MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-256P02
Chromosome	19 (Build37)
Map Location	40,302,732 - 40,416,483
singlet/doublet	doublet
Overlap gene	Pdlim1, LOC435599, Sorbs1, A930028N01Rik
Upstream gene	Cyp2c29, Cyp2c38, Cyp2c39, C730004C24Rik, 9030012A22Rik, Cyp2c40, LOC100043108, LOC100042523, Cyp2c37, Cyp2c54, Cyp2c50, Cyp2c70, LOC545289, LOC676923
Downstream gene	Aldh18a1, LOC100043135, 4930521E07Rik, EG667723, Entpd1, EG667720, EG668310, EG668311, Ccnj, LOC664819, E030044B06Rik, E130314M14Rik, Zfp518, Blnk, LOC100043155, Dntt, Tmem10, Tll2, Tm9sf3, Pik3ap1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cyp2c29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13095 MGI:103238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13097 MGI:1306819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13098 MGI:1306818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C730004C24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545288 MGI:3612288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9030012A22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433247 MGI:3612287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13099 MGI:1306815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043108 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 114 ESTs, 61 Proteins

name	LOC100042523 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Cyp2c37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13096 MGI:1306806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404195 MGI:3642960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107141 MGI:2147497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c70 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226105 MGI:2385878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545289 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 82 ESTs, 28 Proteins pseudo : _no_value

name	LOC676923 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 451 ESTs, 25 Proteins

name	Pdlim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54132 MGI:1860611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435599 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Sorbs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20411 MGI:700014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	A930028N01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78438 MGI:1925688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Aldh18a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56454 MGI:1888908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043135 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 402 ESTs, 9 Proteins

name	4930521E07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67590 MGI:1914840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667723 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667723 MGI:3646027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 390 ESTs, 12 Proteins

name	Entpd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12495 MGI:102805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667720 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667720 MGI:3646024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	EG668310 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668310 MGI:3645359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	EG668311 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668311 MGI:3645360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Ccnj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240665 MGI:2443297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664819 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	E030044B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381223 MGI:2686464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	E130314M14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:449522 MGI:3053211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	Zfp518 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72672 MGI:1919922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Blnk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17060 MGI:96878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043155 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Dntt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21673 MGI:98659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmem10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226115 MGI:2657025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tll2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24087 MGI:1346044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tm9sf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107358 MGI:1914262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pik3ap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83490 MGI:1933177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116268124 GeneID:13095 MGI:103238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 29 transcript_id : NM_007815.3

name	Cyp2c38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368995 GeneID:13097 MGI:1306819
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 38 transcript_id : NM_010002.2

name	Cyp2c39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857776 GeneID:13098 MGI:1306818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 39 transcript_id : NM_010003.1

name	C730004C24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131197 GeneID:545288 MGI:3612288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C730004C24 gene transcript_id : NM_001024719.2

name	9030012A22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88319957 GeneID:433247 MGI:3612287
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030012A22 gene transcript_id : NM_001039555.1

name	Cyp2c40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857778 GeneID:13099 MGI:1306815
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 40 transcript_id : NM_010004.1

name	LOC100043108 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270538 GeneID:100043108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 9 Proteins product : similar to RIKEN cDNA C730004C24 gene, transcript variant 3 transcript_id : XM_001479736.1

name	LOC100043108 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270534 GeneID:100043108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 114 ESTs, 56 Proteins product : similar to RIKEN cDNA C730004C24 gene, transcript variant 1 transcript_id : XM_001479730.1

name	LOC100043108 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270536 GeneID:100043108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 106 ESTs, 8 Proteins product : similar to RIKEN cDNA C730004C24 gene, transcript variant 2 transcript_id : XM_001479732.1

name	LOC100043108 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270540 GeneID:100043108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 72 ESTs, 3 Proteins product : similar to RIKEN cDNA C730004C24 gene, transcript variant 4 transcript_id : XM_001479745.1

name	LOC100042523 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270464 GeneID:100042523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001478375.1

name	Cyp2c37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753579 GeneID:13096 MGI:1306806
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2. subfamily c, polypeptide 37 transcript_id : NM_010001.1

name	Cyp2c54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45504401 GeneID:404195 MGI:3642960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 54 transcript_id : NM_206537.1

name	Cyp2c50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527381 GeneID:107141 MGI:2147497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 50 transcript_id : NM_134144.1

name	Cyp2c70 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703981 GeneID:226105 MGI:2385878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 70 transcript_id : NM_145499.1

name	LOC676923 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270468 GeneID:676923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 451 ESTs, 25 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript_id : XM_001478412.1

name	Pdlim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802544 GeneID:54132 MGI:1860611
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ and LIM domain 1 (elfin) transcript_id : NM_016861.2

name	Sorbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130498 GeneID:20411 MGI:700014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorbin and SH3 domain containing 1 transcript_id : NM_009166.3

name	Sorbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78000172 GeneID:20411 MGI:700014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorbin and SH3 domain containing 1 transcript_id : NM_178362.1

name	Sorbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78000176 GeneID:20411 MGI:700014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorbin and SH3 domain containing 1 transcript_id : NM_001034963.1

name	Sorbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78000178 GeneID:20411 MGI:700014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorbin and SH3 domain containing 1 transcript_id : NM_001034962.1

