MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-218O23
Chromosome	19 (Build37)
Map Location	42,762,972 - 42,943,858
singlet/doublet	doublet
Overlap gene	4833409A17Rik, Hps1, LOC545291
Upstream gene	Slit1, Arhgap19, Frat1, Frat2, Rrp12, LOC100042609, Pgam1, Exosc1, Zdhhc16, Mms19l, Ubtd1, Ankrd2, 0610010D20Rik, 4933411K16Rik, BC023055, Pi4k2a, Avpi1, Marveld1, EG628994, LOC100042633, Zfyve27, Sfrp5, 4933417O08Rik, Crtac1, D19Ertd386e, Loxl4
Downstream gene	EG627624, Cnnm1, Got1, Nkx2-3, LOC100042700, LOC100043245, Slc25a28, Entpd7, Cox15, Cutc, Abcc2, Dnmbp
Link	Open Mouse BAC browser

Click to get alignment info.

name	Slit1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20562 MGI:1315203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71085 MGI:1918335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14296 MGI:109450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212398 MGI:2673967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rrp12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107094 MGI:2147437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042609 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042609
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Pgam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18648 MGI:97552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exosc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66583 MGI:1913833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74168 MGI:1921418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mms19l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72199 MGI:1919449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubtd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226122 MGI:2385092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56642 MGI:1861447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610010D20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67432 MGI:1914682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933411K16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66765 MGI:1914015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 ESTs, 2 Proteins

name	BC023055 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226123 MGI:2449568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pi4k2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84095 MGI:1934031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Avpi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69534 MGI:1916784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Marveld1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277010 MGI:2147570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 45 ESTs, 2 Proteins

name	EG628994 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628994 MGI:3647230
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042633 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042633
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Zfyve27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319740 MGI:1919602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54612 MGI:1860298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933417O08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71146 MGI:1918396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crtac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72832 MGI:1920082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D19Ertd386e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52013 MGI:1196316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Loxl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67573 MGI:1914823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4833409A17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74580 MGI:1921830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192236 MGI:2177763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627624 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627624 MGI:3647201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 68 ESTs, 3 Proteins

name	Cnnm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83674 MGI:1891366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Got1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14718 MGI:95791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkx2-3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18089 MGI:97348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043245 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Slc25a28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246696 MGI:2180509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Entpd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93685 MGI:2135885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226139 MGI:1920112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cutc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66388 MGI:1913638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12780 MGI:1352447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnmbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71972 MGI:1917352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slit1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801919 GeneID:20562 MGI:1315203
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : slit homolog 1 (Drosophila) transcript_id : NM_015748.2

name	Arhgap19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803334 GeneID:71085 MGI:1918335
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 19 transcript_id : NM_027667.2

name	Frat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37059811 GeneID:14296 MGI:109450
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : frequently rearranged in advanced T-cell lymphomas transcript_id : NM_008043.2

name	Frat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802346 GeneID:212398 MGI:2673967
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : frequently rearranged in advanced T-cell lymphomas 2 transcript_id : NM_177603.2

name	Rrp12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40804766 GeneID:107094 MGI:2147437
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal RNA processing 12 homolog (S. cerevisiae) transcript_id : NM_199447.2

name	Pgam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326545 GeneID:18648 MGI:97552
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoglycerate mutase 1 transcript_id : NM_023418.2

name	Exosc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981244 GeneID:66583 MGI:1913833
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 1 transcript_id : NM_025644.3

name	Zdhhc16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963806 GeneID:74168 MGI:1921418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 16 transcript_id : NM_023740.1

name	Mms19l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892783 GeneID:72199 MGI:1919449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MMS19 (MET18 S. cerevisiae)-like transcript_id : NM_028152.3

name	Ubtd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893218 GeneID:226122 MGI:2385092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin domain containing 1 transcript_id : NM_145500.3

name	Ankrd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910129 GeneID:56642 MGI:1861447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 2 (stretch responsive muscle) transcript_id : NM_020033.1

name	0610010D20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385655 GeneID:67432 MGI:1914682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610010D20 gene transcript_id : NM_026152.1

name	4933411K16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405931 GeneID:66765 MGI:1914015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 ESTs, 2 Proteins product : RIKEN cDNA 4933411K16 gene transcript_id : XM_894441.2

name	BC023055 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674221 GeneID:226123 MGI:2449568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC023055 transcript_id : NM_198108.1

name	Pi4k2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262158 GeneID:84095 MGI:1934031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 4-kinase type 2 alpha transcript_id : NM_145501.2

