MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-211H04
Chromosome	19 (Build37)
Map Location	11,650,625 - 11,651,768
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Tmem138, Cybasc3, Dak, Ddb1, Vwce, Pga5, 2210404E10Rik, Vps37c, Cd5, Cd6, Slc15a3, Tmem132a, Tmem109, Prpf19, Zp1, Gpr44, Ccdc86, Ms4a10, E530011F12Rik, 5033428B15Rik, AW112010, Ms4a8a, Gm336, LOC624395, 1700025F22Rik, Ms4a13, Ms4a12, Ms4a1, Ms4a5, Gm1276, Ms4a7, Ms4a4a, LOC435588, Ms4a4c, LOC433221, Ms4a4b, Ms4a6c, EG666926, Ms4a6b, Ms4a4d, LOC100040454
Downstream gene	Ms4a6d, Ms4a2, Ms4a3, Plac1l, Oosp1, Gm97, Gif, EG666958, Mrpl16, Stx3, Olfr1417, Olfr1418, Olfr1419, EG622845, EG666985, Olfr1420, AV312086, Osbp, GA_x5J8B7W6KF8-6942124-6941700, Olfr1422-ps1, Olfr1423, Olfr1424, Olfr1425, Olfr1426, Olfr1427, Olfr1428, Olfr76, Olfr1555-ps1, Olfr1430-ps1, Olfr1431, Olfr1429-ps1, Olfr262, Olfr232, Olfr1433, Olfr1435-ps1, Olfr1436, Olfr1437, Olfr1438-ps1, Olfr1439-ps1, Olfr1440, Olfr1441, Pfpl, Mpeg1, Dtx4, EG625046, 4632417K18Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tmem138 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72982 MGI:1920232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cybasc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225912 MGI:2686925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dak (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225913 MGI:2385084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13194 MGI:1202384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vwce (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71768 MGI:1919018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein

name	Pga5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58803 MGI:1915935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210404E10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72305 MGI:1919555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Vps37c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107305 MGI:2147661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12507 MGI:88340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12511 MGI:103566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc15a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65221 MGI:1929691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem132a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98170 MGI:2147810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68539 MGI:1915789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prpf19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28000 MGI:106247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22786 MGI:103073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14764 MGI:1330275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc86 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108673 MGI:1277220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69826 MGI:1917076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E530011F12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545279 MGI:3617853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5033428B15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76002 MGI:1923252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	AW112010 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107350 MGI:2147706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 109 ESTs

name	Ms4a8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64381 MGI:1927657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm336 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240539 MGI:2685182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins

name	LOC624395 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624395
definition	note : NS1-associated protein 1 pseudogene pseudo : _no_value

name	1700025F22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69416 MGI:1916666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73466 MGI:1920716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381213 MGI:2685812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Ms4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12482 MGI:88321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269063 MGI:2670985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1276 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383435 MGI:2686122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins

name	Ms4a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109225 MGI:1918846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ms4a4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666907 MGI:3643932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	LOC435588 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ms4a4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64380 MGI:1927656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 55 ESTs, 24 Proteins pseudo : _no_value

name	Ms4a4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60361 MGI:1913083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a6c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73656 MGI:2385644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG666926 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666926 MGI:3645380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ms4a6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69774 MGI:1917024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66607 MGI:1913857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Ms4a6d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68774 MGI:1916024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14126 MGI:95495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170813 MGI:2158468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plac1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225922 MGI:2684945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oosp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170834 MGI:2149290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm97 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225923 MGI:2684943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gif (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14603 MGI:1202394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666958 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666958 MGI:3647782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Mrpl16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94063 MGI:2137219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20908 MGI:103077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Olfr1417 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258938 MGI:3031251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1418 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258227 MGI:3031252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1419 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257938 MGI:3031253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622845 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622845 MGI:3643502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 99 ESTs, 6 Proteins

name	EG666985 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666985 MGI:3644364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Olfr1420 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258405 MGI:3031254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AV312086 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225929 MGI:2147679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Osbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76303 MGI:97447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-6942124-6941700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257719
definition	note : olfactory receptor GA_x5J8B7W6KF8-6942124-6941700 pseudo : _no_value

name	Olfr1422-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258005 MGI:3031256
definition	gene_synonym : MOR239-8P note : olfactory receptor 1422, pseudogene 1 pseudo : _no_value

name	Olfr1423 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258675 MGI:3031257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1424 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258676 MGI:3031258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1425 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258155 MGI:3031259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1426 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258805 MGI:3031260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1427 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258674 MGI:3031261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1428 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258673 MGI:3031262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr76 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258677 MGI:2153205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1555-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257954 MGI:3031389
definition	gene_synonym : MOR0-15P; MOR202-43 note : olfactory receptor 1555, pseudogene 1 pseudo : _no_value

name	Olfr1430-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257992 MGI:3031264
definition	gene_synonym : MOR214-8P note : olfactory receptor 1430, pseudogene 1 pseudo : _no_value

name	Olfr1431 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258409 MGI:3031265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1429-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257955 MGI:3031263
definition	gene_synonym : GA_x5J8B7W20A2-6027-5647; MOR0-14P note : olfactory receptor 1429, pseudogene 1 pseudo : _no_value

name	Olfr262 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258683 MGI:3030096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr232 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258681 MGI:3030066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1433 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258680 MGI:3031267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr1435-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258004 MGI:3031269
definition	gene_synonym : MOR133-4P note : olfactory receptor 1435, pseudogene 1 pseudo : _no_value

name	Olfr1436 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258682 MGI:3031270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1437 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258117 MGI:3031271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1438-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258116 MGI:3031272
definition	gene_synonym : MOR215-4 note : olfactory receptor 1438, pseudogene 1 pseudo : _no_value

name	Olfr1439-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258015 MGI:3031273
definition	gene_synonym : MOR214-7P note : olfactory receptor 1439, pseudogene 1 pseudo : _no_value

name	Olfr1440 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258679 MGI:3031274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1441 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258678 MGI:3031275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56093 MGI:1860266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpeg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17476 MGI:1333743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dtx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207521 MGI:2672905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625046 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625046 MGI:3643874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	4632417K18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107373 MGI:1915508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem138 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374796 GeneID:72982 MGI:1920232
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 138 transcript_id : NM_028411.2

