MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-251P07
Chromosome	19 (Build37)
Map Location	13,423,426 - 13,551,571
singlet/doublet	doublet
Overlap gene	Olfr1467, Olfr1468-ps1, Olfr1469, Olfr1470-ps1, Olfr1471, GA_x5J8B7W6KF8-5605544-5605301, Olfr1472, Olfr1473-ps1, Olfr1474
Upstream gene	Olfr1440, Olfr1441, Pfpl, Mpeg1, Dtx4, EG625046, 4632417K18Rik, EG240549, Glyat, Olfr1442, Olfr1443, Keg1, Zfp91, Cntf, Lpxn, EG383436, Olfr1444, Olfr1445, Olfr1446, Olfr1447, EG433224, Olfr1448, Olfr1449, Olfr1450, Olfr1451, Olfr1452-ps1, Olfr1453, Olfr1454, Olfr1455-ps1, Olfr1456-ps1, Olfr1457, EG667271, Olfr1459, Olfr1460-ps1, Olfr1461, Olfr1462, Olfr1463, LOC667300, Olfr1465, Olfr1466
Downstream gene	Olfr1475, GA_x5J8B7W6KF8-5563315-5562883, Olfr1477, GA_x5J8B7W6KF8-5546505-5545716, GA_x5J8B7W6KF8-5539992-5539494, LOC100041185, Olfr1480, GA_x5J8B7W6KF8-5515896-5515561, GA_x5J8B7W6KF8-5488050-5488655, Olfr1483-ps1, Olfr1484, GA_x5J8B7W6KF8-5463415-5462623, Olfr1486-ps1, LOC671653, Olfr1487, GA_x5J8B7W6KF8-5425983-5425664, Olfr1489, Olfr1490, Olfr1491, Olfr1492-ps1, Olfr1493-ps1, Olfr1494, Olfr1495, Olfr1496, Olfr1497, Olfr1498-ps1, Olfr1499, Olfr1500, Olfr1501, Olfr1502, Olfr1503-ps1, Olfr1504, Olfr1505, EG667433, Tle4
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr1440 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258679 MGI:3031274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1441 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258678 MGI:3031275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56093 MGI:1860266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpeg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17476 MGI:1333743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dtx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207521 MGI:2672905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625046 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625046 MGI:3643874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	4632417K18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107373 MGI:1915508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG240549 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240549 MGI:3643569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glyat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107146 MGI:2147502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1442 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258692 MGI:3031276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1443 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258693 MGI:3031277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Keg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64697 MGI:1928492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp91 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109910 MGI:104854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Cntf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12803 MGI:88439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lpxn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107321 MGI:2147677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG383436 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383436 MGI:3646958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	Olfr1444 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258697 MGI:3031278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1445 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258694 MGI:3031279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1446 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258699 MGI:3031280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1447 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258698 MGI:3031281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433224 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433224 MGI:3645436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 47 ESTs, 8 Proteins pseudo : _no_value

name	Olfr1448 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258696 MGI:3031282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1449 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258300 MGI:3031283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1450 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258368 MGI:3031284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1451 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258700 MGI:3031285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1452-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258126 MGI:3031286
definition	gene_synonym : MOR202-23 note : olfactory receptor 1452, pseudogene 1 pseudo : _no_value

name	Olfr1453 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258695 MGI:3031287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1454 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258687 MGI:3031288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1455-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404515 MGI:3031289
definition	note : olfactory receptor 1455, pseudogene 1 pseudo : _no_value

name	Olfr1456-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404516 MGI:3031290
definition	note : olfactory receptor 1456, pseudogene 1 pseudo : _no_value

name	Olfr1457 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258568 MGI:3031291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667271 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667271 MGI:3645607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2279 Proteins

name	Olfr1459 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258684 MGI:3031293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1460-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258118 MGI:3031294
definition	gene_synonym : MOR202-31P note : olfactory receptor 1460, pseudogene 1 pseudo : _no_value

name	Olfr1461 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258299 MGI:3031295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1462 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258688 MGI:3031296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1463 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258120 MGI:3031297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667300 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667300
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1315 Proteins pseudo : _no_value

name	Olfr1465 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258121 MGI:3031299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1466 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258689 MGI:3031300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1467 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258686 MGI:3031301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1468-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258192 MGI:3031302
definition	gene_synonym : MOR202-21 note : olfactory receptor 1468, pseudogene 1 pseudo : _no_value

name	Olfr1469 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258690 MGI:3031303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1470-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258119 MGI:3031304
definition	gene_synonym : MOR202-30P note : olfactory receptor 1470, pseudogene 1 pseudo : _no_value

name	Olfr1471 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258231 MGI:3031305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-5605544-5605301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257729
definition	note : olfactory receptor GA_x5J8B7W6KF8-5605544-5605301 pseudo : _no_value

name	Olfr1472 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258685 MGI:3031306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1473-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258124 MGI:3031307
definition	gene_synonym : MOR202-25P note : olfactory receptor 1473, pseudogene 1 pseudo : _no_value

name	Olfr1474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258123 MGI:3031308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1475 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258298 MGI:3031309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-5563315-5562883 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257761
definition	note : olfactory receptor GA_x5J8B7W6KF8-5563315-5562883 pseudo : _no_value

name	Olfr1477 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258691 MGI:3031311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-5546505-5545716 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257762
definition	note : olfactory receptor GA_x5J8B7W6KF8-5546505-5545716 pseudo : _no_value

name	GA_x5J8B7W6KF8-5539992-5539494 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257763
definition	note : olfactory receptor GA_x5J8B7W6KF8-5539992-5539494 pseudo : _no_value

name	LOC100041185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr1480 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404339 MGI:3031314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-5515896-5515561 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257764
definition	note : olfactory receptor GA_x5J8B7W6KF8-5515896-5515561 pseudo : _no_value

name	GA_x5J8B7W6KF8-5488050-5488655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257765
definition	note : olfactory receptor GA_x5J8B7W6KF8-5488050-5488655 pseudo : _no_value

name	Olfr1483-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404522 MGI:3031317
definition	note : olfactory receptor 1483, pseudogene 1 pseudo : _no_value