name	Sorbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78000153 GeneID:20411 MGI:700014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorbin and SH3 domain containing 1 transcript_id : NM_001034964.1

name	A930028N01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270546 GeneID:78438 MGI:1925688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA A930028N01 gene transcript_id : XM_001479809.1

name	Aldh18a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24025658 GeneID:56454 MGI:1888908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 18 family, member A1 transcript_id : NM_153554.1

name	Aldh18a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790060 GeneID:56454 MGI:1888908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 18 family, member A1 transcript_id : NM_019698.1

name	LOC100043135 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270548 GeneID:100043135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 402 ESTs, 9 Proteins product : similar to tyrosine phosphatase transcript_id : XM_001479813.1

name	4930521E07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541974 GeneID:67590 MGI:1914840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930521E07 gene transcript_id : NM_026260.2

name	EG667723 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405920 GeneID:667723 MGI:3646027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 390 ESTs, 10 Proteins product : predicted gene, EG667723 transcript_id : XM_001001948.1

name	Entpd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665730 GeneID:12495 MGI:102805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 1 transcript_id : NM_009848.3

name	EG667720 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405916 GeneID:667720 MGI:3646024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG667720 transcript_id : XM_001001937.1

name	EG668310 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406003 GeneID:668310 MGI:3645359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG668310 transcript_id : XM_001000795.1

name	EG668311 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406005 GeneID:668311 MGI:3645360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG668311 transcript_id : XM_001000809.1

name	Ccnj (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348879 GeneID:240665 MGI:2443297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin J transcript_id : NM_172839.2

name	LOC664819 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270470 GeneID:664819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical LOC664819 transcript_id : XM_001478451.1

name	E030044B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406007 GeneID:381223 MGI:2686464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA E030044B06 gene transcript_id : XM_358529.3

name	E130314M14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406009 GeneID:449522 MGI:3053211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : RIKEN cDNA E130314M14 gene transcript_id : XM_001000855.1

name	Zfp518 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133507239 GeneID:72672 MGI:1919922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 518 transcript_id : NM_028319.1

name	Blnk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130752 GeneID:17060 MGI:96878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell linker transcript_id : NM_008528.4

name	Dntt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734846 GeneID:21673 MGI:98659
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxynucleotidyltransferase, terminal transcript_id : NM_009345.2

name	Dntt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734840 GeneID:21673 MGI:98659
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxynucleotidyltransferase, terminal transcript_id : NM_001043228.1

name	Tmem10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943843 GeneID:226115 MGI:2657025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 10 transcript_id : NM_153520.1

name	Tll2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385783 GeneID:24087 MGI:1346044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tolloid-like 2 transcript_id : NM_011904.2

name	Tm9sf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490411 GeneID:107358 MGI:1914262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane 9 superfamily member 3 transcript_id : NM_133352.2

name	Pik3ap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872201 GeneID:83490 MGI:1933177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoinositide-3-kinase adaptor protein 1 transcript_id : NM_031376.2

name	Cyp2c29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116268125 CCDS:CCDS29793.1 GeneID:13095 MGI:103238
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2c29 product : cytochrome P450, family 2, subfamily c, polypeptide 29 protein_id : NP_031841.3

name	Cyp2c38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789012 CCDS:CCDS29794.1 GeneID:13097 MGI:1306819
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 2c38 product : cytochrome P450, family 2, subfamily c, polypeptide 38 protein_id : NP_034132.1

name	Cyp2c39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857777 CCDS:CCDS29795.1 GeneID:13098 MGI:1306818
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : drug metabolizing enzyme; metabolizes arachidonic acid note : cytochrome P450, 2c39 product : cytochrome P450, family 2, subfamily c, polypeptide 39 protein_id : NP_034133.1

name	C730004C24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67010061 CCDS:CCDS29796.1 GeneID:545288 MGI:3612288
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC545288 protein_id : NP_001019890.1

name	9030012A22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88319958 CCDS:CCDS29797.1 GeneID:433247 MGI:3612287
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cytochrome P450 2C40 family protein_id : NP_001034644.1

name	Cyp2c40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857779 CCDS:CCDS29798.1 GeneID:13099 MGI:1306815
definition	EC_number : 1.14.14.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : drug metabolizing enzyme; metabolizes arachidonic acid note : cytochrome P450, 2c40 product : cytochrome P450, family 2, subfamily c, polypeptide 40 protein_id : NP_034134.1

name	LOC100043108 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270541 GeneID:100043108
definition	codon_start : 1 product : similar to RIKEN cDNA C730004C24 gene isoform 4 protein_id : XP_001479795.1

name	LOC100043108 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270539 GeneID:100043108
definition	codon_start : 1 product : similar to RIKEN cDNA C730004C24 gene isoform 3 protein_id : XP_001479786.1

name	LOC100043108 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270535 GeneID:100043108
definition	codon_start : 1 product : similar to RIKEN cDNA C730004C24 gene isoform 1 protein_id : XP_001479780.1

name	LOC100043108 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270537 GeneID:100043108
definition	codon_start : 1 product : similar to RIKEN cDNA C730004C24 gene isoform 2 protein_id : XP_001479782.1

name	LOC100042523 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270465 GeneID:100042523
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001478425.1

