerase II transcription mediator activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006310 - DNA recombination [Evidence ISS]; GO:0006281 - DNA repair [Evidence ISS]; GO:0006260 - DNA replication [Evidence ISS]; GO:0030520 - estrogen receptor signaling pathway [Evidence ISS]; GO:0042921 - glucocorticoid receptor signaling pathway [Evidence ISS]; GO:0016575 - histone deacetylation [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0009725 - response to hormone stimulus [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : synaptotagmin interacting protein product : RNA binding motif protein 14 protein_id : NP_063922.2

name	Ccs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393066 CCDS:CCDS29438.1 GeneID:12460 MGI:1333783
definition	GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0005375 - copper ion transporter activity [Evidence IEA]; GO:0004785 - copper, zinc superoxide dismutase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006825 - copper ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0051353 - positive regulation of oxidoreductase activity [Evidence IMP]; GO:0006457 - protein folding [Evidence IEA]; GO:0006801 - superoxide metabolism [Evidence IEA] codon_start : 1 product : copper chaperone for superoxide dismutase protein_id : NP_058588.1

name	Ccdc87 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402285 CCDS:CCDS29439.1 GeneID:399599 MGI:3026882
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 87 protein_id : NP_997151.1

name	Ctsf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845246 CCDS:CCDS29440.1 GeneID:56464 MGI:1861434
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016946 - cathepsin F activity [Evidence IEA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : cathepsin F protein_id : NP_063914.1

name	Actn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304855 CCDS:CCDS29441.1 GeneID:11474 MGI:99678
definition	GO_component : GO:0005865 - striated muscle thin filament [Evidence TAS] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0051015 - actin filament binding [Evidence TAS] [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030674 - protein binding, bridging [Evidence TAS]; GO:0042803 - protein homodimerization activity [Evidence TAS] GO_process : GO:0006936 - muscle contraction [Evidence IPI] codon_start : 1 product : actinin alpha 3 protein_id : NP_038484.1

name	Zdhhc24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229103 GeneID:70605 MGI:1917855
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : leukocyte receptor cluster (LRC) member 4 protein_id : NP_081752.1

name	Bbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370025 CCDS:CCDS29442.1 GeneID:52028 MGI:1277215
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0016358 - dendrite development [Evidence IMP]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0001895 - retinal homeostasis [Evidence IMP]; GO:0035058 - sensory cilium biogenesis [Evidence IGI] [Evidence IMP]; GO:0007608 - sensory perception of smell [Evidence IMP] codon_start : 1 product : Bardet-Biedl syndrome 1 homolog protein_id : NP_001028300.1

name	Dpp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527018 CCDS:CCDS29443.1 GeneID:75221 MGI:1922471
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0017039 - dipeptidyl-peptidase III activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : dipeptidylpeptidase III product : dipeptidyl peptidase III protein_id : NP_598564.1

name	Peli3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982119 GeneID:240518 MGI:1924963
definition	codon_start : 1 exception : mismatches in translation product : pellino 3 protein_id : NP_766423.2

name	Mrpl11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384980 CCDS:CCDS29444.1 GeneID:66419 MGI:2137215
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence ISS]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence TAS] codon_start : 1 product : mitochondrial ribosomal protein L11 protein_id : NP_079829.1

name	Npas4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24233564 CCDS:CCDS29445.1 GeneID:225872 MGI:2664186
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : limbic-enhanced PAS protein; bHLH-PAS type transcription factor NXF product : neuronal PAS domain protein 4 protein_id : NP_705781.1

name	Slc29a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678013 GeneID:13340 MGI:1345278
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005337 - nucleoside transporter activity [Evidence IDA] GO_process : GO:0015858 - nucleoside transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : delayed early response gene 12 product : solute carrier family 29 (nucleoside transporters), member 2 protein_id : NP_031880.1

name	B3gnt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30039682 CCDS:CCDS29446.1 GeneID:108902 MGI:1919680
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008532 - N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 note : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 product : beta-1,3-N-acetylglucosaminyltransferase bGnT-6 protein_id : NP_780592.1

name	Brms1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527392 GeneID:107392 MGI:2388804
definition	GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IDA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : breast cancer metastasis-suppressor 1 protein_id : NP_598916.1

name	Rin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703974 CCDS:CCDS29447.1 GeneID:225870 MGI:2385695
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Ras and Rab interactor 1 protein_id : NP_663470.1

name	Cd248 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16923944 CCDS:CCDS29448.1 GeneID:70445 MGI:1917695
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : CD164 sialomucin-like 1; tumor endothelial marker 1 product : CD248 antigen, endosialin protein_id : NP_473383.1

name	Tmem151 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49457865 CCDS:CCDS29449.1 GeneID:381199 MGI:2147713
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC381199 protein_id : NP_001001885.1

name	Yif1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25282409 CCDS:CCDS29450.1 GeneID:68090 MGI:1915340
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : putative transmembrane protein; homolog of yeast Golgi membrane protein Yif1p (Yip1p-interacting factor) product : Yip1p-interacting factor protein_id : NP_080829.1