name	Olfr1484 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258288 MGI:3031318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-5463415-5462623 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257767
definition	note : olfactory receptor GA_x5J8B7W6KF8-5463415-5462623 pseudo : _no_value

name	Olfr1486-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404524 MGI:3031320
definition	note : olfactory receptor 1486, pseudogene 1 pseudo : _no_value

name	LOC671653 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	Olfr1487 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258629 MGI:3031321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6KF8-5425983-5425664 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257768
definition	note : olfactory receptor GA_x5J8B7W6KF8-5425983-5425664 pseudo : _no_value

name	Olfr1489 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258628 MGI:3031323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1490 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258098 MGI:3031324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1491 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258342 MGI:3031325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1492-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404526 MGI:3031326
definition	note : olfactory receptor 1492, pseudogene 1 pseudo : _no_value

name	Olfr1493-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258735 MGI:3031327
definition	gene_synonym : MOR266-3 note : olfactory receptor 1493, pseudogene 1 pseudo : _no_value

name	Olfr1494 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258992 MGI:3031328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1495 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258341 MGI:3031329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1496 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258991 MGI:3031330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1497 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258736 MGI:3031331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1498-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258217 MGI:3031332
definition	gene_synonym : MOR211-3P note : olfactory receptor 1498, pseudogene 1 pseudo : _no_value

name	Olfr1499 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258792 MGI:3031333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1500 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258097 MGI:3031334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1501 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258626 MGI:3031335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1502 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258793 MGI:3031336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1503-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404527 MGI:3031337
definition	note : olfactory receptor 1503, pseudogene 1 pseudo : _no_value

name	Olfr1504 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258627 MGI:3031338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1505 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258151 MGI:3031339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667433 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667433 MGI:3647677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Tle4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21888 MGI:104633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1440 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239083 GeneID:258679 MGI:3031274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1440 transcript_id : NM_146684.1

name	Olfr1441 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239077 GeneID:258678 MGI:3031275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1441 transcript_id : NM_146683.1

name	Pfpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506576 GeneID:56093 MGI:1860266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pore forming protein-like transcript_id : NM_019540.1

name	Mpeg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133506752 GeneID:17476 MGI:1333743
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage expressed gene 1 transcript_id : NM_010821.1

name	Dtx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254206 GeneID:207521 MGI:2672905
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deltex 4 homolog (Drosophila) transcript_id : NM_172442.2

name	EG625046 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270390 GeneID:625046 MGI:3643874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG625046 transcript_id : XM_889589.2

name	4632417K18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360571 GeneID:107373 MGI:1915508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632417K18 gene transcript_id : NM_026640.2

name	EG240549 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000639 GeneID:240549 MGI:3643569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG240549 transcript_id : NM_001013762.1

name	Glyat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802788 GeneID:107146 MGI:2147502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycine-N-acyltransferase transcript_id : NM_145935.3

name	Olfr1442 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129446 GeneID:258692 MGI:3031276
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1442 transcript_id : NM_146697.1

name	Olfr1443 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41056105 GeneID:258693 MGI:3031277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1443 transcript_id : NM_146698.2

name	Keg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387486 GeneID:64697 MGI:1928492
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kidney expressed gene 1 transcript_id : NM_029550.2

name	Zfp91 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90669975 GeneID:109910 MGI:104854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : zinc finger protein 91 transcript_id : NM_001039718.1

name	Cntf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90669424 GeneID:12803 MGI:88439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ciliary neurotrophic factor transcript_id : NM_170786.2

name	Zfp91 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90669982 GeneID:109910 MGI:104854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 91 transcript_id : NM_053009.2

name	Lpxn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352336 GeneID:107321 MGI:2147677
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leupaxin transcript_id : NM_134152.2

name	EG383436 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38084913 GeneID:383436 MGI:3646958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG383436, transcript variant 1 transcript_id : XM_357052.1

name	EG383436 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82998210 GeneID:383436 MGI:3646958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG383436, transcript variant 2 transcript_id : XM_899309.1

name	Olfr1444 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129432 GeneID:258697 MGI:3031278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1444 transcript_id : NM_146702.1

name	Olfr1445 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129442 GeneID:258694 MGI:3031279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1445 transcript_id : NM_146699.1

name	Olfr1446 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129428 GeneID:258699 MGI:3031280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1446 transcript_id : NM_146704.1

name	Olfr1447 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129434 GeneID:258698 MGI:3031281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1447 transcript_id : NM_146703.1

name	Olfr1448 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129438 GeneID:258696 MGI:3031282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1448 transcript_id : NM_146701.1

name	Olfr1449 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129680 GeneID:258300 MGI:3031283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1449 transcript_id : NM_146303.1

name	Olfr1450 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129558 GeneID:258368 MGI:3031284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1450 transcript_id : NM_146371.1

name	Olfr1451 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129430 GeneID:258700 MGI:3031285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1451 transcript_id : NM_146705.1

name	Olfr1453 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129436 GeneID:258695 MGI:3031287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1453 transcript_id : NM_146700.1

name	Olfr1454 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239135 GeneID:258687 MGI:3031288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1454 transcript_id : NM_146692.1

name	Olfr1457 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129494 GeneID:258568 MGI:3031291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1457 transcript_id : NM_146575.1

name	EG667271 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270392 GeneID:667271 MGI:3645607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2279 Proteins product : predicted gene, EG667271 transcript_id : XM_001475614.1

name	Olfr1459 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239133 GeneID:258684 MGI:3031293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1459 transcript_id : NM_146689.1

name	Olfr1461 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170041 GeneID:258299 MGI:3031295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1461 transcript_id : NM_146302.1

name	Olfr1462 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239141 GeneID:258688 MGI:3031296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1462 transcript_id : NM_146693.1

name	Olfr1463 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801439 GeneID:258120 MGI:3031297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1463 transcript_id : NM_001011840.1

name	Olfr1465 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801441 GeneID:258121 MGI:3031299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1465 transcript_id : NM_001011841.1