name	Cyp2c37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753580 CCDS:CCDS29799.1 GeneID:13096 MGI:1306806
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : metabolizes arachidonic acid note : cytochrome P450, 2c37 product : cytochrome P450, family 2. subfamily c, polypeptide 37 protein_id : NP_034131.1

name	Cyp2c54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45504402 CCDS:CCDS29800.1 GeneID:404195 MGI:3642960
definition	codon_start : 1 function : metabolizes arachidonic acid note : ytochrome P450, family 2, subfamily c, polypeptide 54 product : cytochrome P450 protein_id : NP_996260.1

name	Cyp2c50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527382 CCDS:CCDS29801.1 GeneID:107141 MGI:2147497
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 2c50 product : cytochrome P450, family 2, subfamily c, polypeptide 50 protein_id : NP_598905.1

name	Cyp2c70 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703982 GeneID:226105 MGI:2385878
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence ISS] [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450 2C70 product : cytochrome P450, family 2, subfamily c, polypeptide 70 protein_id : NP_663474.1

name	LOC676923 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270469 GeneID:676923
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein_id : XP_001478462.1

name	Pdlim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393150 GeneID:54132 MGI:1860611
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy product : carboxyl terminal LIM domain protein 1 protein_id : NP_058557.1

name	Sorbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78000177 GeneID:20411 MGI:700014
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005924 - cell-substrate adherens junction [Evidence IDA]; GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005158 - insulin receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA] GO_process : GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0015758 - glucose transport [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0043149 - stress fiber formation [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; ponsin; SH3 domain protein 5; c-Cbl-associated protein product : sorbin and SH3 domain containing 1 isoform 4 protein_id : NP_001030135.1

name	Sorbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78000175 GeneID:20411 MGI:700014
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005924 - cell-substrate adherens junction [Evidence IDA]; GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005158 - insulin receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA] GO_process : GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0015758 - glucose transport [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0043149 - stress fiber formation [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ponsin; SH3 domain protein 5; c-Cbl-associated protein product : sorbin and SH3 domain containing 1 isoform 1 protein_id : NP_033192.2

name	Sorbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78000154 GeneID:20411 MGI:700014
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005924 - cell-substrate adherens junction [Evidence IDA]; GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005158 - insulin receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA] GO_process : GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0015758 - glucose transport [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0043149 - stress fiber formation [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 5 is encoded by transcript variant 5; ponsin; SH3 domain protein 5; c-Cbl-associated protein product : sorbin and SH3 domain containing 1 isoform 5 protein_id : NP_001030136.1

name	Sorbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78000173 GeneID:20411 MGI:700014
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005924 - cell-substrate adherens junction [Evidence IDA]; GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005158 - insulin receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA] GO_process : GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0015758 - glucose transport [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0043149 - stress fiber formation [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ponsin; SH3 domain protein 5; c-Cbl-associated protein product : sorbin and SH3 domain containing 1 isoform 2 protein_id : NP_848139.1

name	Sorbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78000179 GeneID:20411 MGI:700014
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005924 - cell-substrate adherens junction [Evidence IDA]; GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005158 - insulin receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA] GO_process : GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0015758 - glucose transport [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0043149 - stress fiber formation [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; ponsin; SH3 domain protein 5; c-Cbl-associated protein product : sorbin and SH3 domain containing 1 isoform 3 protein_id : NP_001030134.1

name	A930028N01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270547 GeneID:78438 MGI:1925688
definition	codon_start : 1 product : hypothetical protein LOC78438 protein_id : XP_001479859.1

name	Aldh18a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24025659 GeneID:56454 MGI:1888908
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004349 - glutamate 5-kinase activity [Evidence IGI] [Evidence IDA]; GO:0004350 - glutamate-5-semialdehyde dehydrogenase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence TAS]; GO:0006561 - proline biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation function : catalyzes NADPH-, ATP-dependent conversion of L-glutamate to P5C note : isoform 2 is encoded by transcript variant 2; glutamate gamma-semialdehyde synthetase; pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase) product : pyrroline-5-carboxylate synthetase isoform 2 protein_id : NP_705782.1

name	Aldh18a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790061 CCDS:CCDS29803.1 GeneID:56454 MGI:1888908
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004349 - glutamate 5-kinase activity [Evidence IGI] [Evidence IDA]; GO:0004350 - glutamate-5-semialdehyde dehydrogenase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence TAS]; GO:0006561 - proline biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation function : catalyzes NADPH-, ATP-dependent conversion of L-glutamate to P5C note : isoform 1 is encoded by transcript variant 1; glutamate gamma-semialdehyde synthetase; pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase) product : pyrroline-5-carboxylate synthetase isoform 1 protein_id : NP_062672.1

name	LOC100043135 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270549 GeneID:100043135
definition	codon_start : 1 product : similar to tyrosine phosphatase protein_id : XP_001479863.1

name	4930521E07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541975 CCDS:CCDS29804.1 GeneID:67590 MGI:1914840
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : tectonic 3 protein_id : NP_080536.2

name	EG667723 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94405921 GeneID:667723 MGI:3646027
definition	codon_start : 1 product : similar to protein tyrosine phosphatase type IVA, member 1 protein_id : XP_001001948.1