name	Cnih2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753470 CCDS:CCDS29451.1 GeneID:12794 MGI:1277225
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : cornichon-like product : cornichon homolog 2 protein_id : NP_034050.1

name	Rab1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313162 CCDS:CCDS29452.1 GeneID:76308 MGI:1923558
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB1B, member RAS oncogene family protein_id : NP_083852.1

name	Klc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778983 GeneID:16594 MGI:107953
definition	GO_component : GO:0035253 - ciliary rootlet [Evidence IDA] [Evidence IPI]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008088 - axon cargo transport [Evidence IMP] codon_start : 1 product : kinesin light chain 2 protein_id : NP_032477.2

name	Pacs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54291704 CCDS:CCDS29453.1 GeneID:107975 MGI:1277113
definition	GO_component : GO:0030137 - COPI-coated vesicle [Evidence IDA] GO_process : GO:0000042 - protein targeting to Golgi [Evidence IDA] codon_start : 1 note : cytosolic sorting protein PACS-1 product : phosphofurin acidic cluster sorting protein 1 protein_id : NP_694769.2

name	Sf3b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794206 CCDS:CCDS29454.1 GeneID:319322 MGI:2441856
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation product : splicing factor 3b, subunit 2 protein_id : NP_084385.1

name	Gal3st3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701542 CCDS:CCDS29455.1 GeneID:545276 MGI:3617843
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001733 - galactosylceramide sulfotransferase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : galactose-3-O-sulfotransferase 3 protein_id : NP_001019888.1

name	Catsper1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314844 CCDS:CCDS29456.1 GeneID:225865 MGI:2179947
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0007342 - fusion of sperm to egg plasma membrane [Evidence IMP]; GO:0030317 - sperm motility [Evidence IMP] codon_start : 1 note : sperm ion channel product : cation channel of sperm 1 protein_id : NP_647462.1

name	Cst6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312060 CCDS:CCDS29457.1 GeneID:73720 MGI:1920970
definition	GO_component : GO:0001533 - cornified envelope [Evidence IDA] GO_process : GO:0008544 - epidermis development [Evidence IMP] codon_start : 1 note : cystatin M; harlequin ichthysosis; harlequin ichthyosis product : cystatin E/M protein_id : NP_082899.1

name	Banf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84042521 CCDS:CCDS29458.1 GeneID:23825 MGI:1346330
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence TAS] [Evidence IDA] GO_process : GO:0015074 - DNA integration [Evidence IDA]; GO:0019047 - provirus integration [Evidence TAS] codon_start : 1 note : breakpoint cluster region protein 1; LAP2 binding protein 1 product : barrier to autointegration factor 1 protein_id : NP_001033320.1

name	Banf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753178 CCDS:CCDS29458.1 GeneID:23825 MGI:1346330
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence TAS] [Evidence IDA] GO_process : GO:0015074 - DNA integration [Evidence IDA]; GO:0019047 - provirus integration [Evidence TAS] codon_start : 1 note : breakpoint cluster region protein 1; LAP2 binding protein 1 product : barrier to autointegration factor 1 protein_id : NP_035923.1

name	2010003J03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037183 CCDS:CCDS29459.1 GeneID:69860 MGI:1917110
definition	GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69860 protein_id : NP_081512.1

name	Sart1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244096 CCDS:CCDS29460.1 GeneID:20227 MGI:1309453
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : squamous cell carcinoma antigen recognized by T-cells 1 protein_id : NP_058578.3

name	EG622178 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82997807 GeneID:622178 MGI:3649011
definition	codon_start : 1 product : similar to RIKEN cDNA 1110020P15 gene protein_id : XP_891680.1

name	Drap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313424 CCDS:CCDS29462.1 GeneID:66556 MGI:1913806
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IDA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Dr1 associated protein 1 (negative cofactor 2 alpha) protein_id : NP_077138.1

name	AI837181 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527386 CCDS:CCDS29463.1 GeneID:107242 MGI:2147598
definition	codon_start : 1 product : basophilic leukemia expressed protein protein_id : NP_598910.1

name	Fosl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753896 CCDS:CCDS29464.1 GeneID:14283 MGI:107179
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : fos-like antigen 1 protein_id : NP_034365.1

name	Ccdc85b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348478 GeneID:240514 MGI:2147607
definition	codon_start : 1 product : coiled-coil domain containing 85B protein_id : NP_941018.1

name	Fibp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946808 GeneID:58249 MGI:1926233
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0017134 - fibroblast growth factor binding [Evidence IEA] codon_start : 1 note : aFGF intracellular binding protein product : FGF intracellular binding protein protein_id : NP_067413.1

name	Ctsw (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981819 CCDS:CCDS29465.1 GeneID:13041 MGI:1338045
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : cathepsin W preproprotein protein_id : NP_034115.2