name	Olfr1466 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239139 GeneID:258689 MGI:3031300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1466 transcript_id : NM_146694.1

name	Olfr1467 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239137 GeneID:258686 MGI:3031301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1467 transcript_id : NM_146691.1

name	Olfr1469 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239145 GeneID:258690 MGI:3031303
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1469 transcript_id : NM_146695.1

name	Olfr1471 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821661 GeneID:258231 MGI:3031305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1471 transcript_id : NM_207132.2

name	Olfr1472 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671325 GeneID:258685 MGI:3031306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1472 transcript_id : NM_146690.2

name	Olfr1474 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801443 GeneID:258123 MGI:3031308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1474 transcript_id : NM_001011842.1

name	Olfr1475 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129686 GeneID:258298 MGI:3031309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1475 transcript_id : NM_146301.1

name	Olfr1477 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983619 GeneID:258691 MGI:3031311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1477 transcript_id : NM_146696.2

name	Olfr1480 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430751 GeneID:404339 MGI:3031314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1480 transcript_id : NM_207575.1

name	Olfr1484 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129706 GeneID:258288 MGI:3031318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1484 transcript_id : NM_146291.1

name	Olfr1487 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239127 GeneID:258629 MGI:3031321
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1487 transcript_id : NM_146636.1

name	Olfr1489 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239129 GeneID:258628 MGI:3031323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1489 transcript_id : NM_146635.1

name	Olfr1490 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801427 GeneID:258098 MGI:3031324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1490 transcript_id : NM_001011832.1

name	Olfr1491 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129607 GeneID:258342 MGI:3031325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1491 transcript_id : NM_146345.1

name	Olfr1494 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128952 GeneID:258992 MGI:3031328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1494 transcript_id : NM_146990.1

name	Olfr1495 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129613 GeneID:258341 MGI:3031329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1495 transcript_id : NM_146344.1

name	Olfr1496 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128958 GeneID:258991 MGI:3031330
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1496 transcript_id : NM_146989.1

name	Olfr1497 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129358 GeneID:258736 MGI:3031331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1497 transcript_id : NM_146741.1

name	Olfr1499 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129260 GeneID:258792 MGI:3031333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1499 transcript_id : NM_146796.1

name	Olfr1500 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801425 GeneID:258097 MGI:3031334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1500 transcript_id : NM_001011831.1

name	Olfr1501 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671327 GeneID:258626 MGI:3031335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1501 transcript_id : NM_146633.2

name	Olfr1502 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129254 GeneID:258793 MGI:3031336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1502 transcript_id : NM_146797.1

name	Olfr1504 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239093 GeneID:258627 MGI:3031338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1504 transcript_id : NM_146634.1

name	Olfr1505 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801457 GeneID:258151 MGI:3031339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1505 transcript_id : NM_001011850.1

name	EG667433 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405893 GeneID:667433 MGI:3647677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : predicted gene, EG667433 transcript_id : XM_990558.1

name	Tle4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38372894 GeneID:21888 MGI:104633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducin-like enhancer of split 4, homolog of Drosophila E(spl) transcript_id : NM_011600.2

name	Olfr1440 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239084 CCDS:CCDS29629.1 GeneID:258679 MGI:3031274
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2725206-2726153; olfactory receptor MOR215-1 product : olfactory receptor 1440 protein_id : NP_666895.1

name	Olfr1441 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239078 CCDS:CCDS29630.1 GeneID:258678 MGI:3031275
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-2753221-2754177; olfactory receptor MOR215-2 product : olfactory receptor 1441 protein_id : NP_666894.1

name	Pfpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506577 GeneID:56093 MGI:1860266
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : ectoplacental cone, invasive trophoblast giant cells, extraembryonic ectoderm and chorion sequence 50 product : pore forming protein-like protein_id : NP_062413.1

name	Mpeg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133506753 GeneID:17476 MGI:1333743
definition	codon_start : 1 product : macrophage expressed gene 1 protein_id : NP_034951.1

name	Dtx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254207 CCDS:CCDS29631.1 GeneID:207521 MGI:2672905
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : deltex 4 homolog protein_id : NP_766030.2

name	EG625046 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270391 GeneID:625046 MGI:3643874
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894682.2

name	4632417K18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386132 CCDS:CCDS29632.1 GeneID:107373 MGI:1915508
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC107373 protein_id : NP_080916.1

name	EG240549 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000640 GeneID:240549 MGI:3643569
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC240549 protein_id : NP_001013784.1

name	Glyat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122359 CCDS:CCDS29633.1 GeneID:107146 MGI:2147502
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0047961 - glycine N-acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : glycine-N-acyltransferase protein_id : NP_666047.1

name	Olfr1442 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129447 CCDS:CCDS29634.1 GeneID:258692 MGI:3031276
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RE5P-3000589-3001527; olfactory receptor MOR202-9 product : olfactory receptor 1442 protein_id : NP_666908.1

name	Olfr1443 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129441 CCDS:CCDS29635.1 GeneID:258693 MGI:3031277
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3006492-3007430; olfactory receptor MOR202-8 product : olfactory receptor 1443 protein_id : NP_666909.1

name	Keg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19482166 CCDS:CCDS29636.1 GeneID:64697 MGI:1928492
definition	GO_component : GO:0005813 - centrosome [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0043015 - gamma-tubulin binding [Evidence ISS] GO_process : GO:0000074 - regulation of progression through cell cycle [Evidence ISS] codon_start : 1 product : hypothetical protein LOC64697 protein_id : NP_083826.1

name	Cntf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25952141 CCDS:CCDS29637.1 GeneID:12803 MGI:88439
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0040007 - growth [Evidence IEA]; GO:0048644 - muscle morphogenesis [Evidence IGI]; GO:0046533 - negative regulation of photoreceptor cell differentiation [Evidence IDA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0048666 - neuron development [Evidence IGI]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0042517 - positive regulation of tyrosine phosphorylation of Stat3 protein [Evidence IDA]; GO:0046668 - regulation of retinal programmed cell death [Evidence IDA] codon_start : 1 product : ciliary neurotrophic factor protein_id : NP_740756.1