name	Avpi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802580 GeneID:69534 MGI:1916784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginine vasopressin-induced 1 transcript_id : NM_027106.2

name	EG628994 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406013 GeneID:628994 MGI:3647230
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG628994 transcript_id : XM_915567.2

name	LOC100042633 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270479 GeneID:100042633
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042633 transcript_id : XM_001478549.1

name	Zfyve27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341138 GeneID:319740 MGI:1919602
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, FYVE domain containing 27 transcript_id : NM_177319.2

name	Sfrp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560420 GeneID:54612 MGI:1860298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secreted frizzled-related sequence protein 5 transcript_id : NM_018780.2

name	4933417O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037238 GeneID:71146 MGI:1918396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933417O08 gene transcript_id : NM_027694.1

name	Crtac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350981 GeneID:72832 MGI:1920082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cartilage acidic protein 1 transcript_id : NM_145123.4

name	D19Ertd386e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803500 GeneID:52013 MGI:1196316
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 19, ERATO Doi 386, expressed transcript_id : NM_177464.3

name	Loxl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48976072 GeneID:67573 MGI:1914823
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysyl oxidase-like 4 transcript_id : NM_053083.2

name	4833409A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125858597 GeneID:74580 MGI:1921830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833409A17 gene transcript_id : NM_029011.2

name	Hps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722683 GeneID:192236 MGI:2177763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Hermansky-Pudlak syndrome 1 homolog (human) transcript_id : NM_019424.2

name	LOC545291 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:124486930 GeneID:545291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : similar to Heparanase-2 (Hpa2) transcript_id : NM_001081257.1

name	EG627624 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270554 GeneID:627624 MGI:3647201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 68 ESTs, 3 Proteins product : predicted gene, EG627624 transcript_id : XM_894499.3

name	Cnnm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878234 GeneID:83674 MGI:1891366
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin M1 transcript_id : NM_031396.1

name	Got1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754033 GeneID:14718 MGI:95791
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate oxaloacetate transaminase 1, soluble transcript_id : NM_010324.1

name	Nkx2-3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49274620 GeneID:18089 MGI:97348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NK2 transcription factor related, locus 3 (Drosophila) transcript_id : NM_008699.2

name	LOC100043245 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270555 GeneID:100043245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043245 transcript_id : XM_001480053.1

name	Slc25a28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553114 GeneID:246696 MGI:2180509
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 28 transcript_id : NM_145156.1

name	Entpd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380877 GeneID:93685 MGI:2135885
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 7 transcript_id : NM_053103.4

name	Cox15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384028 GeneID:226139 MGI:1920112
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COX15 homolog, cytochrome c oxidase assembly protein (yeast) transcript_id : NM_144874.3

name	Cutc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379763 GeneID:66388 MGI:1913638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cutC copper transporter homolog (E.coli) transcript_id : NM_025530.2

name	Abcc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063565 GeneID:12780 MGI:1352447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 2 transcript_id : NM_013806.2

name	Dnmbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130402 GeneID:71972 MGI:1917352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynamin binding protein transcript_id : NM_028029.2

name	Slit1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:35215323 CCDS:CCDS29812.1 GeneID:20562 MGI:1315203
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005102 - receptor binding [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007411 - axon guidance [Evidence IDA] [Evidence IGI]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0040023 - establishment of nucleus localization [Evidence IDA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 exception : mismatches in translation function : axon guidance molecule product : slit homolog 1 protein_id : NP_056563.1

name	Arhgap19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037233 GeneID:71085 MGI:1918335
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Rho GTPase activating protein 19 protein_id : NP_081943.1

name	Frat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37059812 GeneID:14296 MGI:109450
definition	GO_process : GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : GSK-3 binding protein FRAT1 protein_id : NP_032069.2

name	Frat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243970 CCDS:CCDS29813.1 GeneID:212398 MGI:2673967
definition	GO_process : GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : frequently rearranged in advanced T-cell lymphomas 2 protein_id : NP_808271.1

name	Rrp12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789092 CCDS:CCDS29814.1 GeneID:107094 MGI:2147437
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : ribosomal RNA processing 12 homolog protein_id : NP_955518.1

name	Pgam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326546 CCDS:CCDS29815.1 GeneID:18648 MGI:97552
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016868 - intramolecular transferase activity, phosphotransferases [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0004619 - phosphoglycerate mutase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : phosphoglycerate mutase 1 protein_id : NP_075907.2

