MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-257C16
Chromosome	19 (Build37)	15 (Build37)
Map Location	9,829,812 - 9,830,340	21,710,962 - 21,712,048
singlet/doublet	singlet	singlet
Overlap gene	none
Upstream gene	Stx5a, LOC100039902, Nxf1, 0610006I08Rik, 1810059G22Rik, Taf6l, LOC100039957, Polr2g, Zbtb3, Ttc9c, Hnrpul2, Gng3, Bscl2, 1110067I12Rik, D19Ertd721e, AI462493, 1810009A15Rik, Ints5, Ganab, B3gat3, Rom1, Eml3, Mta2, Tut1, Eef1g, Ahnak, Scgb1a1, Asrgl1, EG621699, LOC100040104, LOC623810, Pcna-ps2, LOC100040130, LOC100040137, LOC100040143, LOC100040152, Stxbp3b, LOC623688, LOC100040178, LOC100040192
Downstream gene	6720475J19Rik, LOC100040203, Incenp, LOC100040215, Fth1, Best1, Rab3il1, Fads3, Fads2, LOC100040227, Fads1, Fen1, 1810006K21Rik, Gm98, Dagla, Syt7, Gm705, 4930579J09Rik, 0610038F07Rik, 5730453I16Rik, 2810441K11Rik, Tmem138, Cybasc3, Dak, Ddb1, Vwce, Pga5, 2210404E10Rik, Vps37c, Cd5
Link	Open Mouse BAC browser

Click to get alignment info.

name	Stx5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56389 MGI:1928483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039902 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039902
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Nxf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53319 MGI:1858330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610006I08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66836 MGI:1914086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810059G22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67706 MGI:1914956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf6l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225895 MGI:2444957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039957 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Polr2g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67710 MGI:1914960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75291 MGI:1922541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc9c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70387 MGI:1917637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpul2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68693 MGI:1915943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gng3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14704 MGI:102704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bscl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14705 MGI:1298392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110067I12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68852 MGI:1916102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D19Ertd721e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225896 MGI:1289301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI462493 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107197 MGI:2147553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 91 ESTs, 1 Protein

name	1810009A15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66276 MGI:1913526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ints5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109077 MGI:1923578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ganab (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14376 MGI:1097667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gat3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72727 MGI:1919977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rom1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19881 MGI:97998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eml3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225898 MGI:2387612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mta2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23942 MGI:1346340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tut1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70044 MGI:1917294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eef1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67160 MGI:1914410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ahnak (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66395 MGI:1316648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Scgb1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22287 MGI:98919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asrgl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66514 MGI:1913764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621699 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621699 MGI:3644748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1534 ESTs, 5 Proteins

name	LOC100040104 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC623810 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Pcna-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18540 MGI:97505
definition	note : proliferating cell nuclear antigen pseudogene 2 pseudo : _no_value

name	LOC100040130 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040137 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100040143 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040152 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Stxbp3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619371 MGI:3586869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 3 Proteins

name	LOC623688 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100040178 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100040192 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	6720475J19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68157 MGI:1915407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 42 ESTs

name	LOC100040203 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Incenp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16319 MGI:1313288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040215 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Fth1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14319 MGI:95588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Best1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24115 MGI:1346332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab3il1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74760 MGI:1922010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fads3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60527 MGI:1928740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fads2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56473 MGI:1930079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040227 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Fads1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76267 MGI:1923517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fen1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14156 MGI:102779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810006K21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69038 MGI:1916288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 78 ESTs, 2 Proteins

name	Gm98 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225908 MGI:2684944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 41 ESTs, 1 Protein

name	Dagla (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269060 MGI:2677061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syt7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54525 MGI:1859545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Gm705 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278795 MGI:2685551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins

name	4930579J09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67752 MGI:1915002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610038F07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66072 MGI:1913322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730453I16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269061 MGI:1917826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810441K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68642 MGI:1920020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem138 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72982 MGI:1920232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cybasc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225912 MGI:2686925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dak (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225913 MGI:2385084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13194 MGI:1202384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vwce (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71768 MGI:1919018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein

name	Pga5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58803 MGI:1915935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210404E10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72305 MGI:1919555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Vps37c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107305 MGI:2147661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12507 MGI:88340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328464 GeneID:56389 MGI:1928483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 5A transcript_id : NM_019829.3

name	LOC100039902 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270343 GeneID:100039902
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039902 transcript_id : XM_001474163.1

name	Nxf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980797 GeneID:53319 MGI:1858330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear RNA export factor 1 homolog (S. cerevisiae) transcript_id : NM_016813.2

name	0610006I08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385261 GeneID:66836 MGI:1914086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610006I08 gene transcript_id : NM_025791.1

name	1810059G22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353761 GeneID:67706 MGI:1914956
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810059G22 gene transcript_id : NM_026325.2

name	Taf6l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122596 GeneID:225895 MGI:2444957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor transcript_id : NM_146092.1

name	Polr2g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802245 GeneID:67710 MGI:1914960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide G transcript_id : NM_026329.2

name	Zbtb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802199 GeneID:75291 MGI:1922541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 3 transcript_id : NM_133759.2

name	Ttc9c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378463 GeneID:70387 MGI:1917637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 9C transcript_id : NM_027412.3

name	Hnrpul2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487098 GeneID:68693 MGI:1915943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein U-like 2 transcript_id : NM_001081196.1

name	Gng3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579907 GeneID:14704 MGI:102704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma 3 subunit transcript_id : NM_010316.3

name	Bscl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475903 GeneID:14705 MGI:1298392
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bernardinelli-Seip congenital lipodystrophy 2 homolog (human) transcript_id : NM_008144.3

name	1110067I12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311555 GeneID:68852 MGI:1916102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110067I12 gene transcript_id : NM_001013019.2

name	D19Ertd721e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122590 GeneID:225896 MGI:1289301
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 19, ERATO Doi 721, expressed transcript_id : NM_146093.1

name	AI462493 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405835 GeneID:107197 MGI:2147553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 91 ESTs, 1 Protein product : expressed sequence AI462493, transcript variant 1 transcript_id : XM_887080.2

name	1810009A15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370464 GeneID:66276 MGI:1913526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810009A15 gene transcript_id : NM_025463.2

name	Ints5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341150 GeneID:109077 MGI:1923578
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrator complex subunit 5 transcript_id : NM_176843.2

name	Ganab (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679890 GeneID:14376 MGI:1097667
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha glucosidase 2 alpha neutral subunit transcript_id : NM_008060.1

name	B3gat3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980750 GeneID:72727 MGI:1919977
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) transcript_id : NM_024256.2

name	Rom1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374669 GeneID:19881 MGI:97998
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rod outer segment membrane protein 1 transcript_id : NM_009073.3

name	Eml3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450110 GeneID:225898 MGI:2387612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : echinoderm microtubule associated protein like 3 transcript_id : NM_144872.1

name	Mta2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491879 GeneID:23942 MGI:1346340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : metastasis-associated gene family, member 2 transcript_id : NM_011842.3

name	Tut1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350735 GeneID:70044 MGI:1917294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : terminal uridylyl transferase 1, U6 snRNA-specific transcript_id : NM_197993.2

name	Eef1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345473 GeneID:67160 MGI:1914410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation elongation factor 1 gamma transcript_id : NM_026007.4

name	Ahnak (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90403606 GeneID:66395 MGI:1316648
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AHNAK nucleoprotein (desmoyokin) transcript_id : NM_001039959.1

name	Ahnak (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61743960 GeneID:66395 MGI:1316648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AHNAK nucleoprotein (desmoyokin) transcript_id : NM_009643.1

name	Scgb1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053927 GeneID:22287 MGI:98919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretoglobin, family 1A, member 1 (uteroglobin) transcript_id : NM_011681.2

name	Asrgl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803298 GeneID:66514 MGI:1913764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asparaginase like 1 transcript_id : NM_025610.3

name	LOC100040104 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270349 GeneID:100040104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040104 transcript_id : XM_001474095.1

name	LOC623810 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270351 GeneID:623810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to steroid-binding protein C1 transcript_id : XM_001474111.1