name	Cybasc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235723 GeneID:225912 MGI:2686925
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b, ascorbate dependent 3 transcript_id : NM_201351.1

name	Dak (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703975 GeneID:225913 MGI:2385084
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydroxyacetone kinase 2 homolog (yeast) transcript_id : NM_145496.1

name	Ddb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657010 GeneID:13194 MGI:1202384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : damage specific DNA binding protein 1 transcript_id : NM_015735.1

name	Vwce (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405819 GeneID:71768 MGI:1919018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein product : von Willebrand factor C and EGF domains, transcript variant 2 transcript_id : XM_889279.2

name	Pga5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378195 GeneID:58803 MGI:1915935
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pepsinogen 5, group I transcript_id : NM_021453.3

name	2210404E10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270388 GeneID:72305 MGI:1919555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 2210404E10 gene transcript_id : XM_001475568.1

name	Vps37c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340991 GeneID:107305 MGI:2147661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 37C (yeast) transcript_id : NM_181403.2

name	Cd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517488 GeneID:12507 MGI:88340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD5 antigen transcript_id : NM_007650.3

name	Cd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126513131 GeneID:12511 MGI:103566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD6 antigen transcript_id : NM_001037801.2

name	Cd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126513129 GeneID:12511 MGI:103566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD6 antigen transcript_id : NM_009852.3

name	Slc15a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12746419 GeneID:65221 MGI:1929691
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 15, member 3 transcript_id : NM_023044.1

name	Tmem132a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88196787 GeneID:98170 MGI:2147810
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 132A transcript_id : NM_133804.2

name	Tmem109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527377 GeneID:68539 MGI:1915789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 109 transcript_id : NM_134142.1

name	Prpf19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892883 GeneID:28000 MGI:106247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) transcript_id : NM_134129.3

name	Zp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249091 GeneID:22786 MGI:103073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zona pellucida glycoprotein 1 transcript_id : NM_009580.2

name	Gpr44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328164 GeneID:14764 MGI:1330275
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 44 transcript_id : NM_009962.2

name	Ccdc86 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357952 GeneID:108673 MGI:1277220
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 86 transcript_id : NM_023731.2

name	Ms4a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647223 GeneID:69826 MGI:1917076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 10 transcript_id : NM_023529.2

name	E530011F12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803485 GeneID:545279 MGI:3617853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E530011F12 gene transcript_id : NM_001034898.2

name	5033428B15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405843 GeneID:76002 MGI:1923252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5033428B15 gene transcript_id : XM_129208.5

name	AW112010 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405846 GeneID:107350 MGI:2147706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 109 ESTs product : expressed sequence AW112010 transcript_id : XM_888885.2

name	Ms4a8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953176 GeneID:64381 MGI:1927657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 8A transcript_id : NM_022430.2

name	Gm336 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270378 GeneID:240539 MGI:2685182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : gene model 336, (NCBI) transcript_id : XM_140607.6

name	1700025F22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802777 GeneID:69416 MGI:1916666
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700025F22 gene transcript_id : NM_027074.2

name	Ms4a13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130838 GeneID:73466 MGI:1920716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 13 transcript_id : NM_198224.3

name	Ms4a12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270379 GeneID:381213 MGI:2685812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : membrane-spanning 4-domains, subfamily A, member 12 transcript_id : XM_001474614.1

name	Ms4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361802 GeneID:12482 MGI:88321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 1 transcript_id : NM_007641.4

name	Ms4a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625823 GeneID:269063 MGI:2670985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 5 transcript_id : NM_183190.2

name	Gm1276 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405848 GeneID:383435 MGI:2686122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : gene model 1276, (NCBI) transcript_id : XM_357051.4

name	Ms4a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130396 GeneID:109225 MGI:1918846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 7 transcript_id : NM_027836.5

name	Ms4a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802929 GeneID:109225 MGI:1918846
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 7 transcript_id : NM_001025610.2

name	Ms4a4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270381 GeneID:666907 MGI:3643932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : membrane-spanning 4-domains, subfamily A, member 4A transcript_id : XM_986941.2

name	Ms4a4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62461603 GeneID:64380 MGI:1927656
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 4C transcript_id : NM_029499.2

name	Ms4a4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796633 GeneID:60361 MGI:1913083
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 4B transcript_id : NM_021718.2

name	Ms4a6c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373919 GeneID:73656 MGI:2385644
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : membrane-spanning 4-domains, subfamily A, member 6C transcript_id : NM_028595.3

name	EG666926 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270384 GeneID:666926 MGI:3645380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG666926 transcript_id : XM_987047.2

name	Ms4a6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130332 GeneID:69774 MGI:1917024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 6B transcript_id : NM_027209.3

name	Ms4a4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374560 GeneID:66607 MGI:1913857
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 4D transcript_id : NM_025658.4

name	Ms4a6d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637843 GeneID:68774 MGI:1916024
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 6D transcript_id : NM_026835.2

name	Ms4a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305048 GeneID:14126 MGI:95495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 2 transcript_id : NM_013516.1

name	Ms4a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354489 GeneID:170813 MGI:2158468
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 3 transcript_id : NM_133246.3

name	Plac1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364906 GeneID:225922 MGI:2684945
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : placenta-specific 1-like transcript_id : NM_001037634.2

name	Oosp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354986 GeneID:170834 MGI:2149290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oocyte secreted protein 1 transcript_id : NM_133353.3

name	Gm97 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185933 GeneID:225923 MGI:2684943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 97, (NCBI) transcript_id : NM_001033283.2

name	Gif (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377019 GeneID:14603 MGI:1202394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastric intrinsic factor transcript_id : NM_008118.3

name	Mrpl16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130301 GeneID:94063 MGI:2137219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L16 transcript_id : NM_025606.3

name	Stx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778801 GeneID:20908 MGI:103077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 3 transcript_id : NM_001025307.1

name	Stx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778979 GeneID:20908 MGI:103077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 3 transcript_id : NM_011502.2

name	Stx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778910 GeneID:20908 MGI:103077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 3 transcript_id : NM_152220.1