name	Exosc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22267446 CCDS:CCDS29816.1 GeneID:66583 MGI:1913833
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence ISS]; GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 product : exosome component 1 protein_id : NP_079920.1

name	Zdhhc16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963807 CCDS:CCDS29817.1 GeneID:74168 MGI:1921418
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Abl-philin 2 protein_id : NP_076229.1

name	Mms19l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15100156 CCDS:CCDS29818.1 GeneID:72199 MGI:1919449
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : MMS19 (MET18 S. cerevisiae)-like protein_id : NP_082428.1

name	Ubtd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703984 CCDS:CCDS29819.1 GeneID:226122 MGI:2385092
definition	GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : ubiquitin domain containing 1 protein_id : NP_663475.1

name	Ankrd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910130 GeneID:56642 MGI:1861447
definition	GO_component : GO:0030017 - sarcomere [Evidence IDA] codon_start : 1 product : ankyrin repeat domain 2 protein_id : NP_064417.1

name	0610010D20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385656 CCDS:CCDS29820.1 GeneID:67432 MGI:1914682
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67432 protein_id : NP_080428.1

name	4933411K16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998549 GeneID:66765 MGI:1914015
definition	codon_start : 1 product : hypothetical protein LOC66765 protein_id : XP_899534.1

name	BC023055 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674222 GeneID:226123 MGI:2449568
definition	codon_start : 1 product : hypothetical protein LOC226123 protein_id : NP_932776.1

name	Pi4k2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703986 CCDS:CCDS29821.1 GeneID:84095 MGI:1934031
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : phosphatidylinositol 4-kinase type II-like product : phosphatidylinositol 4-kinase type 2 alpha protein_id : NP_663476.1

name	Avpi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526465 CCDS:CCDS29822.1 GeneID:69534 MGI:1916784
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA] codon_start : 1 product : Esau protein protein_id : NP_081382.1

name	EG628994 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999391 GeneID:628994 MGI:3647230
definition	codon_start : 1 product : similar to EG628994 protein protein_id : XP_920660.1

name	LOC100042633 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270480 GeneID:100042633
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478599.1

name	Zfyve27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893433 CCDS:CCDS29825.1 GeneID:319740 MGI:1919602
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : zinc finger, FYVE domain containing 27 protein_id : NP_796293.1

name	Sfrp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560421 CCDS:CCDS29826.1 GeneID:54612 MGI:1860298
definition	GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : secreted frizzled-related protein 5 product : secreted frizzled-related sequence protein 5 protein_id : NP_061250.2

name	4933417O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037239 CCDS:CCDS29827.1 GeneID:71146 MGI:1918396
definition	codon_start : 1 product : hypothetical protein LOC71146 protein_id : NP_081970.1

name	Crtac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626040 CCDS:CCDS29828.1 GeneID:72832 MGI:1920082
definition	codon_start : 1 product : cartilage acidic protein 1 protein_id : NP_660105.3

name	D19Ertd386e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29126193 CCDS:CCDS29829.1 GeneID:52013 MGI:1196316
definition	codon_start : 1 product : growth inhibition and differentiation related protein 86 protein_id : NP_803415.1

name	Loxl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48976073 CCDS:CCDS29830.1 GeneID:67573 MGI:1914823
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004720 - protein-lysine 6-oxidase activity [Evidence IDA]; GO:0005044 - scavenger receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ysyl oxidase-like 4 product : lysyl oxidase-like 4 protein_id : NP_444313.2

name	4833409A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125858598 GeneID:74580 MGI:1921830
definition	GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016705 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen [Evidence IEA] GO_process : GO:0016117 - carotenoid biosynthesis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74580 protein_id : NP_083287.2

name	Hps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506573 GeneID:192236 MGI:2177763
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence ISS] GO_process : GO:0030318 - melanocyte differentiation [Evidence IMP]; GO:0006996 - organelle organization and biogenesis [Evidence IMP] codon_start : 1 note : Hermansky-Pudlak syndrome protein homolog product : pale ear protein_id : NP_062297.1

name	LOC545291 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:124486931 GeneID:545291
definition	codon_start : 1 product : similar to Heparanase-2 (Hpa2) protein_id : NP_001074726.1

name	EG627624 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998566 GeneID:627624 MGI:3647201
definition	codon_start : 1 product : similar to leucine zipper transcription factor-like 1 protein_id : XP_899592.1

name	Cnnm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878235 GeneID:83674 MGI:1891366
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : ancient conserved domain protein 1; cyclin-like protein 1 product : cyclin M1 protein_id : NP_113573.1