name	Zfp91 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90669976 GeneID:109910 MGI:104854
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : zinc finger protein 91 isoform b protein_id : NP_001034807.1

name	Zfp91 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90669983 GeneID:109910 MGI:104854
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : zinc finger protein 91 isoform a protein_id : NP_443735.2

name	Lpxn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26080416 CCDS:CCDS29638.1 GeneID:107321 MGI:2147677
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : leupaxin protein_id : NP_598913.1

name	EG383436 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38084914 GeneID:383436 MGI:3646958
definition	codon_start : 1 product : similar to 60S acidic ribosomal protein P1 isoform 1 protein_id : XP_357052.1

name	EG383436 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998211 GeneID:383436 MGI:3646958
definition	codon_start : 1 product : similar to 60S acidic ribosomal protein P1 isoform 2 protein_id : XP_904402.1

name	Olfr1444 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129433 CCDS:CCDS29640.1 GeneID:258697 MGI:3031278
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3191201-3192160; olfactory receptor MOR202-4 product : olfactory receptor 1444 protein_id : NP_666913.1

name	Olfr1445 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129443 CCDS:CCDS29641.1 GeneID:258694 MGI:3031279
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3213352-3214296; olfactory receptor MOR202-7 product : olfactory receptor 1445 protein_id : NP_666910.1

name	Olfr1446 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129429 CCDS:CCDS29642.1 GeneID:258699 MGI:3031280
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3220047-3219130; olfactory receptor MOR202-2 product : olfactory receptor 1446 protein_id : NP_666915.1

name	Olfr1447 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129435 CCDS:CCDS29643.1 GeneID:258698 MGI:3031281
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3231251-3230331; olfactory receptor MOR202-3 product : olfactory receptor 1447 protein_id : NP_666914.1

name	Olfr1448 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129439 CCDS:CCDS29644.1 GeneID:258696 MGI:3031282
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3249780-3248836; olfactory receptor MOR202-5 product : olfactory receptor 1448 protein_id : NP_666912.1

name	Olfr1449 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129681 CCDS:CCDS29645.1 GeneID:258300 MGI:3031283
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3264213-3265157; olfactory receptor MOR202-34 product : olfactory receptor 1449 protein_id : NP_666415.1

name	Olfr1450 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129559 CCDS:CCDS29646.1 GeneID:258368 MGI:3031284
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3283121-3284098; olfactory receptor MOR202-33 product : olfactory receptor 1450 protein_id : NP_666483.1

name	Olfr1451 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129431 CCDS:CCDS29647.1 GeneID:258700 MGI:3031285
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3328502-3329434; olfactory receptor MOR202-1 product : olfactory receptor 1451 protein_id : NP_666916.1

name	Olfr1453 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129437 CCDS:CCDS29648.1 GeneID:258695 MGI:3031287
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3357666-3356743; olfactory receptor MOR202-6 product : olfactory receptor 1453 protein_id : NP_666911.1

name	Olfr1454 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239136 CCDS:CCDS29649.1 GeneID:258687 MGI:3031288
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3390804-3391727; olfactory receptor MOR202-14 product : olfactory receptor 1454 protein_id : NP_666903.1

name	Olfr1457 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129495 CCDS:CCDS29650.1 GeneID:258568 MGI:3031291
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3423041-3422097; olfactory receptor MOR202-20 product : olfactory receptor 1457 protein_id : NP_666786.1

name	EG667271 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270393 GeneID:667271 MGI:3645607
definition	codon_start : 1 product : similar to olfactory receptor Olfr1458 protein_id : XP_001475664.1

name	Olfr1459 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239134 CCDS:CCDS29651.1 GeneID:258684 MGI:3031293
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3473421-3472498; olfactory receptor MOR202-17 product : olfactory receptor 1459 protein_id : NP_666900.1

name	Olfr1461 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170042 CCDS:CCDS29652.1 GeneID:258299 MGI:3031295
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3491834-3492772; olfactory receptor MOR202-35 product : olfactory receptor 1461 protein_id : NP_666414.1

name	Olfr1462 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239142 CCDS:CCDS29653.1 GeneID:258688 MGI:3031296
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3517488-3518411; olfactory receptor MOR202-13 product : olfactory receptor 1462 protein_id : NP_666904.1

name	Olfr1463 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801440 CCDS:CCDS29654.1 GeneID:258120 MGI:3031297
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3560863-3561795; olfactory receptor MOR202-29P product : olfactory receptor 1463 protein_id : NP_001011840.1

name	Olfr1465 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801442 CCDS:CCDS29655.1 GeneID:258121 MGI:3031299
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3645346-3644423; olfactory receptor MOR202-28 product : olfactory receptor 1465 protein_id : NP_001011841.1

name	Olfr1466 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239140 CCDS:CCDS29656.1 GeneID:258689 MGI:3031300
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3672907-3673839; olfactory receptor MOR202-12 product : olfactory receptor 1466 protein_id : NP_666905.1

name	Olfr1467 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239138 CCDS:CCDS29657.1 GeneID:258686 MGI:3031301
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3695694-3696620; olfactory receptor MOR202-15 product : olfactory receptor 1467 protein_id : NP_666902.1

name	Olfr1469 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239146 CCDS:CCDS29658.1 GeneID:258690 MGI:3031303
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3743369-3744289; olfactory receptor MOR202-11 product : olfactory receptor 1469 protein_id : NP_666906.1

name	Olfr1471 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821662 CCDS:CCDS29659.1 GeneID:258231 MGI:3031305
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3777626-3778570; MOR202-47_p; olfactory receptor MOR202-38 product : olfactory receptor 1471 protein_id : NP_997015.2

name	Olfr1472 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110671326 CCDS:CCDS29660.1 GeneID:258685 MGI:3031306
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3787124-3786180; olfactory receptor MOR202-16 product : olfactory receptor 1472 protein_id : NP_666901.2

name	Olfr1474 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801444 CCDS:CCDS29661.1 GeneID:258123 MGI:3031308
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3803583-3804527; olfactory receptor MOR202-26P product : olfactory receptor 1474 protein_id : NP_001011842.1