name	Entpd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753346 GeneID:12495 MGI:102805
definition	GO_component : GO:0005605 - basal lamina [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IDA] GO_process : GO:0006200 - ATP catabolism [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0030168 - platelet activation [Evidence IDA]; GO:0009181 - purine ribonucleoside diphosphate catabolism [Evidence IDA] codon_start : 1 note : CD39 antigen; ectoapyrase product : ectonucleoside triphosphate diphosphohydrolase 1 protein_id : NP_033978.1

name	EG667720 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94405917 GeneID:667720 MGI:3646024
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001937.1

name	EG668310 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406004 GeneID:668310 MGI:3645359
definition	codon_start : 1 product : similar to RIKEN cDNA 5730509K17 gene protein_id : XP_001000795.1

name	EG668311 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406006 GeneID:668311 MGI:3645360
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001000809.1

name	Ccnj (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370262 CCDS:CCDS29806.1 GeneID:240665 MGI:2443297
definition	codon_start : 1 product : cyclin J protein_id : NP_766427.1

name	LOC664819 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270471 GeneID:664819
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478501.1

name	E030044B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406008 GeneID:381223 MGI:2686464
definition	codon_start : 1 product : hypothetical protein protein_id : XP_358529.3

name	E130314M14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406010 GeneID:449522 MGI:3053211
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001000855.1

name	Zfp518 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133507240 GeneID:72672 MGI:1919922
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 518 protein_id : NP_082595.1

name	Blnk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982209 GeneID:17060 MGI:96878
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0042113 - B cell activation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : lymphocyte antigen 57; B-cell linker protein product : B-cell linker protein_id : NP_032554.2

name	Dntt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734847 CCDS:CCDS29807.1 GeneID:21673 MGI:98659
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003912 - DNA nucleotidylexotransferase activity [Evidence IDA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006259 - DNA metabolism [Evidence IDA]; GO:0006304 - DNA modification [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; terminal deoxynucleotidyl transferase product : terminal deoxynucleotidyltransferase isoform 1 protein_id : NP_033371.2

name	Dntt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734841 GeneID:21673 MGI:98659
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003912 - DNA nucleotidylexotransferase activity [Evidence IDA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006259 - DNA metabolism [Evidence IDA]; GO:0006304 - DNA modification [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; terminal deoxynucleotidyl transferase product : terminal deoxynucleotidyltransferase isoform 2 protein_id : NP_001036693.1

name	Tmem10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943844 GeneID:226115 MGI:2657025
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : transmembrane protein TMP10 product : transmembrane protein 10 protein_id : NP_705740.1

name	Tll2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755807 GeneID:24087 MGI:1346044
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 product : tolloid-like 2 protein_id : NP_036034.1

name	Tm9sf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111162 CCDS:CCDS29808.1 GeneID:107358 MGI:1914262
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : SM-11044 binding protein product : transmembrane protein 9 superfamily member 3 protein_id : NP_579930.1

name	Pik3ap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878195 GeneID:83490 MGI:1933177
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005066 - transmembrane receptor protein tyrosine kinase signaling protein activity [Evidence IDA] codon_start : 1 note : B cell phosphoinositide 3-kinase adaptor product : phosphoinositide-3-kinase adaptor protein 1 protein_id : NP_113553.1

name	LOC435599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435599
definition	number : 1 pseudo : _no_value

name	LOC100043155 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043155
definition	number : 1 pseudo : _no_value

name	LOC545289 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270467 GeneID:545289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 82 ESTs, 28 Proteins product : similar to Rev-Erb-beta pseudo : _no_value transcript_id : XR_033677.1