name	LOC100040130 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270353 GeneID:100040130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to prostatic steroid binding protein transcript_id : XM_001474129.1

name	LOC100040137 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270355 GeneID:100040137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to steroid-binding protein C1 transcript_id : XM_001474140.1

name	LOC100040143 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270357 GeneID:100040143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to steroid-binding protein C1 transcript_id : XM_001474156.1

name	LOC100040152 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270359 GeneID:100040152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to pol protein transcript_id : XM_001474171.1

name	Stxbp3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270361 GeneID:619371 MGI:3586869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 3 Proteins product : syntaxin-binding protein 3B transcript_id : XM_001474190.1

name	LOC623688 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270363 GeneID:623688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to prostatic steroid binding protein transcript_id : XM_001474206.1

name	LOC100040178 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270365 GeneID:100040178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to prostatic steroid-binding protein C1 chain transcript_id : XM_001474226.1

name	LOC100040192 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270367 GeneID:100040192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040192 transcript_id : XM_001474243.1

name	6720475J19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270376 GeneID:68157 MGI:1915407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 42 ESTs product : RIKEN cDNA 6720475J19 gene transcript_id : XM_001474896.1

name	LOC100040203 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270369 GeneID:100040203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to prostatein C3 subunit transcript_id : XM_001474259.1

name	Incenp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710039 GeneID:16319 MGI:1313288
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inner centromere protein transcript_id : NM_016692.1

name	LOC100040215 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270371 GeneID:100040215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040215 transcript_id : XM_001474300.1

name	Fth1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753911 GeneID:14319 MGI:95588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ferritin heavy chain 1 transcript_id : NM_010239.1

name	Best1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50233764 GeneID:24115 MGI:1346332
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bestrophin 1 transcript_id : NM_011913.1

name	Rab3il1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239979 GeneID:74760 MGI:1922010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB3A interacting protein (rabin3)-like 1 transcript_id : NM_144538.2

name	Fads3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887800 GeneID:60527 MGI:1928740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid desaturase 3 transcript_id : NM_021890.3

name	Fads2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790070 GeneID:56473 MGI:1930079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid desaturase 2 transcript_id : NM_019699.1

name	Fads1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22164783 GeneID:76267 MGI:1923517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid desaturase 1 transcript_id : NM_146094.1

name	Fen1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47132513 GeneID:14156 MGI:102779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flap structure specific endonuclease 1 transcript_id : NM_007999.3

name	1810006K21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270373 GeneID:69038 MGI:1916288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 78 ESTs, 2 Proteins product : RIKEN cDNA 1810006K21 gene transcript_id : XM_622862.4

name	Gm98 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270386 GeneID:225908 MGI:2684944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 41 ESTs, 1 Protein product : gene model 98, (NCBI), transcript variant 2 transcript_id : XM_888586.3

name	Dagla (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674270 GeneID:269060 MGI:2677061
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol lipase, alpha transcript_id : NM_198114.1

name	Syt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129798 GeneID:54525 MGI:1859545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin VII transcript_id : NM_173067.2

name	Syt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281839 GeneID:54525 MGI:1859545
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin VII transcript_id : NM_173068.1

name	Syt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130738 GeneID:54525 MGI:1859545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin VII transcript_id : NM_018801.2

name	Gm705 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270374 GeneID:278795 MGI:2685551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins product : gene model 705, (NCBI) transcript_id : XM_204937.8

name	4930579J09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526857 GeneID:67752 MGI:1915002
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930579J09 gene transcript_id : NM_133689.1

name	0610038F07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828928 GeneID:66072 MGI:1913322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610038F07 gene transcript_id : NM_025333.3

name	5730453I16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982054 GeneID:269061 MGI:1917826
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730453I16 gene transcript_id : NM_172302.2

name	2810441K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312085 GeneID:68642 MGI:1920020
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810441K11 gene transcript_id : NM_026798.1

name	Tmem138 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374796 GeneID:72982 MGI:1920232
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 138 transcript_id : NM_028411.2

name	Cybasc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235723 GeneID:225912 MGI:2686925
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b, ascorbate dependent 3 transcript_id : NM_201351.1