name	Got1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754034 CCDS:CCDS29832.1 GeneID:14718 MGI:95791
definition	GO_function : GO:0004069 - aspartate transaminase activity [Evidence IDA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytosolic aspartate aminotransferase product : glutamate oxaloacetate transaminase 1, soluble protein_id : NP_034454.1

name	Nkx2-3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46849702 CCDS:CCDS29833.1 GeneID:18089 MGI:97348
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030183 - B cell differentiation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0006955 - immune response [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Drosophila NK2 transcription factor related, locus 3 product : NK2 transcription factor related, locus 3 protein_id : NP_032725.1

name	LOC100043245 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270556 GeneID:100043245
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480103.1

name	Slc25a28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553115 CCDS:CCDS29834.1 GeneID:246696 MGI:2180509
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : putative mitochondrial solute carrier product : solute carrier family 25, member 28 protein_id : NP_660138.1

name	Entpd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82617566 CCDS:CCDS29835.1 GeneID:93685 MGI:2135885
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence ISS]; GO:0017111 - nucleoside-triphosphatase activity [Evidence ISS] GO_process : GO:0009191 - ribonucleoside diphosphate catabolism [Evidence ISS]; GO:0009203 - ribonucleoside triphosphate catabolism [Evidence ISS] codon_start : 1 note : lysosomal apyrase-like 2 product : ectonucleoside triphosphate diphosphohydrolase 7 protein_id : NP_444333.3

name	Cox15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541932 CCDS:CCDS29836.1 GeneID:226139 MGI:1920112
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] codon_start : 1 product : COX15 homolog, cytochrome c oxidase assembly protein protein_id : NP_659123.2

name	Cutc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384952 CCDS:CCDS29837.1 GeneID:66388 MGI:1913638
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : cutC copper transporter homolog protein_id : NP_079806.1

name	Abcc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063566 CCDS:CCDS29838.1 GeneID:12780 MGI:1352447
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0046581 - intercellular canaliculus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : multidrug resistance protein 2; canalicular multispecific organic anion transporter product : ATP-binding cassette, sub-family C, member 2 protein_id : NP_038834.2

name	Dnmbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:36796741 CCDS:CCDS29839.1 GeneID:71972 MGI:1917352
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : dynamin binding protein protein_id : NP_082305.1

name	LOC100042609 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042609
definition	number : 1 pseudo : _no_value

name	LOC100042609 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042609
definition	number : 2 pseudo : _no_value

name	LOC100042609 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042609
definition	number : 3 pseudo : _no_value

name	LOC100042700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042700
definition	number : 2 pseudo : _no_value

name	LOC100042700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042700
definition	number : 1 pseudo : _no_value

name	Marveld1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270553 GeneID:277010 MGI:2147570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 45 ESTs, 2 Proteins product : MARVEL (membrane-associating) domain containing 1 transcript_id : XR_035422.1