clone name	MSMg01-527J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379P09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-455M20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-324P05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-379H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-379H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-090M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-459P14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-357J14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-090M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-428C02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-528J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-342I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-210L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-503F20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386E09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-363E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145F14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-256P02.b	B6Ng01-256P02.g
ACC	GA062772	GA062773
length	1,137	1,065
definition	B6Ng01-256P02.b	B6Ng01-256P02.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(40,302,732 - 40,303,856)	(40,415,416 - 40,416,483)
sequence	gaattcatgagtgggcaagcaaagctcacctggagccttctggtgaagtg ccagcatcacggcaactggggagtgcttactgtggtcatagcaacggttg tgttgcacactttgtgatgtctgagcctagagcacaggtcagaaactagc ctagggttgaggtggctaccctggagcctctcttgaggtcactagccagg gttaagaaagagctgttgtgccgggcagtggtggcgcatgcctttaatcc cagcacttgggaggcagaggcaggtggatttctgagttcaaggccagcct ggtctaccgaataagttccgggacagccagggctatacagagaagcctgt ctcaaaaacaaaaaacaaaaaacaaaacaaacaaacaaacaaacaaacaa acaaaaaacttgattgttgaaaggccatctgccctaaggcaagaacaaac tcaggtgacccactgggaaggaaggtccccatcttcggtggcttacagat ccattttccttctgtggcctccagaaattcttcctcacctgccaccttgg gaacaaggtgtgtgaatgagaagagctctcacaaggtcacactgactgca ccctcaactccctaatacatgcatggctggaaacagctggccagatgcaa agctcttaaaacaactcccacatgccacaagggattgatatctaggatag ccaataaactcaaaatatcagacaccgagaacaaaacccccaccatcgaa tgaatgaatacatgagccacagaacagactgcctgtaacacaggaaaatg gtgctgagcatccgtggtcatcaggaaatgaaaattaaaaccacaatgag gttgcatccccatctctctcagaatggtttgtataaaaacaaacagcaaa cagatgctgacaagaatgtacaaaagcacccttgcacacacagctggcgg aaatgaaaattggaggcagccgctatgaaatccgtaatcagttatgaagg gttccacaaaaaaattaaaattaaaatagaaccacatgaaggaggtcaac attagccagatacttgggttcatctatgtaattattgtgacaccttgcac ggaatccattaggcacctatagagtcacgatgtccat	gaattctgtgacaaagtaagaaaggtgtgggggtaacacgtgttaaaaag tctacttccctgacagccactgagtgtattaagaggtaaaaatgaacggt cgctgctctgtcattgactttgcagagcacatacctcacatatgtggaag acctgctgttgacaggggaaacacagtcagagccagttcttttcttttgg agaggtagtacagagaccaagaggacccaccttttactctccccttccct tcagtttctacagaaattgatttgatgtctagccacaaactcaaggcaat gtttctcaatagtaatccctcgaatgtgtctgtagaattaacggacatga aacttgcatgcaatctgtggggcttttaatgatctcctgtgtctgatctc cccggaggtcatagcatggtagatctcaagtgtacacaggcagagtcaga gaatccactctgtgtgagagaagttcagagttagaagtttctggaagttt gcttagctctcactgcacacaaacccttgggaagcctacagcattctcct ggcagattttcagcgctctgattgtccatgaaggggttaaagaacaaaca tcgtgacctctgacctgccagggggagggggcggagcctgcctctagcgt tacttctgccgcctaactctacttacattatgaaaggccagttgagctgc aagcatgaaatggtcacagcactgtctgaattcctactctagatgccaat gaatcctactgtggatgccgctgccacacaccagagggtcacccttttag gtcagcctctactggacagacttacagatttacacatttattaacatgca atgattttttttctatagtaggaaagactatttaaaaatgtgaaaatctc cagggtcagtctttgtttgaagagaacaagaaagaatagagttttaattt gtttaaatccgtattgatgcttcccttccctccccccccccccttttagt ttaaatttttagtattggaactcaagggtggatttggctctgaacttaat aactttctagtcagg