name	Olfr1417 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129038 GeneID:258938 MGI:3031251
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1417 transcript_id : NM_146936.1

name	Olfr1418 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372129 GeneID:258227 MGI:3031252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1418 transcript_id : NM_001011524.1

name	Olfr1419 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801325 GeneID:257938 MGI:3031253
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1419 transcript_id : NM_001011775.1

name	EG622845 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270394 GeneID:622845 MGI:3643502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 83 ESTs, 4 Proteins product : predicted gene, EG622845, transcript variant 1 transcript_id : XM_001476608.1

name	EG622845 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270396 GeneID:622845 MGI:3643502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 29 ESTs, 2 Proteins product : predicted gene, EG622845, transcript variant 2 transcript_id : XM_001476626.1

name	Olfr1420 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238899 GeneID:258405 MGI:3031254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1420 transcript_id : NM_146410.1

name	AV312086 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802695 GeneID:225929 MGI:2147679
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AV312086 transcript_id : NM_172635.2

name	Osbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133504508 GeneID:76303 MGI:97447
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein transcript_id : NM_001033174.1

name	Olfr1423 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239021 GeneID:258675 MGI:3031257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1423 transcript_id : NM_146680.1

name	Olfr1424 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239019 GeneID:258676 MGI:3031258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1424 transcript_id : NM_146681.1

name	Olfr1425 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801463 GeneID:258155 MGI:3031259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1425 transcript_id : NM_001011853.1

name	Olfr1426 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254188 GeneID:258805 MGI:3031260
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1426 transcript_id : NM_146809.2

name	Olfr1427 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239015 GeneID:258674 MGI:3031261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1427 transcript_id : NM_146679.1

name	Olfr1428 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239017 GeneID:258673 MGI:3031262
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1428 transcript_id : NM_146678.1

name	Olfr76 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239079 GeneID:258677 MGI:2153205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 76 transcript_id : NM_146682.1

name	Olfr1431 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239081 GeneID:258409 MGI:3031265
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1431 transcript_id : NM_146414.1

name	Olfr262 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239089 GeneID:258683 MGI:3030096
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 262 transcript_id : NM_146688.1

name	Olfr232 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239085 GeneID:258681 MGI:3030066
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 232 transcript_id : NM_146686.1

name	Olfr1433 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239087 GeneID:258680 MGI:3031267
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 1433 transcript_id : NM_146685.1

name	Olfr1436 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239091 GeneID:258682 MGI:3031270
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1436 transcript_id : NM_146687.1

name	Olfr1437 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801437 GeneID:258117 MGI:3031271
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1437 transcript_id : NM_001011839.1

name	Olfr1440 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239083 GeneID:258679 MGI:3031274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1440 transcript_id : NM_146684.1

name	Olfr1441 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239077 GeneID:258678 MGI:3031275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1441 transcript_id : NM_146683.1

name	Pfpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506576 GeneID:56093 MGI:1860266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pore forming protein-like transcript_id : NM_019540.1

name	Mpeg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133506752 GeneID:17476 MGI:1333743
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage expressed gene 1 transcript_id : NM_010821.1

name	Dtx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254206 GeneID:207521 MGI:2672905
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deltex 4 homolog (Drosophila) transcript_id : NM_172442.2

name	EG625046 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270390 GeneID:625046 MGI:3643874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG625046 transcript_id : XM_889589.2

name	4632417K18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360571 GeneID:107373 MGI:1915508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632417K18 gene transcript_id : NM_026640.2

name	Cybasc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235724 CCDS:CCDS29582.1 GeneID:225912 MGI:2686925
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : cytochrome b, ascorbate dependent 3 protein protein_id : NP_958739.1

name	Dak (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703976 GeneID:225913 MGI:2385084
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004371 - glycerone kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006071 - glycerol metabolism [Evidence IEA] codon_start : 1 product : dihydroxyacetone kinase 2 homolog protein_id : NP_663471.1

name	Ddb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657011 GeneID:13194 MGI:1202384
definition	codon_start : 1 note : damage specific DNA binding protein 1 (127 kDa); DNA repair protein; damage-specific DNA-binding protein, DNA repair; damaged-DNA recognition protein 1 product : damage specific DNA binding protein 1 protein_id : NP_056550.1

name	Vwce (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998150 GeneID:71768 MGI:1919018
definition	codon_start : 1 product : von Willebrand factor C and EGF domains isoform 2 protein_id : XP_894372.1

name	Pga5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981154 CCDS:CCDS29584.1 GeneID:58803 MGI:1915935
definition	GO_component : GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IDA] GO_process : GO:0019538 - protein metabolism [Evidence TAS] codon_start : 1 note : pepsinogen A5; pepsinogen F product : pepsinogen 5, group I protein_id : NP_067428.2

name	2210404E10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270389 GeneID:72305 MGI:1919555
definition	codon_start : 1 product : hypothetical protein LOC72305 protein_id : XP_001475618.1

name	Vps37c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088908 CCDS:CCDS29585.1 GeneID:107305 MGI:2147661
definition	codon_start : 1 product : vacuolar protein sorting 37C protein_id : NP_852068.1

name	Cd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517489 CCDS:CCDS29586.1 GeneID:12507 MGI:88340
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005044 - scavenger receptor activity [Evidence IEA] GO_process : GO:0008624 - induction of apoptosis by extracellular signals [Evidence IDA]; GO:0031295 - T cell costimulation [Evidence IDA] codon_start : 1 product : CD5 antigen protein_id : NP_031676.3

name	Cd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83699412 GeneID:12511 MGI:103566
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005044 - scavenger receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : CD6 antigen isoform 1 protein_id : NP_001032890.1

name	Cd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126513130 GeneID:12511 MGI:103566
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005044 - scavenger receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : CD6 antigen isoform 2 protein_id : NP_033982.3

name	Slc15a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746420 CCDS:CCDS29588.1 GeneID:65221 MGI:1929691
definition	GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cAMP inducible gene 1 product : solute carrier family 15, member 3 protein_id : NP_075531.1