name	Olfr1475 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129687 CCDS:CCDS29662.1 GeneID:258298 MGI:3031309
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3812807-3811863; olfactory receptor MOR202-36 product : olfactory receptor 1475 protein_id : NP_666413.1

name	Olfr1477 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983620 CCDS:CCDS29663.1 GeneID:258691 MGI:3031311
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3834960-3835907; olfactory receptor MOR202-10 product : olfactory receptor 1477 protein_id : NP_666907.2

name	Olfr1480 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430752 CCDS:CCDS29664.1 GeneID:404339 MGI:3031314
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3862389-3863336 product : olfactory receptor 1480 protein_id : NP_997458.1

name	Olfr1484 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129707 CCDS:CCDS29665.1 GeneID:258288 MGI:3031318
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3917859-3918806; olfactory receptor MOR202-37 product : olfactory receptor 1484 protein_id : NP_666403.1

name	Olfr1487 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239128 CCDS:CCDS29666.1 GeneID:258629 MGI:3031321
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3951719-3952666; olfactory receptor MOR202-18 product : olfactory receptor 1487 protein_id : NP_666847.1

name	Olfr1489 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239130 CCDS:CCDS29667.1 GeneID:258628 MGI:3031323
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3965668-3966609; olfactory receptor MOR202-19 product : olfactory receptor 1489 protein_id : NP_666846.1

name	Olfr1490 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801428 CCDS:CCDS29668.1 GeneID:258098 MGI:3031324
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-3987000-3987950; olfactory receptor MOR266-6P product : olfactory receptor 1490 protein_id : NP_001011832.1

name	Olfr1491 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129608 CCDS:CCDS29669.1 GeneID:258342 MGI:3031325
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4037809-4038768; olfactory receptor MOR266-8 product : olfactory receptor 1491 protein_id : NP_666457.1

name	Olfr1494 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128953 CCDS:CCDS29670.1 GeneID:258992 MGI:3031328
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4082427-4083374; olfactory receptor MOR266-1 product : olfactory receptor 1494 protein_id : NP_667201.1

name	Olfr1495 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129614 CCDS:CCDS29671.1 GeneID:258341 MGI:3031329
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4101369-4102328; olfactory receptor MOR266-9 product : olfactory receptor 1495 protein_id : NP_666456.1

name	Olfr1496 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128959 CCDS:CCDS29672.1 GeneID:258991 MGI:3031330
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RE5P-4112771-4113718; olfactory receptor MOR127-1 product : olfactory receptor 1496 protein_id : NP_667200.1

name	Olfr1497 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129359 CCDS:CCDS29673.1 GeneID:258736 MGI:3031331
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4127765-4126821; olfactory receptor MOR212-1 product : olfactory receptor 1497 protein_id : NP_666952.1

name	Olfr1499 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129261 CCDS:CCDS29674.1 GeneID:258792 MGI:3031333
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4147744-4146800; olfactory receptor MOR211-2 product : olfactory receptor 1499 protein_id : NP_667007.1

name	Olfr1500 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801426 CCDS:CCDS29675.1 GeneID:258097 MGI:3031334
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4160554-4159619; olfactory receptor MOR212-4P product : olfactory receptor 1500 protein_id : NP_001011831.1

name	Olfr1501 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239096 CCDS:CCDS29676.1 GeneID:258626 MGI:3031335
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4171358-4170411; olfactory receptor MOR212-3 product : olfactory receptor 1501 protein_id : NP_666844.1

name	Olfr1502 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129255 CCDS:CCDS29677.1 GeneID:258793 MGI:3031336
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4193992-4194942; olfactory receptor MOR211-1 product : olfactory receptor 1502 protein_id : NP_667008.1

name	Olfr1504 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239094 CCDS:CCDS29678.1 GeneID:258627 MGI:3031338
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4223635-4222688; olfactory receptor MOR212-2 product : olfactory receptor 1504 protein_id : NP_666845.1

name	Olfr1505 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801458 CCDS:CCDS29679.1 GeneID:258151 MGI:3031339
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RE5P-4250267-4251217; MOR211-10_i; olfactory receptor MOR211-4P product : olfactory receptor 1505 protein_id : NP_001011850.1

name	EG667433 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94405894 GeneID:667433 MGI:3647677
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995652.1

name	Tle4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38372895 GeneID:21888 MGI:104633
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IC] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence IGI]; GO:0003714 - transcription corepressor activity [Evidence IDA] [Evidence IGI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IDA] codon_start : 1 note : groucho-related protein 4; transducin-like enhancer of split 4; B lymphocyte gene 1 product : transducin-like enhancer protein 4 protein_id : NP_035730.2

name	LOC667300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667300
definition	number : 4 pseudo : _no_value

name	LOC667300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667300
definition	number : 3 pseudo : _no_value

name	LOC667300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667300
definition	number : 2 pseudo : _no_value

name	LOC667300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667300
definition	number : 1 pseudo : _no_value

name	LOC100041185 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041185
definition	number : 3 pseudo : _no_value

name	LOC100041185 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041185
definition	number : 2 pseudo : _no_value

name	LOC100041185 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041185
definition	number : 1 pseudo : _no_value

name	LOC671653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671653
definition	number : 3 pseudo : _no_value

name	LOC671653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671653
definition	number : 2 pseudo : _no_value

name	LOC671653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671653
definition	number : 1 pseudo : _no_value

name	EG433224 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:86198299 GeneID:433224 MGI:3645436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 47 ESTs, 8 Proteins product : predicted gene, EG433224 pseudo : _no_value transcript_id : NR_002891.1