name	Efemp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982690 CCDS:CCDS29466.1 GeneID:58859 MGI:1891209
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : EGF-containing fibulin-like extracellular matrix protein 2 (Efemp2); fibulin 4; fibulin-4 product : epidermal growth factor-containing fibulin-like extracellular matrix protein 2 protein_id : NP_067449.2

name	Mus81 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980667 CCDS:CCDS29467.1 GeneID:71711 MGI:1918961
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006259 - DNA metabolism [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA] [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MUS81 endonuclease protein_id : NP_082153.2

name	Cfl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680924 GeneID:12631 MGI:101757
definition	GO_component : GO:0030864 - cortical actin cytoskeleton [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0007015 - actin filament organization [Evidence IMP]; GO:0006928 - cell motility [Evidence IMP]; GO:0000910 - cytokinesis [Evidence IMP]; GO:0030010 - establishment of cell polarity [Evidence IMP]; GO:0001755 - neural crest cell migration [Evidence IMP]; GO:0001842 - neural fold formation [Evidence IMP]; GO:0030836 - positive regulation of actin filament depolymerization [Evidence IMP] codon_start : 1 product : cofilin 1, non-muscle protein_id : NP_031713.1

name	B930037P14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66792896 CCDS:CCDS29468.1 GeneID:225861 MGI:2444704
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC225861 protein_id : NP_001019731.1

name	1700020D05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981318 GeneID:75555 MGI:1922805
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : mage-g2 protein protein_id : NP_076270.2

name	Ovol1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910472 CCDS:CCDS29469.1 GeneID:18426 MGI:1330290
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008544 - epidermis development [Evidence IMP]; GO:0007498 - mesoderm development [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0000239 - pachytene [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : OVO homolog-like 1 protein_id : NP_064319.1

name	Gm962 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677454 CCDS:CCDS29470.1 GeneID:381201 MGI:2685808
definition	codon_start : 1 product : hypothetical protein LOC381201 protein_id : NP_001028620.1

name	Rnaseh2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386102 CCDS:CCDS29471.1 GeneID:68209 MGI:1915459
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : AYP1 protein protein_id : NP_080892.1

name	Htatip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519991 CCDS:CCDS29472.1 GeneID:81601 MGI:1932051
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004402 - histone acetyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Tat-interactive protein-60; mHTATIP/CPLA2; HIV-1 tat interactive protein 1, homolog; HIV-1 tat interactive protein 1, 60 kDa homolog product : HIV-1 tat interactive protein, homolog protein_id : NP_848752.1

name	Rela (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677709 CCDS:CCDS29473.1 GeneID:19697 MGI:103290
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence TAS] GO_process : GO:0051092 - activation of NF-kappaB transcription factor [Evidence ISS]; GO:0006952 - defense response [Evidence IMP]; GO:0001942 - hair follicle development [Evidence IMP]; GO:0001889 - liver development [Evidence IMP]; GO:0042177 - negative regulation of protein catabolism [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045084 - positive regulation of interleukin-12 biosynthesis [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : p65 NF-kappa B; p65 NFkB; avian reticuloendotheliosis viral (v-rel) oncogene homolog A; p65 NF kappaB product : v-rel reticuloendotheliosis viral oncogene homolog A protein_id : NP_033071.1

name	Sipa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61556720 CCDS:CCDS29474.1 GeneID:20469 MGI:107576
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0046582 - Rap GTPase activator activity [Evidence ISS] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0007162 - negative regulation of cell adhesion [Evidence ISS]; GO:0030308 - negative regulation of cell growth [Evidence ISS]; GO:0045786 - negative regulation of progression through cell cycle [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA] codon_start : 1 exception : mismatches in translation product : signal-induced proliferation associated gene 1 protein_id : NP_035509.3

name	Pcnxl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450095 CCDS:CCDS29475.1 GeneID:104401 MGI:1861733
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : pecanex-like 3 protein_id : NP_659117.1

name	Map3k11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543234 CCDS:CCDS29476.1 GeneID:26403 MGI:1346880
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0046328 - regulation of JNK cascade [Evidence IDA] codon_start : 1 note : mixed lineage kinase 3 product : mitogen activated protein kinase kinase kinase 11 protein_id : NP_071295.2

name	Kcnk7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51944955 CCDS:CCDS29477.1 GeneID:16530 MGI:1341841
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0005267 - potassium channel activity [Evidence IEA] [Evidence ISS]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : potassium channel, subfamily K, member 7 isoform a protein_id : NP_034739.2

name	Kcnk7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51944957 GeneID:16530 MGI:1341841
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0005267 - potassium channel activity [Evidence IEA] [Evidence ISS]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : potassium channel, subfamily K, member 7 isoform b protein_id : NP_001004138.1

name	Ehbp1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158693 GeneID:114601 MGI:3612340
definition	codon_start : 1 product : tangerin protein_id : NP_444482.2

name	Mtvr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963547 GeneID:17826 MGI:106595
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : mammary tumor virus receptor 2 isoform 2 protein_id : NP_075655.1

name	Mtvr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31324534 GeneID:17826 MGI:106595
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : mammary tumor virus receptor 2 isoform 1 protein_id : NP_852117.1