name	Tmem132a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88196788 CCDS:CCDS29589.1 GeneID:98170 MGI:2147810
definition	codon_start : 1 note : heat shock protein 5 binding protein 1 product : heat shock 70kDa protein 5 binding protein 1 protein_id : NP_598565.2

name	Tmem109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527378 CCDS:CCDS29590.1 GeneID:68539 MGI:1915789
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 109 protein_id : NP_598903.1

name	Prpf19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527358 GeneID:28000 MGI:106247
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000151 - ubiquitin ligase complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0016567 - protein ubiquitination [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : PRP19/PSO4 homolog product : nuclear matrix protein SNEV protein_id : NP_598890.1

name	Zp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249092 GeneID:22786 MGI:103073
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007338 - fertilization (sensu Metazoa) [Evidence IEA] codon_start : 1 product : zona pellucida glycoprotein 1 protein_id : NP_033606.2

name	Gpr44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753528 CCDS:CCDS29592.1 GeneID:14764 MGI:1330275
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IDA] [Evidence ISS]; GO:0004982 - N-formyl peptide receptor activity [Evidence IEA]; GO:0004956 - prostaglandin D receptor activity [Evidence IDA]; GO:0004958 - prostaglandin F receptor activity [Evidence IDA]; GO:0001785 - prostaglandin J receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019722 - calcium-mediated signaling [Evidence IDA]; GO:0006935 - chemotaxis [Evidence IDA] [Evidence ISS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0007193 - G-protein signaling, adenylate cyclase inhibiting pathway [Evidence IDA]; GO:0045745 - positive regulation of G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : chemoattractant receptor-homologous molecule expressed on TH2 cells; prostaglandin D2 receptor CRTH2 product : G protein-coupled receptor 44 protein_id : NP_034092.1

name	Ccdc86 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38093630 CCDS:CCDS29593.1 GeneID:108673 MGI:1277220
definition	codon_start : 1 exception : mismatches in translation note : cyclon product : coiled-coil domain containing 86 protein_id : NP_076220.1

name	Ms4a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647224 GeneID:69826 MGI:1917076
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : membrane-spanning 4-domains, subfamily A, member 10 protein_id : NP_076018.2

name	E530011F12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702258 CCDS:CCDS29594.1 GeneID:545279 MGI:3617853
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC545279 protein_id : NP_001030070.1

name	5033428B15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38085783 GeneID:76002 MGI:1923252
definition	codon_start : 1 product : hypothetical protein LOC76002 protein_id : XP_129208.2

name	AW112010 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998257 GeneID:107350 MGI:2147706
definition	codon_start : 1 product : hypothetical protein LOC107350 protein_id : XP_893978.1

name	Ms4a8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953177 GeneID:64381 MGI:1927657
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MS4a8B protein product : membrane-spanning 4-domains, subfamily A, member 8A protein_id : NP_071875.2

name	Gm336 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20887521 GeneID:240539 MGI:2685182
definition	codon_start : 1 product : hypothetical protein protein_id : XP_140607.1

name	1700025F22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469001 GeneID:69416 MGI:1916666
definition	codon_start : 1 product : hypothetical protein LOC69416 protein_id : NP_081350.1

name	Ms4a13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793424 CCDS:CCDS29595.1 GeneID:73466 MGI:1920716
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 note : testis-expressed transmembrane 4 product : membrane-spanning 4-domains, subfamily A, member 13 protein_id : NP_937867.2

name	Ms4a12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270380 GeneID:381213 MGI:2685812
definition	codon_start : 1 product : similar to Membrane-spanning 4-domains, subfamily A, member 12 protein_id : XP_001474664.1

name	Ms4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671710 GeneID:12482 MGI:88321
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0042113 - B cell activation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : CD20 antigen; membrane-spanning 4-domains, subfamily A, member 2 product : membrane-spanning 4-domains, subfamily A, member 1 protein_id : NP_031667.1

name	Ms4a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147252 CCDS:CCDS29596.1 GeneID:269063 MGI:2670985
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : membrane-spanning 4-domains, subfamily A, member 5 protein_id : NP_899013.1

name	Gm1276 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998267 GeneID:383435 MGI:2686122
definition	codon_start : 1 product : similar to sperm protein SSP3111 protein_id : XP_357051.3

name	Ms4a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043948 CCDS:CCDS29597.1 GeneID:109225 MGI:1918846
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : membrane-spanning 4-domains, subfamily A, member 7 isoform b protein_id : NP_001020781.1

name	Ms4a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043882 CCDS:CCDS29598.1 GeneID:109225 MGI:1918846
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : membrane-spanning 4-domains, subfamily A, member 7 isoform a protein_id : NP_082112.3

name	Ms4a4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270382 GeneID:666907 MGI:3643932
definition	codon_start : 1 product : similar to MS4A4A protein protein_id : XP_992035.2

name	Ms4a4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386406 CCDS:CCDS29599.1 GeneID:64380 MGI:1927656
definition	codon_start : 1 note : membrane-spanning 4-domains, subfamily A, member 9 product : membrane-spanning 4-domains, subfamily A, member 4C protein_id : NP_083775.1

name	Ms4a4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11096338 CCDS:CCDS29600.1 GeneID:60361 MGI:1913083
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : lymphocyte antigen 116 product : membrane-spanning 4-domains, subfamily A, member 4B protein_id : NP_068364.1

name	Ms4a6c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430755 GeneID:73656 MGI:2385644
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : membrane-spanning 4-domains, subfamily A, member 6C protein_id : NP_082871.2

name	EG666926 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270385 GeneID:666926 MGI:3645380
definition	codon_start : 1 product : hypothetical protein protein_id : XP_992141.2

name	Ms4a6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982630 CCDS:CCDS29601.1 GeneID:69774 MGI:1917024
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : membrane-spanning 4-domains, subfamily A, member 6B protein_id : NP_081485.2

name	Ms4a4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754122 CCDS:CCDS29602.1 GeneID:66607 MGI:1913857
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : membrane-spanning 4-domains, subfamily A, member 4D protein_id : NP_079934.2

name	Ms4a6d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386172 CCDS:CCDS29603.1 GeneID:68774 MGI:1916024
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : membrane-spanning 4-domains, subfamily A, member 11 product : MS4A6D protein protein_id : NP_081111.1