clone name	MSMg01-445O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-109J24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-106O12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-509E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-121F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361A18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-211K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-156O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518B15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-113G03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-097J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-114O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461G02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-191C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-129F24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-091P16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-094F14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-094D16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137A08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-401E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-444G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444P15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-304B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047A09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-393M16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166P24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-478I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327A10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-251P07.b	B6Ng01-251P07.g
ACC	GA059083	GA059084
length	1,002	1,151
definition	B6Ng01-251P07.b	B6Ng01-251P07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(13,423,426 - 13,424,026)	(13,550,410 - 13,551,571)
sequence	gaattcattataccaccccaacagattcattagagcctcaatattttgcc ctacatccaggccgtacatccagggtcccactagtacttttatttctgtc tattttggcttcattttttaaaaaatcaagtgtccaaaaatgtgtgattt tatttctgggcctttgattagattccatccatcaacctgtctttttctat accaataccatgcaaatttatgcaatacagctatagatcaggaatgctga taccccctaaagttctattattgtacaggattgttttagatttcctgggt tttcgtttttccatatgaagtagaaaattgttctatcatggtctgtaaag acgtttgtttgggattttcatgggaattgtattgaatttgtaaatttatt tttgtaaggtgtccatcaacacttgcataactcattgcacatggagaagt gaagctggtgtatctttgtaacgtttctacagtaaaacacactcggacaa ccaggtctttctatggcaaagctttttattgtttacttttcaggaagacc tcgaacccggaaaatggagctgcttaaatacccctctgtgtgatgtgtca gctcttgattagctgtttacttatcaccccactgctacactccgagatgg gcagtgacttggcacgaatttactctagcacctgcgcacattgcttgttt actagttaggcactgtgaaagccagagccatcttgtaatggtgattgttt atggctctctacatctccccctttttattttattaaaacgcaagccactc tttaatggatgaagatagaggtctaatctctagtgtgtagaaataggggc catgtcaggattggctcttaggctcacaggttttacccagagcaaccctg acctgttcccatgcagtttttttttttttttttttagggggagggacact tggacactcaaatctcatgtaaattcgacttgtcttctaggagtgcccaa cc	gaattcaccaacttgcttctaatatgcaatgtagcctgctatacttggct atagtgaagattcctgtctcagtgggatgccataactttctcatggtaaa cccacctattagctagaccattgtgtatgccgttgtttgggtaagactgg ctactaagtaataagtactaagtaatcactctgcagagtagacctgagct attctagctgggttctttgtaatgcctaattagtttcactgtctcttcca agctcctcagcttcaagcattttctaggacattggaacactggtggaggc ttacctatgtcagaattcaatccttaaacattcagtaaattctctaaact gaatgctgaaactgtttacagcttaagaaaactaacaaaaaattctaagt ttgagtcaaaccagcaacactaaatattcagatgcttgttgataatggga aaatctctactggtgaaaacatatgagaataatacaacccattctcccac ctacactgcctggtggccataaagtaattagaagtcatgaaaaacagcat ctacaggatagtggtatggtgctatataatgacaaaattcatttatgttt ttcaaaacgacctcatatgtgaggttgtcactgttgtgaaaacaaggtca ttagtaccaaatgccttctctgaggtagtcacactaggaaggcaaatatg tataaaacatcaatggctgcctcacagtaataagaaaattgtttcattaa ctcttcactattaaatctcttccatctatattaatgtaatatctaaaacc aaacacttcatatatatataagaagggagaaatagaaacattaacattgt ggtgttggcatgacatttaatagaacagtttatgtgaagccttaagcaga atgtttgctctcctgtgtggaaataatatttagaaattgttttacctcta gtaaaaaataatatagaataagtccgtgcctctttactgcaagtttacca aatgtttttgtattcatcttcatgtgggtcagctttcagagattacagat gggtcatgctggtcacaaagaatacttcttgtggacagataccttctcct ctctaactctgataccaaaccttaatgttggtagacctcaagtctttcat a
quality values	Open. Hide. 62 41 31 32 62 32 24 47 62 56 62 62 62 37 23 62 62 62 47 41 62 59 44 62 59 59 62 59 36 62 62 49 24 34 28 48 50 43 33 50 51 56 62 62 49 49 62 59 62 62 62 62 62 62 59 62 49 59 49 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 54 59 62 59 59 56 54 33 33 56 59 62 59 62 62 62 59 62 62 62 62 62 62 54 54 62 59 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 54 54 54 62 54 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 44 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 58 58 58 58 54 54 37 58 58 58 54 58 58 54 47 58 54 58 58 58 58 58 54 58 58 58 54 58 58 58 58 58 54 54 58 58 58 48 54 58 58 58 58 58 58 58 54 58 58 58 54 39 58 54 58 58 54 54 54 58 58 58 58 58 58 39 42 54 58 51 58 58 58 52 58 54 51 49 58 49 51 58 58 52 58 58 58 49 51 51 58 58 58 58 50 58 50 58 58 58 58 52 58 33 39 49 58 58 58 51 58 53 53 58 48 48 58 58 51 39 53 35 44 44 58 50 53 58 54 52 51 58 58 51 51 53 53 52 52 54 51 58 54 39 46 53 52 39 51 47 54 52 58 51 54 51 58 50 42 39 50 58 38 58 40 52 51 58 43 50 43 49 54 50 50 53 58 54 39 54 49 49 39 53 29 54 49 40 45 53 50 50 54 40 49 40 39 54 44 35 53 42 29 52 54 32 54 38 45 42 53 54 33 45 53 39 41 42 34 53 37 53 40 31 25 54 54 54 54 40 54 54 54 37 42 40 54 54 44 46 37 41 39 54 54 51 44 36 33 27 53 32 40 41 32 45 53 53 53 49 22 21 38 31 29 29 34 29 32 34 33 30 31 19 32 31 39 18 33 30 32 42 30 30 32 31 42 43 36 38 32 43 45 31 51 26 30 22 46 51 31 34 31 9 51 51 27 21 34 29 31 30 30 31 33 33 44 32 22 29 22 36 27 37 31 43 31 17 22 14 27 41 34 23 30 9 6 30 20 47 47 46 12 31 41 25 23 20 38 25 32 32 31 36 46 21 31 29 31 20 27 31 38 8 31 27 46 33 27 27 33 34 16 14 33 48 48 48 48 46 46 46 44 43 44 48 48 48 44 44 44 44 24 13 10 44 48 43 7 9 12 44 20 22 15 19 31 23 31 14 26 8 13 9 11 17 26 31 44 24 27 27 34 27 10 12 37 32 27 36 33 14 6 7 19 11 27 24 31 20 21 24 19 31 25 22 11 11 6 19 6 16 14 15 36 25 12 30 26 36	Open. Hide. 62 59 51 47 62 59 41 62 59 59 51 45 51 46 34 32 32 59 62 54 56 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 59 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 49 62 46 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 58 58 58 58 58 45 52 58 58 58 58 58 54 58 54 58 58 54 58 58 58 58 58 58 58 54 58 54 58 58 58 51 58 58 54 51 58 58 54 58 58 54 51 58 58 51 58 58 58 58 53 52 58 58 58 58 50 58 40 58 58 58 53 58 53 52 58 54 58 58 47 58 32 58 58 52 51 49 39 58 58 54 51 58 54 58 58 58 58 41 51 40 58 51 58 48 49 53 51 51 51 49 54 50 42 44 34 58 51 44 58 44 39 42 46 53 53 53 58 54 41 15 58 40 53 52 52 53 39 50 52 54 47 51 43 46 49 42 29 54 40 40 54 54 53 52 51 54 51 54 53 49 54 54 51 49 44 54 51 32 54 49 54 49 40 54 49 39 42 54 42 40 42 40 31 37 51 39 41 35 49 37 54 54 54 52 34 54 54 54 54 53 38 31 53 53 33 33 41 53 53 53 51 41 31 41 37 51 53 52 52 49 47 53 53 53 52 40 32 31 47 31 45 53 37 52 52 22 29 51 52 51 32 51 32 53 53 52 52 52 51 35 31 46 46 31 30 32 20 46 26 32 29 31 46 51 35 28 45 30 42 30 34 27 43 31 45 31 37 32 51 31 31 47 36 24 21 46 46 33 31 30 30 36 46 31 31 26 25 46 32 41 28 21 27 43 43 26 46 42 32 42 31 31 36 36 26 24 37 33 23 20 24 37 47 26 31 38 31 28 31 48 37 36 31 31 41 48 36 36 32 32 29 26 32 30 34 31 31 20 38 13 25 20 24 18 13 26 31 31 38 31 48 31 30 21 27 27 31 23 27 22 32 18 31 30 30 37 29 48 30 17 16 11 21 29 19 47 29 30 13 33 48 28 17 12 29 33 34 39 28 22 21 19 20 15 6 10 25 21 20 43 48 43 47 12 32 15 30 22 25 25 21 18 13 25 17 15 15 23 28 18 26 13 6 6 18 18 25 25 16 38 28 12 13 19 28 20 10 20 17 16 18 15 19 8 11 3 29 22 6 18 15 47 47 29 13 13 6 16 10 24 28 15 28 17 11 13 12 13 18 7 9 3 32 8 11 16 21 10 22 22 28 22 8 5 7 13 2 3 3 7 7 18 15 14 12 9 15 28 18 6 13 11 10 7 17 4 9 11 3 4 9 3 3 20 17 16 23 4 4 3 3 3 4 18 5 17 10 4 5 7 3 4 10 4 2 6 5 12 7 17 12 11 6 6 9 10 5 4 6 11 6 4 6 6 4 7 10 7 10 7 2 2 3 18 4 5 4 4 14 7 17 4 7 3 4 4 5 2 4 6 21 7 5 6 5 4 6 4 1 5 7 8 6 11 5 7 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_13423426_13424026
seq2: B6Ng01-251P07.b_43_643