clone name	MSMg01-488N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460F13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061C22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-482H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135K17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-218O23.b	B6Ng01-218O23.g
ACC	GA034927	GA034928
length	1,139	892
definition	B6Ng01-218O23.b	B6Ng01-218O23.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(42,762,972 - 42,764,125)	(42,942,969 - 42,943,858)
sequence	gaattctctctcctcctggatgtcccacctcccattccctgcctaagcca taggccaaaggctttttaattgacaagagatgcatccatataacacacaa gacagtatacacaagatagcctctatacatgcctatcaaacatctctcag ggagtgacaggggccggcagtcatctctggggtcttgcccagtgctctag tctggacctttagcttcctggggtttctaactgtgcattttgagcattct gacacccccatgtgccatagtatgctggcatatgtgactctaaagccaca gggcttgccagggccatatgcagcttttctttattacatgggcaaggtct gaggtgtggcctggttgaaaacagccgttctgaagttttgacactaattt ctgaaagcctgaaatgcctgatacccacaggctagcatgtgactgtgata catgctgagtgtctctaaccccaaacttctaaataatccagttctggaac tttttgaggtcctatatgacacacaaacgtaaaattccacacctgacctc atttaccgtgttgaagtcaacaacacaggctcatttaaaatactacataa aattacttgcaaattgtgttcataacatgtataggaaacacaaatttgat gtttagatttggggtacacccccaagctatcccaccacatatatgcaaag attccaaaagctgtccaagaaaaaaaattcagaaatctggttccaaactt ttcagattagaggtgctcacactgaacccatttgctttctagatgatttt ggctttctagacacacgtgaccagaggggcattgtatgttgtccatcagg aaatacacaaaggcgcggtgtcacctgcccgcacacacagttccagaaaa ccacactcgagggggtgcggaatcatacggaaaatgagacactcaagtta ccgcaaagggctatttttgcttatccaaattgctctgtttctgtagtagc tattttcagtcagcgcttccctggctatgttataggacgcactgcattta aacacagtggtaagtgaaagaaatctggcaaatagcctcgcaccccagga taaatctggcatggaaatgtggtggaggttgtctttccc	gaattcctatgccacagggtcatggctttatgagtgtttccacgacatgg tattattacaccccagatctctcacctcatatgtcactcaagcattctct gtcaggaaaccaaggaataaacatccaaaaagaagattaatattagaaag acttaaagagtaaagttcacccagccatatggttcagctcagaagggaca tgtgtgagcccctctccctatcccttcacctgccttacacaagccaggca ggaatgcccctgcagcagcattgcttgggctgcctatgaagtcagcaggg cttgttttttaaaggatgcagattcctagcaattacagtacctgggatgt gactttggaatttgcatgtcccttgctctcagagtcgttttgttgggttg gtttggggtttttgttcattttttgcttttcagtacagactgccgtttcc tctctgacaaacaaactgtgtcttcccatttgagtatgtgcattcatgaa gagctccgtgtttgggggacagacagggctagcaaaggatggtggcgaga tctagggacattctgagatgagtttgaccttcttttcacttgtccatttt tctttccattcttttcttccctctggggccacaggaattaagtcgtttcc cctccccaccccacccccttgtgtgggaaaacctctaagtccgaacttct gtgttctaccttgggaaacaaatgaacaaacaaacaaaaatcaaagcaac cttctgggaatgagcaaagtatctccagcaacaagctctttccccgtgct cagtgacatcgctctgcagcagagtctccttatcctgtggtgctgcacaa aggcttgggggaagtggggcaatggattccacctaacaagat
quality values	Open. Hide. 58 34 32 35 58 58 62 62 62 62 62 62 62 62 62 62 62 62 62 37 31 54 62 62 62 47 42 62 62 62 62 59 59 32 38 49 46 49 37 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 59 62 62 62 62 59 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 42 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 59 59 59 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 54 58 58 58 58 58 58 58 58 58 58 58 52 58 54 42 58 58 47 58 58 58 58 58 54 58 58 58 58 54 58 58 54 52 58 58 58 58 54 58 58 58 58 54 54 42 58 58 58 48 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 52 54 52 52 54 42 58 54 52 49 58 46 53 53 51 51 58 58 58 58 50 50 49 51 51 49 51 58 58 54 45 41 58 51 58 58 50 52 53 50 58 58 54 58 58 51 46 41 50 50 41 43 44 51 44 22 58 50 58 50 50 51 48 43 40 50 42 43 37 49 40 53 50 50 50 39 58 50 49 49 58 42 36 22 50 40 44 16 58 58 50 37 47 51 53 52 50 40 24 50 36 58 58 58 58 58 58 58 50 29 53 37 38 31 58 58 44 50 49 47 54 50 32 33 36 30 37 53 32 42 41 54 54 29 37 27 23 51 31 32 33 32 46 21 33 39 52 49 53 52 39 40 37 38 34 46 54 52 32 51 40 27 38 54 35 42 40 33 54 29 45 37 37 34 41 22 42 41 24 54 54 53 42 33 33 51 52 32 33 39 40 31 32 24 31 34 27 31 31 32 31 31 18 45 33 33 33 10 52 47 40 27 36 32 33 32 31 31 35 43 32 33 31 36 43 35 35 42 38 22 19 13 30 46 38 30 25 33 32 42 20 47 20 16 23 13 9 25 32 36 22 31 30 32 31 32 20 12 27 28 36 41 29 30 30 31 32 30 24 26 12 26 28 31 24 26 18 31 46 31 31 31 18 25 23 30 23 30 31 31 21 41 31 47 48 48 39 27 31 24 24 18 29 12 23 22 34 17 28 23 5 14 30 48 48 32 35 32 31 10 31 24 31 31 36 26 22 30 32 36 25 27 24 24 12 29 25 44 19 25 44 22 21 24 30 30 48 48 48 34 21 32 32 23 12 18 8 25 17 43 33 18 19 32 16 18 21 21 16 17 43 10 24 21 32 15 33 21 29 31 27 23 13 31 22 48 48 30 17 19 19 21 34 20 7 25 15 28 14 14 13 32 21 26 19 18 5 12 20 9 4 6 5 4 6 7 27 27 11 8 12 6 5 7 9 18 14 27 8 38 22 4 30 12 15 5 8 21 6 5 9 21 9 14 27 8 10 6 15 34 27 7 12 30 24 8 17 20 8 9 8 20 30 10 20 8 20 8 5 8 10 7 3 1 5 28 24 15 7 12 8 6 7 9 30 16 6 12 13 14 3 3 3 2 5 4 17 15 14 3 3 7 16 7 4 13 6 4 5 6 5 6 13 7 8 8 28 5 8 23 17	Open. Hide. 62 47 51 41 62 62 62 62 62 62 62 62 44 36 62 59 62 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 59 49 62 62 59 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 62 62 62 62 62 62 62 62 56 62 56 56 62 62 62 56 62 62 62 62 62 62 62 56 51 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 50 62 56 56 54 56 56 38 50 62 62 62 62 62 62 62 62 62 62 32 56 56 62 56 56 53 62 56 62 54 62 62 62 54 54 62 52 62 54 42 62 62 62 62 54 47 41 62 52 46 47 62 62 62 52 62 62 62 42 41 58 54 54 52 37 54 40 54 50 49 58 54 58 54 54 54 54 30 58 58 58 58 54 58 58 54 47 42 54 58 58 58 52 52 54 52 52 52 44 52 52 42 58 58 58 41 54 54 58 54 50 48 58 52 54 52 45 54 26 54 48 34 39 52 42 37 41 47 28 50 50 30 50 53 58 58 51 46 54 45 41 46 41 38 25 41 51 41 46 50 48 49 38 26 50 49 40 39 34 47 40 47 47 34 33 27 30 30 27 40 54 58 58 46 38 29 26 38 50 50 50 26 31 50 39 52 26 51 29 37 39 58 13 43 20 32 46 37 46 33 58 18 51 42 50 39 39 23 32 28 37 30 30 16 40 46 40 40 29 19 18 9 20 35 29 24 49 28 49 39 58 46 50 49 51 37 50 44 52 34 33 16 27 21 38 12 21 21 23 21 39 40 52 37 32 49 54 54 37 37 42 35 32 24 31 42 37 44 21 42 29 26 31 41 45 24 31 40 40 31 31 39 28 23 25 34 37 33 21 51 20 26 41 47 46 31 22 42 20 41 26 42 14 9 27 20 17 32 42 30 45 31 51 32 32 31 21 31 19 15 29 19 51 16 32 31 34 33 12 15 17 21 47 34 32 32 41 28 36 32 29 41 32 31 29 21 21 31 33 40 45 16 31 13 46 18 27 45 45 45 14 46 33 18 30 23 23 18 19 10 18 31 31 33 12 9 5 6 5 13 11 16 22 8 7 9 10 13 10 6 12 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_42762972_42764125
seq2: B6Ng01-218O23.b_45_1183