quality values	Open. Hide. 58 22 31 38 62 41 21 47 62 62 62 62 62 62 54 62 51 62 62 62 62 62 62 62 62 62 47 59 59 62 62 43 26 20 27 28 28 36 43 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 59 46 62 62 59 56 42 43 54 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 54 62 59 59 62 62 62 62 62 59 59 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 46 56 62 62 62 62 62 62 62 56 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 58 58 58 54 58 54 58 58 58 58 58 54 45 58 58 58 45 46 58 58 58 58 45 54 58 58 58 42 41 58 58 54 42 54 50 58 58 58 58 54 58 58 58 58 54 38 54 58 58 58 58 58 58 52 54 48 54 58 58 58 58 54 54 58 58 58 58 58 54 58 58 58 58 51 58 51 50 58 58 58 58 53 53 58 58 47 46 54 58 54 58 58 58 58 54 50 58 58 58 58 58 38 42 58 58 58 51 51 58 58 58 51 50 40 49 41 58 54 58 58 58 58 51 58 32 50 58 58 50 58 58 50 58 50 51 58 53 58 49 50 49 48 50 49 58 50 51 52 50 51 51 49 58 39 58 43 58 46 50 58 58 58 58 58 38 51 51 54 58 58 41 39 41 54 58 53 58 40 58 58 58 41 52 58 58 47 54 54 54 53 54 38 45 42 49 51 51 54 54 32 54 42 53 54 38 51 50 35 44 52 52 51 54 53 49 42 39 44 42 50 40 39 46 49 51 53 54 52 39 47 27 39 47 51 46 38 52 40 33 27 54 54 33 26 53 53 33 37 31 41 53 42 52 40 54 33 33 45 34 33 41 34 53 39 33 33 44 45 53 53 32 51 49 32 32 43 45 45 45 37 53 31 31 42 51 30 37 31 51 41 41 30 47 52 42 53 53 53 53 52 32 53 53 31 52 45 31 46 31 39 42 33 31 42 38 31 41 31 35 51 24 45 43 37 17 41 45 31 45 31 28 36 38 38 31 31 31 31 35 45 31 33 21 37 36 33 31 33 28 31 27 31 42 42 46 47 17 14 41 46 30 38 36 37 30 31 12 42 31 43 32 46 28 15 31 42 31 43 33 38 31 6 10 10 23 47 21 23 32 34 46 46 37 32 18 21 39 41 19 28 43 34 41 14 18 30 41 29 25 13 30 25 36 42 28 36 22 41 41 31 26 43 36 36 37 37 36 34 33 20 10 33 20 25 30 38 7 43 17 37 32 29 15 18 43 44 48 25 31 23 42 33 18 17 26 22 9 29 10 26 16 20 19 27 38 34 38 32 23 21 16 27 20 14 12 24 32 27 24 22 24 39 31 33 20 32 15 32 48 33 30 29 32 23 9 21 27 32 16 29 15 9 16 32 13 26 9 11 8 33 48 34 32 27 32 48 43 33 10 10 33 32 25 10 26 17 20 16 27 16 20 16 9 8 31 8 15 30 21 27 16 15 25 27 27 28 25 26 20 19 20 12 18 19 14 12 21 6 28 15 7 13 27 27 6 18 19 6 27 28 16 30 26 11 16 8 38 29 28 11 11 10 15 17 5 5 4 8 10 11 13 14 13 11 6 6 7 9 5 5 2 10 17 15 13 19 9 10 23 8 16 17 21 17 8 12 6 7 21 7 8 10 10 6 8 18 17 4 6 11 8 16 15 5 15 12 16 12 6 9 17 4 4 12 20 17 5 12 12 6 8 5 21 5 9 6 4 6 23 8 7 10 10 21 8 6 10 3 4 5 6 3 5 3 2 3 9 3 4 3 1 2 4 6 7 3 5 3 3 2 2 5 4 11 4 5	Open. Hide. 62 31 43 38 62 62 54 62 62 62 37 33 22 19 21 16 26 28 32 31 51 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 59 62 62 59 62 59 59 35 28 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 40 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 48 62 62 62 62 62 42 62 62 53 62 62 62 47 62 62 62 62 62 62 62 62 58 54 58 52 58 58 52 58 58 54 54 52 58 42 54 54 54 54 58 58 52 58 58 58 58 58 58 58 58 54 52 58 58 58 58 52 58 58 58 52 58 58 58 58 52 52 53 54 58 58 54 54 52 54 54 58 54 58 58 58 58 54 54 58 58 58 54 52 52 58 54 58 49 52 41 52 52 53 58 58 54 51 58 58 58 45 47 58 49 46 58 58 54 46 53 32 50 58 51 58 58 58 51 58 46 38 58 58 46 54 53 34 58 58 58 37 32 58 58 47 49 53 51 58 48 46 58 44 46 39 54 58 51 50 58 53 46 53 58 34 40 50 49 58 49 58 49 35 58 50 58 46 39 40 50 58 49 58 58 25 10 58 58 49 48 40 54 49 36 18 51 54 52 54 50 52 42 58 53 53 39 49 50 52 51 33 39 53 58 52 53 47 37 46 43 43 33 39 41 36 50 53 52 39 32 39 39 53 38 50 30 53 53 43 42 54 51 54 38 50 38 16 40 35 41 35 54 42 54 21 47 49 52 49 46 39 42 45 35 45 53 53 54 45 41 54 44 30 45 36 40 25 37 40 24 35 45 53 32 47 40 42 53 51 37 54 33 46 33 37 33 40 45 32 33 32 32 32 37 25 53 39 29 33 37 37 38 33 31 53 32 32 32 21 53 34 40 32 21 20 39 36 38 32 32 40 32 41 52 27 52 34 32 25 42 31 30 34 41 10 53 53 28 45 21 18 40 40 31 51 51 42 37 26 38 23 33 33 17 33 30 21 32 28 20 29 29 19 31 26 26 17 33 32 23 28 46 24 18 25 24 31 20 46 38 17 30 26 31 27 36 48 33 28 37 31 14 14 9 13 42 37 31 18 32 31 42 11 9 46 46 30 41 42 32 24 17 20 29 15 13 19 11 29 12 24 24 41 19 11 14 12 37 18 31 46 28 44 44 41 41 22 14 32 19 32 19 46 48 35 21 27 34 32 39 16 27 48 48 14 32 28 24 32 31 31 48 33 38 37 48 13 14 14 30 21 31 8 22 17 26 18 19 31 38 44 38 27 31 33 29 10 5 13 19 32 39 39 26 9 11 17 36 16 11 7 21 6 7 43 31 16 6 19 8 43 11 7 12 18 24 8 20 15 13 14 15 43 22 6 6 48 37 30 16 19 12 28 31 30 34 33 28 27 28 14 11 5 34 34 17 26 7 21 19 7 12 34 29 24 38 40 31 28 27 20 28 16 20 28 23 7 7 4 4 8 8 4 11 10 28 9 11 4 5 20 13 20 27 8 13 9 14 9 27 6 10 7 7 11 12 7 8 8 5 4 4 7 17 7 21 15 7 1 4 5 6 17 17