name	Dak (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703975 GeneID:225913 MGI:2385084
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydroxyacetone kinase 2 homolog (yeast) transcript_id : NM_145496.1

name	Ddb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657010 GeneID:13194 MGI:1202384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : damage specific DNA binding protein 1 transcript_id : NM_015735.1

name	Vwce (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405819 GeneID:71768 MGI:1919018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein product : von Willebrand factor C and EGF domains, transcript variant 2 transcript_id : XM_889279.2

name	Pga5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378195 GeneID:58803 MGI:1915935
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pepsinogen 5, group I transcript_id : NM_021453.3

name	2210404E10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270388 GeneID:72305 MGI:1919555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 2210404E10 gene transcript_id : XM_001475568.1

name	Vps37c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340991 GeneID:107305 MGI:2147661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 37C (yeast) transcript_id : NM_181403.2

name	Cd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517488 GeneID:12507 MGI:88340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD5 antigen transcript_id : NM_007650.3

name	LOC100039902 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270344 GeneID:100039902
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474213.1

name	Nxf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980798 CCDS:CCDS29543.1 GeneID:53319 MGI:1858330
definition	GO_component : GO:0042405 - nuclear inclusion body [Evidence IDA]; GO:0005643 - nuclear pore [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005487 - nucleocytoplasmic transporter activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0016973 - poly(A)+ mRNA export from nucleus [Evidence IPI]; GO:0006405 - RNA export from nucleus [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : tip associating protein; Mex 67 homolog; tip associated protein; modifier of vibrator 1 product : nuclear RNA export factor 1 protein_id : NP_058093.2

name	0610006I08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385262 CCDS:CCDS29544.1 GeneID:66836 MGI:1914086
definition	codon_start : 1 product : hypothetical protein LOC66836 protein_id : NP_080067.1

name	1810059G22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385822 CCDS:CCDS29545.1 GeneID:67706 MGI:1914956
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67706 protein_id : NP_080601.1

name	Taf6l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122597 CCDS:CCDS29546.1 GeneID:225895 MGI:2444957
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0016986 - transcription initiation factor activity [Evidence IEA] GO_process : GO:0015671 - oxygen transport [Evidence IEA]; GO:0051090 - regulation of transcription factor activity [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006352 - transcription initiation [Evidence IEA] codon_start : 1 product : TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor protein_id : NP_666204.1

name	Polr2g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385826 CCDS:CCDS29547.1 GeneID:67710 MGI:1914960
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA] codon_start : 1 product : polymerase (RNA) II (DNA directed) polypeptide G protein_id : NP_080605.1

name	Zbtb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789327 CCDS:CCDS29548.1 GeneID:75291 MGI:1922541
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger and BTB domain containing 3 protein_id : NP_598520.1

name	Ttc9c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625776 CCDS:CCDS29549.1 GeneID:70387 MGI:1917637
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : tetratricopeptide repeat domain 9C protein_id : NP_081688.2

name	Hnrpul2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487099 GeneID:68693 MGI:1915943
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein U-like 2 protein_id : NP_001074665.1

name	Gng3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754022 CCDS:CCDS29550.1 GeneID:14704 MGI:102704
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003924 - GTPase activity [Evidence ISS]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein (G protein), gamma 3 subunit protein_id : NP_034446.1

name	Bscl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949041 CCDS:CCDS29551.1 GeneID:14705 MGI:1298392
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : G protein gamma 3 linked product : seipin protein_id : NP_032170.2

name	1110067I12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67846117 GeneID:68852 MGI:1916102
definition	codon_start : 1 product : hypothetical protein LOC68852 protein_id : NP_001013037.1

name	D19Ertd721e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122591 CCDS:CCDS29553.1 GeneID:225896 MGI:1289301
definition	codon_start : 1 product : 2B28 protein_id : NP_666205.1

name	AI462493 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998119 GeneID:107197 MGI:2147553
definition	codon_start : 1 product : hypothetical protein LOC107197 isoform 1 protein_id : XP_892173.1