seq1  GAATTCTCTCTCCTCCTGGATGTCCCACCTCCCATTCCCTGCCTAAGCCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTCTCCTCCTGGATGTCCCACCTCCCATTCCCTGCCTAAGCCA  50

seq1  TAGGCCAAAGGCTTTTTAATTGACAAGAGATGCATCCATATAACACACAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGCCAAAGGCTTTTTAATTGACAAGAGATGCATCCATATAACACACAA  100

seq1  GACAGTATACACAAGATAGCCTCTATACATGCCTATCAAACATCTCTCAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGTATACACAAGATAGCCTCTATACATGCCTATCAAACATCTCTCAG  150

seq1  GGAGTGACAGGGGCCGGCAGTCATCTCTGGGGTCTTGCCCAGTGCTCTAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGTGACAGGGGCCGGCAGTCATCTCTGGGGTCTTGCCCAGTGCTCTAG  200

seq1  TCTGGACCTTTAGCTTCCTGGGGTTTCTAACTGTGCATTTTGAGCATTCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGACCTTTAGCTTCCTGGGGTTTCTAACTGTGCATTTTGAGCATTCT  250

seq1  GACACCCCCATGTGCCATAGTATGCTGGCATATGTGACTCTAAAGCCACA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACACCCCCATGTGCCATAGTATGCTGGCATATGTGACTCTAAAGCCACA  300