name	Sssca1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543773 CCDS:CCDS29479.1 GeneID:56390 MGI:1913482
definition	GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : C184L-22 protein_id : NP_065237.3

name	Ltbp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487415 GeneID:16998 MGI:1101355
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence ISS]; GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0019838 - growth factor binding [Evidence IEA] GO_process : GO:0001501 - skeletal development [Evidence IMP]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IPI] [Evidence IMP] codon_start : 1 product : latent transforming growth factor beta binding protein 3 protein_id : NP_032546.2

name	Scyl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963867 CCDS:CCDS29480.1 GeneID:78891 MGI:1931787
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : ubiquitous protein kinase-like (105 kDa); N-terminal kinase-like product : SCY1-like 1 protein_id : NP_076401.1

name	1200004M23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385676 CCDS:CCDS29481.1 GeneID:67457 MGI:1914707
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : FKSG44 homolog protein_id : NP_080445.1

name	Slc25a45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956272 CCDS:CCDS29482.1 GeneID:107375 MGI:2147731
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : solute carrier family 25, member 45 protein_id : NP_598915.1

name	Tigd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348510 CCDS:CCDS29483.1 GeneID:332359 MGI:2681860
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : tigger transposable element derived 3 protein_id : NP_941036.1

name	Dpf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755314 GeneID:19708 MGI:109529
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : requiem; neuro-d4/requiem product : D4, zinc and double PHD fingers family 2 protein_id : NP_035392.1

name	Cdc42ep2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779864 CCDS:CCDS29484.1 GeneID:104252 MGI:1929744
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0001515 - opioid peptide activity [Evidence IPI] GO_process : GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 note : Cdc42 effector protein 2 product : CDC42 effector protein (Rho GTPase binding) 2 protein_id : NP_081048.1

name	Pola2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982107 CCDS:CCDS29485.1 GeneID:18969 MGI:99690
definition	GO_component : GO:0005658 - alpha DNA polymerase:primase complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence IPI] GO_process : GO:0006260 - DNA replication [Evidence IDA]; GO:0000060 - protein import into nucleus, translocation [Evidence IDA] codon_start : 1 note : DNA polymerase alpha 2, 68 kDa product : polymerase (DNA directed), alpha 2 protein_id : NP_032919.2

name	Slc22a20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348536 CCDS:CCDS29486.1 GeneID:381203 MGI:2685809
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008514 - organic anion transporter activity [Evidence NAS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0015711 - organic anion transport [Evidence NAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : SLC22 organic anion transporter; OAT1-like organic anion transporter product : solute carrier family 22 (organic anion transporter), member 20 protein_id : NP_941052.1

name	Capn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671668 GeneID:12333 MGI:88263
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004198 - calpain activity [Evidence TAS]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : mu-calpain product : calpain 1 protein_id : NP_031626.1

name	EG666300 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94405709 GeneID:666300 MGI:3644144
definition	codon_start : 1 product : similar to thymosin, beta 10 protein_id : XP_987978.1

name	Syvn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254388 CCDS:CCDS29487.1 GeneID:74126 MGI:1921376
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0006986 - response to unfolded protein [Evidence ISS] codon_start : 1 exception : mismatches in translation product : synoviolin 1 protein_id : NP_083045.3

name	Mrpl49 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385752 CCDS:CCDS29488.1 GeneID:18120 MGI:108180
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : neighbor of fau 1 product : mitochondrial ribosomal protein L49 protein_id : NP_080522.1

name	Fau (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679753 CCDS:CCDS29489.1 GeneID:14109 MGI:102547
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : monoclonal nonspecific suppressor factor betamonoclonal nonspecific suppressor factor beta product : Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (fox derived) protein_id : NP_032016.1

name	Znhit2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59676554 GeneID:29805 MGI:1352481
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger, HIT domain containing 2 protein_id : NP_038887.2

name	Tm7sf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117414164 CCDS:CCDS29490.1 GeneID:73166 MGI:1920416
definition	codon_start : 1 product : transmembrane 7 superfamily member 2 protein_id : NP_082730.2

name	1110014N23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486662 GeneID:68505 MGI:1915755
definition	codon_start : 1 product : hypothetical protein LOC68505 protein_id : NP_001074510.1

name	LOC100039773 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270262 GeneID:100039773
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473533.1

name	Zfpl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195658 CCDS:CCDS29492.1 GeneID:81909 MGI:1891017
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger like protein 1 protein_id : NP_077193.1

name	Cdca5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385902 CCDS:CCDS29493.1 GeneID:67849 MGI:1915099
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence ISS]; GO:0007067 - mitosis [Evidence IDA] [Evidence IEA]; GO:0007076 - mitotic chromosome condensation [Evidence ISS]; GO:0007080 - mitotic metaphase plate congression [Evidence ISS] codon_start : 1 note : sororin p35 product : cell division cycle associated 5 protein_id : NP_080686.1