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_40302732_40303856
seq2: B6Ng01-256P02.b_48_1184

seq1  GAATTCATGAGTGGGCAAGCAAAGCTCACCTGGAGCCTTCTGGTGAAGTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATGAGTGGGCAAGCAAAGCTCACCTGGAGCCTTCTGGTGAAGTG  50

seq1  CCAGCATCACGGCAACTGGGGAGTGCTTACTGTGGTCATAGCAACGGTTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCATCACGGCAACTGGGGAGTGCTTACTGTGGTCATAGCAACGGTTG  100

seq1  TGTTGCACACTTTGTGATGTCTGAGCCTAGAGCACAGGTCAGAAACTAGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGCACACTTTGTGATGTCTGAGCCTAGAGCACAGGTCAGAAACTAGC  150

seq1  CTAGGGTTGAGGTGGCTACCCTGGAGCCTCTCTTGAGGTCACTAGCCAGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGGGTTGAGGTGGCTACCCTGGAGCCTCTCTTGAGGTCACTAGCCAGG  200

seq1  GTTAAGAAAGAGCTGTTGTGCCGGGCAGTGGTGGCGCATGCCTTTAATCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAAGAAAGAGCTGTTGTGCCGGGCAGTGGTGGCGCATGCCTTTAATCC  250

seq1  CAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCAAGGCCAGCCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCAAGGCCAGCCT  300

seq1  GGTCTACCGAATAAGTTCCGGGACAGCCAGGGCTATACAGAGAAGCCTGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTACCGAATAAGTTCCGGGACAGCCAGGGCTATACAGAGAAGCCTGT  350

seq1  CTCAAAAACAAAAAACAAAAAACAAAACAAACAAACAAACAAACAAACAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAAAAACAAAAAACAAAAAACAAAACAAACAAACAAACAAACAAACAA  400

seq1  ACAAAAAACTTGATTGTTGAAAGGCCATCTGCCCTAAGGCAAGAACAAAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAAAACTTGATTGTTGAAAGGCCATCTGCCCTAAGGCAAGAACAAAC  450

seq1  TCAGGTGACCCACTGGGAAGGAAGGTCCCCATCTTCGGTGGCTTACAGAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGTGACCCACTGGGAAGGAAGGTCCCCATCTTCGGTGGCTTACAGAT  500

seq1  CCATTTTCCTTCTGTGGCCTCCAGAAATTCTTCCTCACCTGCCACCTTGG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTTTCCTTCTGTGGCCTCCAGAAATTCTTCCTCACCTGCCACCTTGG  550

seq1  GAACAAGGTGTGTGAATGAGAAGAGCTCTCACAAGGTCACACTGACTGCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACAAGGTGTGTGAATGAGAAGAGCTCTCACAAGGTCACACTGACTGCA  600

seq1  CCCTCAACTCCCTAATACATGCATGGCTGGAAACAGCTGGCCAGATGCAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCAACTCCCTAATACATGCATGGCTGGAAACAGCTGGCCAGATGCAA  650

seq1  AGCTCTTAAAACAACTCCCACATGCCACAAGGGATTGATATCTAGGATAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCTTAAAACAACTCCCACATGCCACAAGGGATTGATATCTAGGATAG  700

seq1  CCAATAAACTCAAAATATCAGACACCGAGAACAAAACCCCCACCATCGAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAATAAACTCAAAATATCAGACACCGAGAACAAAACCCCCACCATCGAA  750

seq1  TGAATGAATACATGAGCCACAGAACAGACTGCCTGTAACACAGGAAAATG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATGAATACATGAGCCACAGAACAGACTGCCTGTAACACAGGAAAATG  800

seq1  GTGCTGAGCATCCGTGGTCATCAGGGAAATGAAAATTAAAACCACAATGA  850
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  GTGCTGAGCATCCGTGGTCATCA-GGAAATGAAAATTAAAACCACAATGA  849

seq1  GGTTGCAT-CCCATCTCTCTCAGAATGG-TTGTATAAAAACAAACAGC-A  897
      |||||||| ||||||||||||||||||| ||||||||||||||||||| |
seq2  GGTTGCATCCCCATCTCTCTCAGAATGGTTTGTATAAAAACAAACAGCAA  899

seq1  ACAGATGCTGACAAGAATGTACAAAAGCACCCTTGCACACACAGCTGGCG  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGATGCTGACAAGAATGTACAAAAGCACCCTTGCACACACAGCTGGCG  949

seq1  GAAATGAAAA-TGGAGGCAGCCGCTATTGAAATCCGTAATCAG-TATGAA  995
      |||||||||| ||||||||||||||| |||||||||||||||| ||||||
seq2  GAAATGAAAATTGGAGGCAGCCGCTA-TGAAATCCGTAATCAGTTATGAA  998

seq1  -GGTTCCACAAAAAAAT--AAAATAAAATAGAA-CACATGAAAGGAAGGT  1041
       ||||||||||||||||  ||| |||||||||| ||||||||  | ||||
seq2  GGGTTCCACAAAAAAATTAAAATTAAAATAGAACCACATGAA--GGAGGT  1046

seq1  CAACA-TAG-CAGATACTTGG--TCATCTATGTA--TATTGTGACAC--T  1083
      ||||| ||| |||||||||||  |||||||||||  |||||||||||  |
seq2  CAACATTAGCCAGATACTTGGGTTCATCTATGTAATTATTGTGACACCTT  1096

seq1  GCACG--AT-CAATAGCCAACTTATAGAGTCAACCAGATGTCCAT  1125
      |||||  || || ||| | || ||||||||||    |||||||||
seq2  GCACGGAATCCATTAGGC-ACCTATAGAGTCA---CGATGTCCAT  1137

seq1: chr19_40415416_40416483
seq2: B6Ng01-256P02.g_69_1133 (reverse)

seq1  CCTGACTAGGAAGT--ATAAGTTTCAAGAG-CAAATCAACCCTTGAGTCT  47
      ||||||||| ||||   ||||||   |||| |||||| ||||||||||  
seq2  CCTGACTAGAAAGTTATTAAGTT--CAGAGCCAAATCCACCCTTGAGTTC  48