seq1  GGGCTTGCCAGGGCCATATGCAGCTTTTCTTTATTACATGGGCAAGGTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTTGCCAGGGCCATATGCAGCTTTTCTTTATTACATGGGCAAGGTCT  350

seq1  GAGGTGTGGCCTGGTTGAAAACAGCCGTTCTGAAGTTTTGACACTAATTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTGTGGCCTGGTTGAAAACAGCCGTTCTGAAGTTTTGACACTAATTT  400

seq1  CTGAAAGCCTGAAATGCCTGATACCCACAGGCTAGCATGTGACTGTGATA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAAAGCCTGAAATGCCTGATACCCACAGGCTAGCATGTGACTGTGATA  450

seq1  CATGCTGAGTGTCTCTAACCCCAAACTTCTAAATAATCCAGTTCTGGAAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCTGAGTGTCTCTAACCCCAAACTTCTAAATAATCCAGTTCTGGAAC  500

seq1  TTTTTGAGGTCCTATATGACACACAAACGTAAAATTCCACACCTGACCTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTGAGGTCCTATATGACACACAAACGTAAAATTCCACACCTGACCTC  550

seq1  ATTTACCGTGTTGAAGTCAACAACACAGGCTCATTTAAAATACTACATAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTACCGTGTTGAAGTCAACAACACAGGCTCATTTAAAATACTACATAA  600

seq1  AATTACTTGCAAATTGTGTTCATAACATGTATAGGAAACACAAATTTGAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTACTTGCAAATTGTGTTCATAACATGTATAGGAAACACAAATTTGAT  650

seq1  GTTTAGATTTGGGGTACACCCCCAAGCTATCCCACCACATATATGCAAAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTAGATTTGGGGTACACCCCCAAGCTATCCCACCACATATATGCAAAG  700

seq1  ATTCCAAAAGCTGTCCAAGAAAAAAAATTCAGAAATCTGGTTCCAAACTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCAAAAGCTGTCCAAGAAAAAAAATTCAGAAATCTGGTTCCAAACTT  750

seq1  TTCAGATTAGAGGTGCTCACACTGAACCCATTTGCTTTCTAGATGATTTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGATTAGAGGTGCTCACACTGAACCCATTTGCTTTCTAGATGATTTT  800

seq1  GGCTTTCTAGACACACGTGACCAGAGGGGCATTGTATGTTGTCCATCAGG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTTCTAGACACACGTGACCAGAGGGGCATTGTATGTTGTCCATCAGG  850

seq1  AAATACACAAAGGCGCGGTGTCACCTGCCCGCACACACAGTTCCAGAAAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACACAAAGGCGCGGTGTCACCTGCCCGCACACACAGTTCCAGAAAA  900

seq1  CCACACTCGAGGGGGTGCGGAAATCAATACGGAAAATGAGACACTCAAGT  950
      |||||||||||||||||||| |||| ||||||||||||||||||||||||
seq2  CCACACTCGAGGGGGTGCGG-AATC-ATACGGAAAATGAGACACTCAAGT  948

seq1  TACCGCAAAGGGCTATTTTTGCTTATTCCAAATTGCTCTGTTTCTGTAAG  1000
      ||||||||||||||||||||||||| ||||||||||||||||||||| ||
seq2  TACCGCAAAGGGCTATTTTTGCTTA-TCCAAATTGCTCTGTTTCTGT-AG  996

seq1  TAGCTATTTTCAGTCAGCCGCTTCCCTGGCTATG-TATAGGGACGGCACT  1049
      ||||||||||||||||| |||||||||||||||| |||| |||| |||||
seq2  TAGCTATTTTCAGTCAG-CGCTTCCCTGGCTATGTTATA-GGAC-GCACT  1043

seq1  GCAATTTAAACACAAGTGGTAAGTGAAAAGAAATCT-GCAAATAGGCTCG  1098
      || |||||||||| ||||||||||| |||||||||| |||||||| ||||
seq2  GC-ATTTAAACAC-AGTGGTAAGTG-AAAGAAATCTGGCAAATAGCCTCG  1090

seq1  CACCCCAGGGATAAATCTGGGGCAATTGAAAATGTGGTGGAGGTTGGTTC  1148
      ||||||| ||||||||||  ||||  || |||||||||||||||||  ||
seq2  CACCCCA-GGATAAATCT--GGCA--TGGAAATGTGGTGGAGGTTG--TC  1133

seq1  TTTCCC  1154
      ||||||
seq2  TTTCCC  1139

seq1: chr19_42942969_42943858
seq2: B6Ng01-218O23.g_63_953 (reverse)