name	Gm550 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28525884 GeneID:225852 MGI:2685396
definition	codon_start : 1 product : similar to Cell division cycle associated 5 protein_id : XP_148894.2

name	Naaladl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222282 CCDS:CCDS29494.1 GeneID:381204 MGI:2685810
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016805 - dipeptidase activity [Evidence IEA]; GO:0043275 - glutamate carboxypeptidase II activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 function : protease product : N-acetylated-alpha-linked acidic dipeptidase like protein protein_id : NP_001009546.1

name	Sac3d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508435 GeneID:66406 MGI:1913656
definition	GO_component : GO:0005813 - centrosome [Evidence IDA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0051298 - centrosome duplication [Evidence IMP]; GO:0051227 - mitotic spindle assembly [Evidence IMP] codon_start : 1 note : Sac3 homology domain 1 product : SAC3 domain containing 1 protein_id : NP_598439.3

name	Snx15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794430 CCDS:CCDS29495.1 GeneID:69024 MGI:1916274
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : sorting nexin 15 protein_id : NP_081188.1

name	Arl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980988 CCDS:CCDS29496.1 GeneID:56327 MGI:1928393
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : arf-like protein 2; ADP-ribosylation-like 2 product : ADP-ribosylation factor-like 2 protein_id : NP_062696.2

name	EG433216 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270270 GeneID:433216 MGI:3648472
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484764.4

name	Batf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077033 CCDS:CCDS29497.1 GeneID:74481 MGI:1921731
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : basic leucine zipper transcription factor, ATF-like 2 protein_id : NP_083243.1

name	LOC622554 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94405714 GeneID:622554
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892081.2

name	Gpha2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18485506 CCDS:CCDS29498.1 GeneID:170458 MGI:2156541
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : glycoprotein hormone alpha 2 protein_id : NP_569720.1

name	Ppp2r5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718993 CCDS:CCDS29499.1 GeneID:225849 MGI:2388480
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein phosphatase 2, regulatory subunit B (B56), beta isoform protein_id : NP_937811.1

name	1810013C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62243857 CCDS:CCDS29500.1 GeneID:329015 MGI:1916291
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC329015 protein_id : NP_919329.2

name	Ehd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106303 CCDS:CCDS29501.1 GeneID:13660 MGI:1341878
definition	GO_component : GO:0005769 - early endosome [Evidence IDA]; GO:0030139 - endocytic vesicle [Evidence IDA]; GO:0005768 - endosome [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IDA]; GO:0016197 - endosome transport [Evidence IDA] codon_start : 1 function : suggested to be involved in regulated endocytosis product : EH-domain containing 1 protein_id : NP_034249.1

name	Cdc42bpg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270272 GeneID:240505 MGI:2652845
definition	codon_start : 1 product : CDC42 binding protein kinase gamma (DMPK-like) protein_id : XP_140553.6

name	Men1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678858 CCDS:CCDS29502.1 GeneID:17283 MGI:1316736
definition	GO_component : GO:0035097 - histone methyltransferase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IDA] GO_process : GO:0016571 - histone methylation [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence TAS] codon_start : 1 product : menin protein_id : NP_032609.1

name	Map4k2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678800 CCDS:CCDS29503.1 GeneID:26412 MGI:1346883
definition	GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence ISS] [Evidence IEA]; GO:0007243 - protein kinase cascade [Evidence ISS]; GO:0006903 - vesicle targeting [Evidence IDA] codon_start : 1 note : RAB8 interacting protein product : mitogen activated protein kinase kinase kinase kinase 2 protein_id : NP_033032.1

name	Sf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106451 GeneID:22668 MGI:1095403
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 162 protein_id : NP_035880.1

name	Pygm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755256 CCDS:CCDS29504.1 GeneID:19309 MGI:97830
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008184 - glycogen phosphorylase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004645 - phosphorylase activity [Evidence IEA]; GO:0030170 - pyridoxal phosphate binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005980 - glycogen catabolism [Evidence IDA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 product : muscle glycogen phosphorylase protein_id : NP_035354.1

name	Rasgrp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:131888394 GeneID:19395 MGI:1333849
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence ISS]; GO:0019992 - diacylglycerol binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005088 - Ras guanyl-nucleotide exchange factor activity [Evidence ISS] GO_process : GO:0007265 - Ras protein signal transduction [Evidence ISS]; GO:0001558 - regulation of cell growth [Evidence ISS]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : RAP 1A protein-specific guanine nucleotide exchange factor 1; CalDAG-GEFI; F25B3.3 kinase like protein product : RAS, guanyl releasing protein 2 protein_id : NP_035372.2

name	Nrxn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62243518 GeneID:18190 MGI:1096362
definition	GO_component : GO:0042734 - presynaptic membrane [Evidence ISS] GO_function : GO:0005246 - calcium channel regulator activity [Evidence IGI] GO_process : GO:0007269 - neurotransmitter secretion [Evidence IGI]; GO:0007268 - synaptic transmission [Evidence IGI]; GO:0007416 - synaptogenesis [Evidence IGI] codon_start : 1 note : neurexin II beta; neurexin II alpha product : neurexin II protein_id : NP_064649.2