name	Ms4a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305049 CCDS:CCDS29604.1 GeneID:14126 MGI:95495
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0045121 - lipid raft [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019863 - IgE binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 note : Fc receptor, IgE, high affinity I, beta polypeptide; membrane-spanning 4-domains, subfamily A, member 1 product : membrane-spanning 4-domains, subfamily A, member 2 protein_id : NP_038544.1

name	Ms4a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875420 CCDS:CCDS29605.1 GeneID:170813 MGI:2158468
definition	GO_component : GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : haematopoietic cell-specific transmembrane-4; membrane-spanning 4-domains subfamily A member 3 product : membrane-spanning 4-domains, subfamily A, member 3 protein_id : NP_573509.1

name	Plac1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701586 CCDS:CCDS29606.1 GeneID:225922 MGI:2684945
definition	codon_start : 1 note : transmembrane protein 122 product : placenta-specific 1-like protein_id : NP_001032723.1

name	Oosp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20373157 CCDS:CCDS29607.1 GeneID:170834 MGI:2149290
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] codon_start : 1 note : oocyte secretory protein 1 product : oocyte secreted protein 1 protein_id : NP_579931.1

name	Gm97 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185934 CCDS:CCDS29608.1 GeneID:225923 MGI:2684943
definition	codon_start : 1 product : hypothetical protein LOC225923 protein_id : NP_001028455.2

name	Gif (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982338 CCDS:CCDS29609.1 GeneID:14603 MGI:1202394
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0050897 - cobalt ion binding [Evidence IEA]; GO:0015087 - cobalt ion transporter activity [Evidence IEA] GO_process : GO:0006824 - cobalt ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : gastric intrinsic factor protein_id : NP_032144.2

name	Mrpl16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19424352 CCDS:CCDS29610.1 GeneID:94063 MGI:2137219
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IDA] GO_process : GO:0006412 - protein biosynthesis [Evidence IDA] codon_start : 1 note : mitochondiral ribosomal protein L16 product : mitochondrial ribosomal protein L16 protein_id : NP_079882.2

name	Stx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22726207 CCDS:CCDS29612.1 GeneID:20908 MGI:103077
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform C is encoded by transcript variant C; syntaxin 3A; syntaxin 3B product : syntaxin 3 isoform C protein_id : NP_035632.1

name	Stx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778802 CCDS:CCDS29611.1 GeneID:20908 MGI:103077
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform B is encoded by transcript variant B; syntaxin 3A; syntaxin 3B product : syntaxin 3 isoform B protein_id : NP_001020478.1

name	Stx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778911 CCDS:CCDS29613.1 GeneID:20908 MGI:103077
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform A is encoded by transcript variant A; syntaxin 3A; syntaxin 3B product : syntaxin 3 isoform A protein_id : NP_689344.1

name	Olfr1417 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129039 CCDS:CCDS29614.1 GeneID:258938 MGI:3031251
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2172809-2171862; olfactory receptor MOR266-2 product : olfactory receptor 1417 protein_id : NP_667147.1

name	Olfr1418 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372130 CCDS:CCDS29615.1 GeneID:258227 MGI:3031252
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2207258-2206302; olfactory receptor MOR266-5 product : olfactory receptor 1418 protein_id : NP_001011524.1

name	Olfr1419 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801326 CCDS:CCDS29616.1 GeneID:257938 MGI:3031253
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2222521-2221490; olfactory receptor MOR266-10 product : olfactory receptor 1419 protein_id : NP_001011775.1

name	EG622845 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270397 GeneID:622845 MGI:3643502
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476676.1

name	EG622845 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270395 GeneID:622845 MGI:3643502
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476658.1

name	Olfr1420 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238900 CCDS:CCDS29617.1 GeneID:258405 MGI:3031254
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2247227-2248156; olfactory receptor MOR266-4 product : olfactory receptor 1420 protein_id : NP_666522.1

name	AV312086 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369916 GeneID:225929 MGI:2147679
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC225929 protein_id : NP_766223.1

name	Osbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133504509 GeneID:76303 MGI:97447
definition	GO_function : GO:0008142 - oxysterol binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : oxysterol binding protein protein_id : NP_001028346.1

name	Olfr1423 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239022 CCDS:CCDS29618.1 GeneID:258675 MGI:3031257
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2393361-2392429; olfactory receptor MOR239-3 product : olfactory receptor 1423 protein_id : NP_666891.1

name	Olfr1424 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239020 CCDS:CCDS29619.1 GeneID:258676 MGI:3031258
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2418550-2417609; olfactory receptor MOR239-2 product : olfactory receptor 1424 protein_id : NP_666892.1

name	Olfr1425 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801464 GeneID:258155 MGI:3031259
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2433425-2432490; olfactory receptor MOR239-7 product : olfactory receptor 1425 protein_id : NP_001011853.1

name	Olfr1426 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129241 CCDS:CCDS29620.1 GeneID:258805 MGI:3031260
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2447610-2446675; olfactory receptor MOR239-1 product : olfactory receptor 1426 protein_id : NP_667020.1

name	Olfr1427 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239016 CCDS:CCDS29621.1 GeneID:258674 MGI:3031261
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2458473-2457538; olfactory receptor MOR239-4 product : olfactory receptor 1427 protein_id : NP_666890.1

name	Olfr1428 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239018 CCDS:CCDS29622.1 GeneID:258673 MGI:3031262
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RE5P-2468394-2467450; olfactory receptor MOR239-5 product : olfactory receptor 1428 protein_id : NP_666889.1

name	Olfr76 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239080 CCDS:CCDS29623.1 GeneID:258677 MGI:2153205
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS] [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS] [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2479601-2478648 product : olfactory receptor 76 protein_id : NP_666893.1

name	Olfr1431 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239082 CCDS:CCDS29624.1 GeneID:258409 MGI:3031265
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2573738-2574676; olfactory receptor MOR214-5 product : olfactory receptor 1431 protein_id : NP_666526.1

name	Olfr262 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239090 CCDS:CCDS29625.1 GeneID:258683 MGI:3030096
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2N4A9-18144-19082; olfactory receptor MOR214-1 product : olfactory receptor 262 protein_id : NP_666899.1