seq1  GAATTCATTATACCACCCCAACAGATTCATTAGAGCCTCAATATTTTGCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTATACCACCCCAACAGATTCATTAGAGCCTCAATATTTTGCC  50

seq1  CTACATCCAGGCCGTACATCCAGGGTCCCACTAGTACTTTTATTTCTGTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACATCCAGGCCGTACATCCAGGGTCCCACTAGTACTTTTATTTCTGTC  100

seq1  TATTTTGGCTTCATTTTTTAAAAAATCAAGTGTCCAAAAATGTGTGATTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTGGCTTCATTTTTTAAAAAATCAAGTGTCCAAAAATGTGTGATTT  150

seq1  TATTTCTGGGCCTTTGATTAGATTCCATCCATCAACCTGTCTTTTTCTAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTCTGGGCCTTTGATTAGATTCCATCCATCAACCTGTCTTTTTCTAT  200

seq1  ACCAATACCATGCAAATTTATGCAATACAGCTATAGATCAGGAATGCTGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAATACCATGCAAATTTATGCAATACAGCTATAGATCAGGAATGCTGA  250

seq1  TACCCCCTAAAGTTCTATTATTGTACAGGATTGTTTTAGATTTCCTGGGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCCCCTAAAGTTCTATTATTGTACAGGATTGTTTTAGATTTCCTGGGT  300

seq1  TTTCGTTTTTCCATATGAAGTAGAAAATTGTTCTATCATGGTCTGTAAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCGTTTTTCCATATGAAGTAGAAAATTGTTCTATCATGGTCTGTAAAG  350

seq1  ACGTTTGTTTGGGATTTTCATGGGAATTGTATTGAATTTGTAAATTTATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGTTTGTTTGGGATTTTCATGGGAATTGTATTGAATTTGTAAATTTATT  400

seq1  TTTGTAAGGTGTCCATCAACACTTGCATAACTCATTGCACATGGAGAAGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTAAGGTGTCCATCAACACTTGCATAACTCATTGCACATGGAGAAGT  450

seq1  GAAGCTGGTGTATCTTTGTAACGTTTCTACAGTAAAACACACTCGGACAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCTGGTGTATCTTTGTAACGTTTCTACAGTAAAACACACTCGGACAA  500

seq1  CCAGGTCTTTCTATGGCAAAGCTTTTTATTGTTTACTTTTCAGGAAGACC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGTCTTTCTATGGCAAAGCTTTTTATTGTTTACTTTTCAGGAAGACC  550

seq1  TCGAACCCGGAAAATGGAGCTGCTTAAATACCCCTCTGTGTGATGTGTCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGAACCCGGAAAATGGAGCTGCTTAAATACCCCTCTGTGTGATGTGTCA  600