name	Slc22a12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982005 CCDS:CCDS29505.1 GeneID:20521 MGI:1195269
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence ISS]; GO:0031526 - brush border membrane [Evidence IDA] [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IDA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0030165 - PDZ domain binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0015143 - urate transporter activity [Evidence ISS] [Evidence IDA] GO_process : GO:0019725 - cell homeostasis [Evidence ISS]; GO:0006810 - transport [Evidence IEA]; GO:0015747 - urate transport [Evidence ISS] [Evidence IDA] codon_start : 1 exception : mismatches in translation note : solute carrier family 22 (organic cation transporter)-like 2 product : solute carrier family 22 (organic anion/cation transporter), member 12 protein_id : NP_033229.2

name	EG631868 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631868
definition	number : 1 pseudo : _no_value

name	EG631868 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631868
definition	number : 2 pseudo : _no_value

name	LOC383424 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270268 GeneID:383424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 13 Proteins product : similar to HNRPF protein pseudo : _no_value transcript_id : XR_034922.1

name	Tsga10ip (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270269 GeneID:78306 MGI:1925556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : testis specific 10 interacting protein transcript_id : XR_034927.1

name	LOC383425 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270259 GeneID:383425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 191 ESTs, 5 Proteins product : similar to nucleolar protein 5A pseudo : _no_value transcript_id : XR_031076.1

name	2310043N10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270260 GeneID:66961 MGI:1914211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 254 ESTs product : RIKEN cDNA 2310043N10 gene transcript_id : XR_035482.1

clone name	MSMg01-178H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417L15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-512N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518C18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535B20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-144P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-288O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167B14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-208N18.b	B6Ng01-208N18.g
ACC	GA027627	GA027628
length	208	1,050
definition	B6Ng01-208N18.b	B6Ng01-208N18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(5,740,306 - 5,740,513)	(5,892,318 - 5,893,338)
sequence	caaggcttggagagcacgagattccaagcctggactgtttgacagcgcct tgttccaaggtgagcctctgcctactctgcacaggggagggtcaggttta caccagttcaaaggaaaaaatgaatgtaagagcgctcagcaccactcctg ccaggtggaaagtattcagtgttactgttgcaacagtgttactagagcag ggggaggg	gaattctctccacttcggaccagaaacactcgactctgccagctctcttc tgggtctagccctctcctcccacagcctggccatctcatgtctctttcag ctggcctggtctcctccagctttctgcattccagagaattgctctggctt caggggtcccgacctcttctgttcttcttgctctcagccattggcacgct ctcctacttttcttcccccagcagcttcccagggagtcatggagctgaac accaagaagaagcttcacgccctgtccctggctgagaagatccaggtgct ggaactcttggatgagtctaagatgtcccagtcagaggtggcccggcgct tccaggtctcacagccccagatctcacggatctgcaagaataaggagaag ctgttggcagactggtgcagtggcacagccaaccacgagcggaagcggaa gcgtgaatccaaatacagtgggatcgatgaggctctactgtgctggtacc acattgcccgagccaaggcctgggatgtaacggggcccatgttgctccac aaggccaaggaactggccgatatcatgggccaggatttcgtgcctagcat tggctggctggtccgctggaaacgtcgaaacaatgtgggctttgggactc gccaggtccttgtccctctgttccctcctgaagctcctcctgcagttctc ccatctcaggcccagccacctctttctcttaaagacttctcaccagaaga tgtttttggctgtgctgaagtacccttgttgtatcgcgcggtgcctggca gagtgttttgaatgtgatcgggttgcaagtactgttatgtgcccaaacag ccagaggcacagaaaaagcgaagggtatttggtgggtgggcttccaggcg gccccaaagatgctttcttttgggggtgaagcaagtgaggcactgccctt acttcttatcaacccctgaccttagcctatttccctgggtcagaagtggg ctggccacaagttggaccaggaacaatgggaacagcaggccgaacaggta
quality values	Open. Hide. 36 11 59 62 62 56 59 62 62 59 62 62 62 49 51 56 59 59 62 62 49 36 62 62 11 11 10 10 30 18 17 18 12 21 13 11 19 7 12 17 14 62 51 59 59 59 62 62 62 62 62 62 62 62 62 44 22 59 62 62 54 62 62 62 62 62 62 62 62 25 24 31 24 18 24 25 23 23 28 24 27 23 21 25 40 49 62 54 54 54 59 49 62 54 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 59 59 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 48 48 12	Open. Hide. 62 38 43 39 62 62 62 62 49 49 10 9 10 11 10 13 8 12 21 12 13 11 12 21 27 28 39 51 59 62 62 43 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 50 28 27 23 34 28 27 28 28 28 28 28 28 32 34 59 62 62 62 62 62 62 62 54 54 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 49 49 54 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 50 62 46 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 46 30 46 32 32 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 56 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 59 62 62 59 62 62 62 59 62 62 62 62 59 50 46 45 49 59 62 62 62 62 62 62 43 49 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 59 59 59 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 56 62 62 62 62 62 56 62 56 62 62 62 56 56 51 56 42 56 62 62 62 62 51 62 56 62 62 62 49 51 62 56 62 41 62 62 47 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 56 47 47 43 62 54 62 62 62 62 62 62 62 62 47 62 62 56 62 62 62 62 62 62 62 62 62 47 39 62 49 39 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 52 62 48 62 47 62 54 47 39 62 52 62 54 62 39 62 58 54 41 58 54 58 39 54 54 46 47 41 58 54 54 48 54 54 54 58 58 37 58 54 58 41 41 49 40 58 52 53 41 54 52 54 58 58 54 52 58 58 58 35 52 54 58 50 54 58 54 54 51 47 58 52 52 58 48 54 54 41 22 54 54 52 48 52 52 54 58 43 58 47 43 52 58 58 47 41 49 44 45 28 50 47 40 37 54 32 50 51 18 37 46 47 58 58 42 33 48 42 41 34 50 51 37 32 23 41 37 50 46 52 50 40 52 58 33 37 49 46 52 52 40 58 40 54 41 39 42 35 41 50 50 27 46 46 40 53 50 53 46 37 25 41 28 41 43 23 46 50 46 30 42 29 37 31 51 58 58 25 39 32 50 32 26 12 37 18 40 21 50 49 36 35 33 39 41 30 30 31 58 28 29 51 18 49 31 50 58 58 37 28 30 27 53 47 31 43 37 50 32 28 51 24 40 19 19 54 44 37 16 22 39 28 38 17 31 43 50 35 24 31 44 44 47 8 40 13 26 17 28 28 28 42 14 54 12 45 44 14 47 51 11 31 45 45 37 44 24 52 40 40 39 18 42 15 25 12 21 35 32 25 16 28 20 27 31 54 18 22 32 38 35 37 22 13 27 18 11 28 11 28 32 36 32 13 32 17 52 15 33 23 29 27 25 13 32 51 51 18 23 9 11 9 15 16 7 49 27 20 30 34 53 31 18 12 9 22 26 32 17 34 32 31 26 30 21 32 30 15 20 30 18 10 22 6 32 40 36 10 32 23 7 42 17 26 28 16 25 10 9 23 26 42 17 28 43 32 40 12 13 13 8 30 20 20 14 20 9 7 22 22 20 32 12 8 20 19 17 8 11 9 8 5 4 7 10 10 12 37 17 11 8 23 11 18 22 42 46 9 18 27 11 13 13 11 7 15 5 6 13 9 8 13 18 18 21 31 22 11 11 37 26 30 10 8 11 30 11 6 10 12 37 28 25 24 27 41 10 10 9 10 8 27 14 44 18 10 11 11 8 5 7 17 29 13 26 9 11 9 11 9 20 11 16 8 11 20 8 17 25 44 12 5 10 5 17 19 13 10 17 7 13 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_5740306_5740513
seq2: B6Ng01-208N18.b_51_258