name	Olfr232 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239086 CCDS:CCDS29626.1 GeneID:258681 MGI:3030066
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T03CT6-1-477 product : olfactory receptor 232 protein_id : NP_666897.1

name	Olfr1433 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239088 GeneID:258680 MGI:3031267
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RE5P-2610001-2610414 product : olfactory receptor 1433 protein_id : NP_666896.1

name	Olfr1436 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239092 CCDS:CCDS29627.1 GeneID:258682 MGI:3031270
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RE5P-2634596-2633658; olfactory receptor MOR214-2 product : olfactory receptor 1436 protein_id : NP_666898.1

name	Olfr1437 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801438 CCDS:CCDS29628.1 GeneID:258117 MGI:3031271
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2658227-2657289; olfactory receptor MOR214-6 product : olfactory receptor 1437 protein_id : NP_001011839.1

name	Olfr1440 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239084 CCDS:CCDS29629.1 GeneID:258679 MGI:3031274
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2725206-2726153; olfactory receptor MOR215-1 product : olfactory receptor 1440 protein_id : NP_666895.1

name	Olfr1441 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239078 CCDS:CCDS29630.1 GeneID:258678 MGI:3031275
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2753221-2754177; olfactory receptor MOR215-2 product : olfactory receptor 1441 protein_id : NP_666894.1

name	Pfpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506577 GeneID:56093 MGI:1860266
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : ectoplacental cone, invasive trophoblast giant cells, extraembryonic ectoderm and chorion sequence 50 product : pore forming protein-like protein_id : NP_062413.1

name	Mpeg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133506753 GeneID:17476 MGI:1333743
definition	codon_start : 1 product : macrophage expressed gene 1 protein_id : NP_034951.1

name	Dtx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254207 CCDS:CCDS29631.1 GeneID:207521 MGI:2672905
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : deltex 4 homolog protein_id : NP_766030.2

name	EG625046 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270391 GeneID:625046 MGI:3643874
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894682.2

name	LOC435588 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435588
definition	number : 2 pseudo : _no_value

name	LOC435588 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435588
definition	number : 1 pseudo : _no_value

name	LOC100040454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040454
definition	number : 1 pseudo : _no_value

name	LOC100040454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040454
definition	number : 2 pseudo : _no_value

name	LOC100040454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040454
definition	number : 3 pseudo : _no_value

name	EG666958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666958
definition	number : 1 pseudo : _no_value

name	EG666958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666958
definition	number : 2 pseudo : _no_value

name	EG666958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666958
definition	number : 3 pseudo : _no_value

name	EG666985 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666985
definition	number : 1 pseudo : _no_value

name	EG666985 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666985
definition	number : 2 pseudo : _no_value

name	LOC433221 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270383 GeneID:433221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 55 ESTs, 24 Proteins product : similar to heat shock protein 86 pseudo : _no_value transcript_id : XR_031867.1