seq1  CAATACTAAAAATTTTAAACTAAAAGGGGGGGGGGGGAGGGGAGGGAAGC  97
      |||||||||||| |||||||||||||||||||||||||||| ||||||||
seq2  CAATACTAAAAA-TTTAAACTAAAAGGGGGGGGGGGGAGGGAAGGGAAGC  97

seq1  ATCAATAACGAATTTAAACAAATTAAAAACTCTAATTCTTTCTTGTTCTC  147
      |||||| ||| ||||||||||||| |||||||| ||||||||||||||||
seq2  ATCAAT-ACGGATTTAAACAAATT-AAAACTCT-ATTCTTTCTTGTTCTC  144

seq1  TTCAAACAAAGACTGACCCTGGAGATTTTCACATTTTTTAAATAGTCTTT  197
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  TTCAAACAAAGACTGACCCTGGAGATTTTCACA-TTTTTAAATAGTCTTT  193

seq1  CCTACTATAG-AAAAAAATCATTGCATGTTAATAAATGTGTAAATCTGTA  246
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  CCTACTATAGAAAAAAAATCATTGCATGTTAATAAATGTGTAAATCTGTA  243

seq1  AGTCTGTCCAGTAGAGGCTGACCTAAAAGGGTGACCCTCTGGTGTGTGGC  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTGTCCAGTAGAGGCTGACCTAAAAGGGTGACCCTCTGGTGTGTGGC  293

seq1  AGCGGCATCCACAGTAGGATTCATTGGCATCTAGAGTAGGAATTCAGACA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGGCATCCACAGTAGGATTCATTGGCATCTAGAGTAGGAATTCAGACA  343

seq1  GTGCTGTGACCATTTCATGCTTGCAGCTCAACTGGCCTTTCATAATGTAA  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTGTGACCATTTCATGCTTGCAGCTCAACTGGCCTTTCATAATGTAA  393

seq1  GTAGAGTTAGGCGGCAGAAGTAACGCTAGAGGCAGGCTCCGCCCCCTCCC  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGAGTTAGGCGGCAGAAGTAACGCTAGAGGCAGGCTCCGCCCCCTCCC  443

seq1  CCTGGCAGGTCAGAGGTCACGATGTTTGTTCTTTAACCCCTTCATGGACA  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGCAGGTCAGAGGTCACGATGTTTGTTCTTTAACCCCTTCATGGACA  493

seq1  ATCAGAGCGCTGAAAATCTGCCAGGAGAATGCTGTAGGCTTCCCAAGGGT  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGAGCGCTGAAAATCTGCCAGGAGAATGCTGTAGGCTTCCCAAGGGT  543

seq1  TTGTGTGCAGTGAGAGCTAAGCAAACTTCCAGAAACTTCTAACTCTGAAC  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGTGCAGTGAGAGCTAAGCAAACTTCCAGAAACTTCTAACTCTGAAC  593

seq1  TTCTCTCACACAGAGTGGATTCTCTGACTCTGCCTGTGTACACTTGAGAT  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCTCACACAGAGTGGATTCTCTGACTCTGCCTGTGTACACTTGAGAT  643

seq1  CTACCATGCTATGACCTCCGGGGAGATCAGACACAGGAGATCATTAAAAG  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCATGCTATGACCTCCGGGGAGATCAGACACAGGAGATCATTAAAAG  693

seq1  CCCCACAGATTGCATGCAAGTTTCATGTCCGTTAATTCTACAGACACATT  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCACAGATTGCATGCAAGTTTCATGTCCGTTAATTCTACAGACACATT  743

seq1  CGAGGGATTACTATTGAGAAACATTGCCTTGAGTTTGTGGCTAGACATCA  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGGGATTACTATTGAGAAACATTGCCTTGAGTTTGTGGCTAGACATCA  793

seq1  AATCAATTTCTGTAGAAACTGAAGGGAAGGGGAGAGTAAAAGGTGGGTCC  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCAATTTCTGTAGAAACTGAAGGGAAGGGGAGAGTAAAAGGTGGGTCC  843

seq1  TCTTGGTCTCTGTACTACCTCTCCAAAAGAAAAGAACTGGCTCTGACTGT  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGGTCTCTGTACTACCTCTCCAAAAGAAAAGAACTGGCTCTGACTGT  893

seq1  GTTTCCCCTGTCAACAGCAGGTCTTCCACATATGTGAGGTATGTGCTCTG  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCCCCTGTCAACAGCAGGTCTTCCACATATGTGAGGTATGTGCTCTG  943

seq1  CAAAGTCAATGACAGAGCAGCGACCGTTCATTTTTACCTCTTAATACACT  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGTCAATGACAGAGCAGCGACCGTTCATTTTTACCTCTTAATACACT  993

seq1  CAGTGGCTGTCAGGGAAGTAGACTTTTTAACACGTGTTACCCCCACACCT  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGGCTGTCAGGGAAGTAGACTTTTTAACACGTGTTACCCCCACACCT  1043

seq1  TTCTTACTTTGTCACAGAATTC  1068
      ||||||||||||||||||||||
seq2  TTCTTACTTTGTCACAGAATTC  1065

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information