seq1  CAAGGCTTGGAGAGCACGAGATTCCAAGCCTGGACTGTTTGACAGCGCCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGCTTGGAGAGCACGAGATTCCAAGCCTGGACTGTTTGACAGCGCCT  50

seq1  TGTTCCAAGGTGAGCCTCTGCCTACTCTGCACAGGGGAGGGTCAGGTTTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCCAAGGTGAGCCTCTGCCTACTCTGCACAGGGGAGGGTCAGGTTTA  100

seq1  CACCAGTTCAAAGGAAAAAATGAATGTAAGAGCGCTCAGCACCACTCCTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCAGTTCAAAGGAAAAAATGAATGTAAGAGCGCTCAGCACCACTCCTG  150

seq1  CCAGGTGGAAAGTATTCAGTGTTACTGTTGCAACAGTGTTACTAGAGCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGTGGAAAGTATTCAGTGTTACTGTTGCAACAGTGTTACTAGAGCAG  200

seq1  GGGGAGGG  208
      ||||||||
seq2  GGGGAGGG  208

seq1: chr19_5892318_5893338
seq2: B6Ng01-208N18.g_73_1122 (reverse)

seq1  TACCTGTCGGCCCTGCTG-TCCCAT--GTCCTGGTCAAAC-TGT-GCCAG  45
      |||||||  | ||||||| ||||||   |||||||| ||| ||| |||||
seq2  TACCTGTTCGGCCTGCTGTTCCCATTGTTCCTGGTCCAACTTGTGGCCAG  50

seq1  -CCAC-TCTGA-CCAGGGAA--TGGCT-AGGTCAGGG--TGATAAGAGGT  87
       |||| ||||| ||||||||   |||| |||||||||  |||||||| ||
seq2  CCCACTTCTGACCCAGGGAAATAGGCTAAGGTCAGGGGTTGATAAGAAGT  100