clone name	MSMg01-177J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127I11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-347L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-543N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-046F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-492G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372H09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-391H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097J16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-503J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334P01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-171J09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386O24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-350J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450H14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-501A03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-421O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523N08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-432P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372I05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-494K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457J14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-330L15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-053D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233E05
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-211H04.b	B6Ng01-211H04.g
ACC	GA029513	GA029514
length	1,000	1,140
definition	B6Ng01-211H04.b	B6Ng01-211H04.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcattggcatagaaaaagacttttaaacagaaccctgttagcatga cactaagattaaaaaaaaaaaaaaagatgggagctcacgaaactgagatg cttttgcaaaccaaagagcaccatcattgcaacagcctacagagtgggag aagatttttacaaactacacatctggtagaggactaatatccaaaatata tgaagaactcaaaaaactagatattgaggaaacaaataactcagtcaaaa actggagtaaagatataaacagtgaattctcaaaagaggaaactcaagtg gctgaaaaacagttaaagcaatgttcaaaatttttttaattgggtattta tttcatttacatttccaatgctatcccaaaagtcccccacaccctccccc acccactcccacttcttggccctggcattcccctgtactgaggcatataa agtttgcatgaccaatgggcctctctttccactgatggccaactaggcca tcttctgattcatatgcagctagagacatgagttccaggggggtattggt tagttcatattgttgttccacctataggattgcagatcccttcagctcct tgggtactttctctagctcctccattgggggccgtgtgacccatccaata gctgactgtgagcatccacttctgtgtttgccaggccccggcataatctc aaaagagacaactatatcagggtccttttagcaaaatcttgctagtgtat gcaatagtatcagcgtttggaagctgattatgggatggatccctggatat ggcagtctctagatggtccatcctttcgtctcagctccaaactttgtctc tgtaactccttccatgggtgttttgttcccaattctaagaatgggcaaag tgtccacactttggtcttcgttcttcttgagtttcatgcgtttagcaaat tgtatcttatatcttgggtattctaagtttctcggctaatatccacttat	gaattctacacttggaagtaaattagagatcaaagttgtacaatgaatgt cagagttagttacgttatttgctcagtgcttgtcttactagaacacacac atgagcagaaaatatagcagctagagaaaacaggaaagaaaactaaccat tattatagtggctgataaatgcatcatgagcaaaaacatgtaacaataac aacacccccacaatacatatttctttggaaatatttagttttaattatgc atataagtgtgtgactttgtgcaggtatgtgctattggagtccagaagag ggtctcagacacttcctgcctctacacttgagctggagttacaggcaatt gtgagcattctgatgagtagtgttgggactcaggtcctctgtatgagtca tttgcattcttaattgcaggaccatctatccagcccatgttaagttgcta aagaatagaaaaaggatttcaaagttataaaatgttaccatctctttagc aacttaacatttggctttagcttttcttttacaaaattttgattacattt ttcaaaaacaaacaaacaaaaagaatgttaaaaagagagggggataggct actccagtcttatcctatgagcttagtgttctgatacagaaacatcggat gaaattagagctatagtgcccctcaacagaggaatggatacagaaaatgt ggtacatctacacaatggagtactactcagctattaaaaagaatgaattt atgaaattcctagccaaatggatggacctggagggcatcatcctgagtga ggtaacacattcacaaaggaactcacacaatatgtactcactgataagtg gatattagcccaaaacctaggatacccaagatataagatataatttccta aacacatgaaactcaagaaaaatgaagactgaagtgtggacactataccc ctcccttagaagtgggaacaaaaacacccttggaaaggagttacagagaa caaagtttggagctgagatgaaaagatggaccatgtagagactactatcc aggatccaccccataatcagcatcaaacgctgacacattgcatacactag cagattttatcgaagaccagaatgtagctgtctcttgtga
quality values	Open. Hide. 62 41 50 37 62 39 24 47 62 62 49 54 56 62 59 62 59 62 62 62 62 62 59 39 62 62 62 59 62 62 62 49 39 34 34 31 48 34 34 48 62 62 54 62 62 62 62 62 62 59 62 62 59 59 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 56 43 42 54 62 62 62 54 56 56 54 59 51 62 59 62 62 62 62 62 62 54 30 32 54 62 59 49 54 62 62 62 62 62 54 62 62 62 62 59 62 56 62 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 59 59 59 62 62 49 42 46 54 54 48 54 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 51 62 54 49 54 62 62 62 59 54 54 62 54 59 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 50 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 59 56 34 54 59 62 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 52 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 49 54 58 58 35 58 58 58 58 58 54 54 58 54 42 58 58 58 54 52 58 58 49 58 58 58 58 58 50 51 58 58 53 58 58 47 58 58 49 51 51 48 54 58 58 52 54 54 54 51 51 58 58 58 58 51 53 51 50 54 48 58 58 58 58 51 41 58 54 50 58 49 58 31 31 58 58 52 51 48 28 30 58 49 51 48 58 58 58 58 39 51 58 41 46 58 41 58 50 52 53 51 35 51 58 54 52 53 58 53 53 53 58 51 41 32 41 41 29 35 28 58 58 58 41 54 41 42 53 35 40 49 52 49 40 32 32 54 54 42 54 30 38 50 40 51 47 47 37 54 42 53 42 40 22 49 32 35 40 44 37 42 49 51 42 40 42 45 54 54 40 38 52 53 44 37 31 34 37 40 37 53 37 40 37 47 37 29 39 42 43 34 33 40 37 45 43 39 53 40 52 46 40 40 32 52 47 17 34 52 36 45 31 32 32 29 36 49 46 31 24 36 30 25 26 31 53 33 31 52 16 30 28 32 37 26 41 25 31 29 31 41 31 30 31 36 31 30 21 30 51 18 31 30 24 33 26 37 30 47 28 31 30 29 31 30 31 36 23 31 31 25 42 29 48 31 31 32 46 33 31 26 31 30 31 25 33 31 35 21 30 37 32 37 25 37 22 46 31 29 42 46 46 21 38 26 46 46 32 33 26 31 28 39 33 11 24 31 32 30 27 25 35 13 29 8 5 20 47 19 23 29 46 41 31 25 39 22 32 37 29 31 29 36 41 46 28 39 32 30 36 21 22 33 17 21 19 36 19 26 29 11 31 31 32 18 31 44 33 31 30 28 42 31 31 38 44 18 26 28 28 24 44 25 27 15 26 13 27 31 24 32 9 14 9 14 26 32 21 11 14 37 31 23 22 17 20 24 23 18 25 31 33 39 27 23 22 31 21 31 20 29 25 34 27 31 31 30 19 25 22 18 13 30 28	Open. Hide. 62 47 56 44 62 62 62 51 59 34 43 11 10 13 10 7 10 13 18 19 23 34 28 34 38 28 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 54 54 62 62 34 26 24 23 34 34 24 38 28 34 32 34 48 62 62 62 62 54 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 46 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 54 53 58 58 58 58 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 58 54 30 49 42 58 54 58 58 58 58 58 58 53 58 51 58 58 58 58 51 39 58 58 58 54 58 58 58 58 58 35 39 58 58 58 58 49 48 51 58 58 51 53 58 58 58 40 58 58 50 58 53 58 58 46 58 53 58 58 58 42 52 51 53 51 58 58 50 49 50 51 54 51 47 46 36 58 58 58 53 39 51 53 50 58 50 54 51 50 51 52 53 58 58 49 43 31 31 44 53 35 35 50 49 49 32 24 54 51 44 35 54 51 37 35 49 51 53 53 54 49 49 46 33 54 41 54 46 42 53 42 53 53 53 34 40 53 38 52 46 54 36 54 42 38 27 52 46 33 53 45 47 54 45 42 40 51 53 39 39 34 45 54 54 54 51 39 53 32 29 51 47 32 34 53 52 32 32 32 52 49 26 19 46 34 53 32 45 31 31 40 23 52 47 32 51 46 32 31 46 44 39 26 33 29 38 36 29 17 47 32 25 32 43 36 38 36 37 44 31 45 33 21 31 40 38 19 46 21 30 40 30 31 45 29 51 43 38 25 33 28 48 26 21 34 31 31 30 41 36 31 37 27 30 24 32 30 31 33 43 27 27 31 35 31 29 31 30 43 33 26 27 35 32 25 37 38 26 23 25 25 31 31 23 31 46 27 24 46 46 30 17 29 27 31 18 31 26 18 26 23 46 29 16 31 33 37 18 25 25 19 28 18 37 19 27 18 13 32 37 48 31 35 38 27 21 44 25 17 18 21 18 31 33 38 44 29 18 31 32 25 24 13 44 44 44 43 27 26 32 31 24 13 11 15 23 24 26 25 21 27 28 6 5 23 4 10 18 32 31 18 16 24 32 39 37 23 11 11 36 9 29 19 20 9 20 33 16 8 9 43 16 28 20 31 11 43 37 31 7 12 22 21 31 22 12 10 11 18 8 38 17 7 21 14 13 23 13 8 26 11 14 14 10 20 13 10 14 38 24 19 25 47 18 12 5 9 5 21 16 10 21 6 19 23 16 10 40 38 7 11 4 15 13 19 8 8 18 22 16 14 7 13 13 28 16 14 18 26 10 3 4 3 16 10 19 20 21 19 9 18 18 18 7 11 25 20 23 16 15 13 22 11 16 20 20 21 16 13 21 14 28 8 11 9 13 20 10 7 7 3 3 3 8 11 14 8 5 6 5 8 5 11 12 21 6 21 23 12 21 15 30 30 24 13 18 15 4 12 3 4 2 6 13 5 5 5 25 5 7 17 7 5 18 7 5 3 5 6 10 5 7 6 6 7 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_11650625_11651768
seq2: B6Ng01-211H04.g_70_1209