seq1  TCTTGTTAGGTGGTAGTCCATTG-CCCACTTTCCCCAAGCCTTTGTGCAG  49
      ||||||||||||| | ||||||| ||||||| ||||||||||||||||||
seq2  TCTTGTTAGGTGG-AATCCATTGCCCCACTTCCCCCAAGCCTTTGTGCAG  49

seq1  CACCACAGGATAAGGAGACTCTGCTGCAGAGCGATGTCACTGAGCACGGG  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCACAGGATAAGGAGACTCTGCTGCAGAGCGATGTCACTGAGCACGGG  99

seq1  G-AAGAGCTTGTTGCTGGAGATACTTTGCTCATTCCCAGAAGGTTGCTTT  148
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGAGCTTGTTGCTGGAGATACTTTGCTCATTCCCAGAAGGTTGCTTT  149

seq1  GATTTTTGTTTGTTTGTTCATTTGTTTCCCAAGGTAGAACACAGAAGTTC  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTTTTGTTTGTTTGTTCATTTGTTTCCCAAGGTAGAACACAGAAGTTC  199

seq1  GGACTTAGAGGTTTTCCCACACAAGGGGGTGGGGTGGGGAGGGGAAACGA  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTTAGAGGTTTTCCCACACAAGGGGGTGGGGTGGGGAGGGGAAACGA  249

seq1  CTTAATTCCTGTGGCCCCAGAGGGAAGAAAAGAATGGAAAGAAAAATGGA  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAATTCCTGTGGCCCCAGAGGGAAGAAAAGAATGGAAAGAAAAATGGA  299

seq1  CAAGTGAAAAGAAGGTCAAACTCATCTCAGAATGTCCCTAGATCTCGCCA  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGTGAAAAGAAGGTCAAACTCATCTCAGAATGTCCCTAGATCTCGCCA  349

seq1  CCATCCTTTGCTAGCCCTGTCTGTCCCCCAAACACGGAGCTCTTCATGAA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCCTTTGCTAGCCCTGTCTGTCCCCCAAACACGGAGCTCTTCATGAA  399

seq1  TGCACATACTCAAATGGGAAGACACAGTTTGTTTGTCAGAGAGGAAACGG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACATACTCAAATGGGAAGACACAGTTTGTTTGTCAGAGAGGAAACGG  449

seq1  CAGTCTGTACTGAAAAGCAAAAAATGAACAAAAACCCCAAACCAACCCAA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCTGTACTGAAAAGCAAAAAATGAACAAAAACCCCAAACCAACCCAA  499

seq1  CAAAACGACTCTGAGAGCAAGGGACATGCAAATTCCAAAGTCACATCCCA  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAACGACTCTGAGAGCAAGGGACATGCAAATTCCAAAGTCACATCCCA  549

seq1  GGTACTGTAATTGCTAGGAATCTGCATCCTTTAAAAAACAAGCCCTGCTG  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTACTGTAATTGCTAGGAATCTGCATCCTTTAAAAAACAAGCCCTGCTG  599

seq1  ACTTCATAGGCAGCCCAAGCAATGCTGCTGCAGGGGCATTCCTGCCTGGC  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCATAGGCAGCCCAAGCAATGCTGCTGCAGGGGCATTCCTGCCTGGC  649

seq1  TTGTGTAAGGCAGGTGAAGGGATAGGGAGAGGGGCTCACACATGTCCCTT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGTAAGGCAGGTGAAGGGATAGGGAGAGGGGCTCACACATGTCCCTT  699

seq1  CTGAGCTGAACCATATGGCTGGGTGAACTTTACTCTTTAAGTCTTTCTAA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGCTGAACCATATGGCTGGGTGAACTTTACTCTTTAAGTCTTTCTAA  749

seq1  TATTAATCTTCTTTTTGGATGTTTATTCCTTGGTTTCCTGACAGAGAATG  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTAATCTTCTTTTTGGATGTTTATTCCTTGGTTTCCTGACAGAGAATG  799

seq1  CTTGAGTGACATATGAGGTGAGAGATCTGGGGTGTAATAATACCATGTCG  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGAGTGACATATGAGGTGAGAGATCTGGGGTGTAATAATACCATGTCG  849

seq1  TGGAAACACTCATAAAGCCATGACCCTGTGGCATAGGAATTC  890
      ||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAACACTCATAAAGCCATGACCCTGTGGCATAGGAATTC  891

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information