seq1  A--GGCAGTGCCTCAC-TGC-TCACCCC--AAAG-AAGCATC-TTGGGGC  129
      |  ||||||||||||| ||| |||||||  |||| ||||||| |||||||
seq2  AAGGGCAGTGCCTCACTTGCTTCACCCCCAAAAGAAAGCATCTTTGGGGC  150

seq1  CGCCTGG-AGCCCACCCA-CAAATACCCTTCGC-TTTTCTGTGCCTCT-G  175
      ||||||| |||||||||| |||||||||||||| |||||||||||||| |
seq2  CGCCTGGAAGCCCACCCACCAAATACCCTTCGCTTTTTCTGTGCCTCTGG  200

seq1  CTGTT--GGCACATAACAGTACTTGCAA-CCGATCACATTC-AAACACTC  221
      |||||  ||||||||||||||||||||| |||||||||||| ||||||||
seq2  CTGTTTGGGCACATAACAGTACTTGCAACCCGATCACATTCAAAACACTC  250

seq1  TGCCAGGCACCGCGCGATACAACAAGGGTACTTCAGCACAGCCAAAAACA  271
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAGGCACCGCGCGATACAACAAGGGTACTTCAGCACAGCCAAAAACA  300

seq1  TCTTCTGGTGAGAAGTCTTTAAGAGAAAGAGGTGGCTGGGCCTGAGATGG  321
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCTGGTGAGAAGTCTTTAAGAGAAAGAGGTGGCTGGGCCTGAGATGG  350

seq1  GAGAACTGCAGGAGGAGCTTCAGGAGGGAACAGAGGGACAAGGACCTGGC  371
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAACTGCAGGAGGAGCTTCAGGAGGGAACAGAGGGACAAGGACCTGGC  400

seq1  GAGTCCCAAAGCCCACATTGTTTCGACGTTTCCAGCGGACCAGCCAGCCA  421
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTCCCAAAGCCCACATTGTTTCGACGTTTCCAGCGGACCAGCCAGCCA  450

seq1  ATGCTAGGCACGAAATCCTGGCCCATGATATCGGCCAGTTCCTTGGCCTT  471
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTAGGCACGAAATCCTGGCCCATGATATCGGCCAGTTCCTTGGCCTT  500

seq1  GTGGAGCAACATGGGCCCCGTTACATCCCAGGCCTTGGCTCGGGCAATGT  521
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAGCAACATGGGCCCCGTTACATCCCAGGCCTTGGCTCGGGCAATGT  550

seq1  GGTACCAGCACAGTAGAGCCTCATCGATCCCACTGTATTTGGATTCACGC  571
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTACCAGCACAGTAGAGCCTCATCGATCCCACTGTATTTGGATTCACGC  600

seq1  TTCCGCTTCCGCTCGTGGTTGGCTGTGCCACTGCACCAGTCTGCCAACAG  621
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCGCTTCCGCTCGTGGTTGGCTGTGCCACTGCACCAGTCTGCCAACAG  650

seq1  CTTCTCCTTATTCTTGCAGATCCGTGAGATCTGGGGCTGTGAGACCTGGA  671
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTCCTTATTCTTGCAGATCCGTGAGATCTGGGGCTGTGAGACCTGGA  700

seq1  AGCGCCGGGCCACCTCTGACTGGGACATCTTAGACTCATCCAAGAGTTCC  721
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGCCGGGCCACCTCTGACTGGGACATCTTAGACTCATCCAAGAGTTCC  750

seq1  AGCACCTGGATCTTCTCAGCCAGGGACAGGGCGTGAAGCTTCTTCTTGGT  771
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACCTGGATCTTCTCAGCCAGGGACAGGGCGTGAAGCTTCTTCTTGGT  800

seq1  GTTCAGCTCCATGACTCCCTGGGAAGCTGCTGGGGGAAGAAAAGTAGGAG  821
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCAGCTCCATGACTCCCTGGGAAGCTGCTGGGGGAAGAAAAGTAGGAG  850

seq1  AGCGTGCCAATGGCTGAGAGCAAGAAGAACAGAAGAGGTCGGGACCCCTG  871
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGTGCCAATGGCTGAGAGCAAGAAGAACAGAAGAGGTCGGGACCCCTG  900

seq1  AAGCCAGAGCAATTCTCTGGAATGCAGAAAGCTGGAGGAGACCAGGCCAG  921
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCAGAGCAATTCTCTGGAATGCAGAAAGCTGGAGGAGACCAGGCCAG  950

seq1  CTGAAAGAGACATGAGATGGCCAGGCTGTGGGAGGAGAGGGCTAGACCCA  971
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAAAGAGACATGAGATGGCCAGGCTGTGGGAGGAGAGGGCTAGACCCA  1000

seq1  GAAGAGAGCTGGCAGAGTCGAGTGTTTCTGGTCCGAAGTGGAGAGAATTC  1021
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAGAGCTGGCAGAGTCGAGTGTTTCTGGTCCGAAGTGGAGAGAATTC  1050

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information