seq1  G  601
      |
seq2  G  601

seq1: chr19_13550410_13551571
seq2: B6Ng01-251P07.g_63_1213 (reverse)

seq1  TATG-AAGACTTGGAGTCTAACAAACATTAAGTGTTTTGGTTATCAGAGT  49
      |||| ||||||||  |||| || ||||||||| ||||  | |||||||||
seq2  TATGAAAGACTTGAGGTCT-ACCAACATTAAG-GTTT--GGTATCAGAGT  46

seq1  TAGAGA-GAGAA-GTATCCTTGTTCCACAAGAAGGTATCTTTGGTTGACC  97
      |||||| ||||| |||||  || |||||||||||   ||||||  |||||
seq2  TAGAGAGGAGAAGGTATC--TG-TCCACAAGAAGTATTCTTTG--TGACC  91

seq1  AGGCATGGACCCATCTGTAAATTCTTCTGAAAAGCTGACCAACATGAAGA  147
      | |||| |||||||||||||  || |||| |||||||||| |||||||||
seq2  A-GCAT-GACCCATCTGTAA--TC-TCTG-AAAGCTGACCCACATGAAGA  135

seq1  TGAATACAAAACATTTTGGTAAACTTGCAGTAAAGAGGCACGGACTTATT  197
      |||||||||||   ||||||||||||||||||||||||||||||||||||
seq2  TGAATACAAAAACATTTGGTAAACTTGCAGTAAAGAGGCACGGACTTATT  185

seq1  CTATATTA-TTTTTACTAGAGGTAAAACAATTTCTAAATATTATTTCCAC  246
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  CTATATTATTTTTTACTAGAGGTAAAACAATTTCTAAATATTATTTCCAC  235

seq1  ACAGGAGAGCAAACATTCTGCTTAAGGCTTCACATAAACTGTTCTATTAA  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGAGAGCAAACATTCTGCTTAAGGCTTCACATAAACTGTTCTATTAA  285

seq1  ATGTCATGCCAACACCACAATGTTAATGTTTCTATTTCTCCCTTCTTATA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCATGCCAACACCACAATGTTAATGTTTCTATTTCTCCCTTCTTATA  335

seq1  TATATATGAAGTGTTTGGTTTTAGATATTACATTAATATAGATGGAAGAG  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATATGAAGTGTTTGGTTTTAGATATTACATTAATATAGATGGAAGAG  385

seq1  ATTTAATAGTGAAGAGTTAATGAAACAATTTTCTTATTACTGTGAGGCAG  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAATAGTGAAGAGTTAATGAAACAATTTTCTTATTACTGTGAGGCAG  435

seq1  CCATTGATGTTTTATACATATTTGCCTTCCTAGTGTGACTACCTCAGAGA  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTGATGTTTTATACATATTTGCCTTCCTAGTGTGACTACCTCAGAGA  485

seq1  AGGCATTTGGTACTAATGACCTTGTTTTCACAACAGTGACAACCTCACAT  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCATTTGGTACTAATGACCTTGTTTTCACAACAGTGACAACCTCACAT  535

seq1  ATGAGGTCGTTTTGAAAAACATAAATGAATTTTGTCATTATATAGCACCA  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGGTCGTTTTGAAAAACATAAATGAATTTTGTCATTATATAGCACCA  585

seq1  TACCACTATCCTGTAGATGCTGTTTTTCATGACTTCTAATTACTTTATGG  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCACTATCCTGTAGATGCTGTTTTTCATGACTTCTAATTACTTTATGG  635

seq1  CCACCAGGCAGTGTAGGTGGGAGAATGGGTTGTATTATTCTCATATGTTT  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCAGGCAGTGTAGGTGGGAGAATGGGTTGTATTATTCTCATATGTTT  685

seq1  TCACCAGTAGAGATTTTCCCATTATCAACAAGCATCTGAATATTTAGTGT  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCAGTAGAGATTTTCCCATTATCAACAAGCATCTGAATATTTAGTGT  735

seq1  TGCTGGTTTGACTCAAACTTAGAATTTTTTGTTAGTTTTCTTAAGCTGTA  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGGTTTGACTCAAACTTAGAATTTTTTGTTAGTTTTCTTAAGCTGTA  785

seq1  AACAGTTTCAGCATTCAGTTTAGAGAATTTACTGAATGTTTAAGGATTGA  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGTTTCAGCATTCAGTTTAGAGAATTTACTGAATGTTTAAGGATTGA  835

seq1  ATTCTGACATAGGTAAGCCTCCACCAGTGTTCCAATGTCCTAGAAAATGC  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTGACATAGGTAAGCCTCCACCAGTGTTCCAATGTCCTAGAAAATGC  885

seq1  TTGAAGCTGAGGAGCTTGGAAGAGACAGTGAAACTAATTAGGCATTACAA  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAGCTGAGGAGCTTGGAAGAGACAGTGAAACTAATTAGGCATTACAA  935

seq1  AGAACCCAGCTAGAATAGCTCAGGTCTACTCTGCAGAGTGATTACTTAGT  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACCCAGCTAGAATAGCTCAGGTCTACTCTGCAGAGTGATTACTTAGT  985

seq1  ACTTATTACTTAGTAGCCAGTCTTACCCAAACAACGGCATACACAATGGT  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTATTACTTAGTAGCCAGTCTTACCCAAACAACGGCATACACAATGGT  1035

seq1  CTAGCTAATAGGTGGGTTTACCATGAGAAAGTTATGGCATCCCACTGAGA  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGCTAATAGGTGGGTTTACCATGAGAAAGTTATGGCATCCCACTGAGA  1085

seq1  CAGGAATCTTCACTATAGCCAAGTATAGCAGGCTACATTGCATATTAGAA  1146
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAATCTTCACTATAGCCAAGTATAGCAGGCTACATTGCATATTAGAA  1135

seq1  GCAAGTTGGTGAATTC  1162
      ||||||||||||||||
seq2  GCAAGTTGGTGAATTC  1151

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information