seq1  GAATTCTACACTTGGAAGTAAATTAGAGATCAAAGTTGTACAATGAATGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTACACTTGGAAGTAAATTAGAGATCAAAGTTGTACAATGAATGT  50

seq1  CAGAGTTAGTTACGTTATTTGCTCAGTGCTTGTCTTACTAGAACACACAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGTTAGTTACGTTATTTGCTCAGTGCTTGTCTTACTAGAACACACAC  100

seq1  ATGAGCAGAAAATATAGCAGCTAGAGAAAACAGGAAAGAAAACTAACCAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGCAGAAAATATAGCAGCTAGAGAAAACAGGAAAGAAAACTAACCAT  150

seq1  TATTATAGTGGCTGATAAATGCATCATGAGCAAAAACATGTAACAATAAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTATAGTGGCTGATAAATGCATCATGAGCAAAAACATGTAACAATAAC  200

seq1  AACACCCCCACAATACATATTTCTTTGGAAATATTTAGTTTTAATTATGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACCCCCACAATACATATTTCTTTGGAAATATTTAGTTTTAATTATGC  250

seq1  ATATAAGTGTGTGACTTTGTGCAGGTATGTGCTATTGGAGTCCAGAAGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAAGTGTGTGACTTTGTGCAGGTATGTGCTATTGGAGTCCAGAAGAG  300

seq1  GGTCTCAGACACTTCCTGCCTCTACACTTGAGCTGGAGTTACAGGCAATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTCAGACACTTCCTGCCTCTACACTTGAGCTGGAGTTACAGGCAATT  350

seq1  GTGAGCATTCTGATGAGTAGTGTTGGGACTCAGGTCCTCTGTATGAGTCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGCATTCTGATGAGTAGTGTTGGGACTCAGGTCCTCTGTATGAGTCA  400

seq1  TTTGCATTCTTAATTGCAGGACCATCTATCCAGCCCATGTTAAGTTGCTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCATTCTTAATTGCAGGACCATCTATCCAGCCCATGTTAAGTTGCTA  450

seq1  AAGAATAGAAAAAGGATTTCAAAGTTATAAAATGTTACCATCTCTTTAGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAATAGAAAAAGGATTTCAAAGTTATAAAATGTTACCATCTCTTTAGC  500

seq1  AACTTAACATTTGGCTTTAGCTTTTCTTTTACAAAATTTTGATTACATTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTAACATTTGGCTTTAGCTTTTCTTTTACAAAATTTTGATTACATTT  550

seq1  TTCAAAAACAAACAAACAAAAAGAATGTTAAAAAGAGAGGGGGATAGGCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAAAAACAAACAAACAAAAAGAATGTTAAAAAGAGAGGGGGATAGGCT  600

seq1  ACTCCAGTCTTATCCTATGAGCTTAGTGTTCTGATACAGAAACATCGGAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCCAGTCTTATCCTATGAGCTTAGTGTTCTGATACAGAAACATCGGAT  650

seq1  GAAATTAGAGCTATAGTGCCCCTCAACAGAGGAATGGATACAGAAAATGT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATTAGAGCTATAGTGCCCCTCAACAGAGGAATGGATACAGAAAATGT  700

seq1  GGTACATCTACACAATGGAGTACTACTCAGCTATTAAAAAGAATGAATTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTACATCTACACAATGGAGTACTACTCAGCTATTAAAAAGAATGAATTT  750

seq1  ATGAAATTCCTAGCCAAATGGATGGACCTGGAGGGCATCATCCTGAGTGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAATTCCTAGCCAAATGGATGGACCTGGAGGGCATCATCCTGAGTGA  800

seq1  GGTAACACATTCACAAAGGAACTCACACAATATGTACTCACTGATAAGTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAACACATTCACAAAGGAACTCACACAATATGTACTCACTGATAAGTG  850

seq1  GATATTAGCCCAAAACCTAGGATACCCAAGATATAAGATATAATTTCCTA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATATTAGCCCAAAACCTAGGATACCCAAGATATAAGATATAATTTCCTA  900

seq1  AACACATGAAACTCAAGAAAAATGAAGACTGAAGTGTGGACACTATACCC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACATGAAACTCAAGAAAAATGAAGACTGAAGTGTGGACACTATACCC  950

seq1  CT-CCTTAGAAGTGGGAAC-AAAACACCCTTGG-AAGGAGTTACAGAG-A  996
      || |||||||||||||||| ||||||||||||| |||||||||||||| |
seq2  CTCCCTTAGAAGTGGGAACAAAAACACCCTTGGAAAGGAGTTACAGAGAA  1000

seq1  CAAAGTTTGGAGCTGAGATGAAAGGATGGACCATGTAGAGACTACCTTAT  1046
      ||||||||||||||||||||||| |||||||||||||||||||||  |||
seq2  CAAAGTTTGGAGCTGAGATGAAAAGATGGACCATGTAGAGACTAC--TAT  1048

seq1  CCAGGGATCCACCCCATAATCAGCATCCAAACGCTGACACCATTGCATAC  1096
      ||| |||||||||||||||||||||| |||||||||||| ||||||||||
seq2  CCA-GGATCCACCCCATAATCAGCAT-CAAACGCTGACA-CATTGCATAC  1095

seq1  ACTAGCAAGATTTTATCGAAAGGACCCAGATGTAGCTGTCTCTTGTGA  1144
      |||||| |||||||||||||  ||||   |||||||||||||||||||
seq2  ACTAGC-AGATTTTATCGAA--GACCAGAATGTAGCTGTCTCTTGTGA  1140

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information