name	1810009A15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384876 CCDS:CCDS29555.1 GeneID:66276 MGI:1913526
definition	codon_start : 1 product : hypothetical protein LOC66276 protein_id : NP_079739.1

name	Ints5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849895 CCDS:CCDS29556.1 GeneID:109077 MGI:1923578
definition	GO_component : GO:0032039 - integrator complex [Evidence ISS] GO_process : GO:0016180 - snRNA processing [Evidence ISS] codon_start : 1 product : integrator complex subunit 5 protein_id : NP_789813.1

name	Ganab (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679891 CCDS:CCDS29557.1 GeneID:14376 MGI:1097667
definition	GO_component : GO:0017177 - alpha-glucosidase II complex [Evidence IPI]; GO:0005783 - endoplasmic reticulum [Evidence TAS] GO_function : GO:0015926 - glucosidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006491 - N-glycan processing [Evidence TAS] codon_start : 1 note : glucosidase II alpha-subunit; carbohydrate processing enzyme of the endoplasmic reticulum product : alpha glucosidase 2 alpha neutral subunit protein_id : NP_032086.1

name	B3gat3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195672 CCDS:CCDS29558.1 GeneID:72727 MGI:1919977
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015018 - galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) protein_id : NP_077218.1

name	Rom1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83699400 CCDS:CCDS29559.1 GeneID:19881 MGI:97998
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 exception : mismatches in translation product : rod outer segment membrane protein 1 protein_id : NP_033099.2

name	Eml3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450111 CCDS:CCDS29560.1 GeneID:225898 MGI:2387612
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : echinoderm microtubule associated protein like 3 protein_id : NP_659121.1

name	Mta2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491880 CCDS:CCDS29561.1 GeneID:23942 MGI:1346340
definition	GO_component : GO:0016585 - chromatin remodeling complex [Evidence IPI]; GO:0000118 - histone deacetylase complex [Evidence IPI]; GO:0005634 - nucleus [Evidence IDA]; GO:0016581 - NuRD complex [Evidence IPI] [Evidence IDA] GO_function : GO:0004407 - histone deacetylase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006338 - chromatin remodeling [Evidence TAS]; GO:0006323 - DNA packaging [Evidence TAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : metastasis associated 1-like 1; metastais-associated gene family, member 2 product : metastasis-associated protein 2 protein_id : NP_035972.3

name	Tut1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574078 CCDS:CCDS29562.1 GeneID:70044 MGI:1917294
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein 21 protein_id : NP_932110.1

name	Eef1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625979 CCDS:CCDS29563.1 GeneID:67160 MGI:1914410
definition	GO_component : GO:0005853 - eukaryotic translation elongation factor 1 complex [Evidence IEA] GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006414 - translational elongation [Evidence IEA] codon_start : 1 product : eukaryotic translation elongation factor 1 gamma protein_id : NP_080283.3

name	Ahnak (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90403607 GeneID:66395 MGI:1316648
definition	GO_component : GO:0005911 - intercellular junction [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; desmoyokin product : AHNAK nucleoprotein isoform 3 protein_id : NP_001035048.1

name	Ahnak (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61743961 CCDS:CCDS29564.1 GeneID:66395 MGI:1316648
definition	GO_component : GO:0005911 - intercellular junction [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; desmoyokin product : AHNAK nucleoprotein isoform 1 protein_id : NP_033773.1

name	Scgb1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755947 GeneID:22287 MGI:98919
definition	GO_function : GO:0019834 - phospholipase A2 inhibitor activity [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA] codon_start : 1 note : uteroglobin; Blastokinin; clara cell secretory protein product : secretoglobin, family 1A, member 1 (uteroglobin) protein_id : NP_035811.1

name	Asrgl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560239 CCDS:CCDS29566.1 GeneID:66514 MGI:1913764
definition	codon_start : 1 product : asparaginase like 1 protein_id : NP_079886.2

name	LOC100040104 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270350 GeneID:100040104
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474145.1

name	LOC623810 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270352 GeneID:623810
definition	codon_start : 1 product : similar to steroid-binding protein C1 protein_id : XP_001474161.1

name	LOC100040130 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270354 GeneID:100040130
definition	codon_start : 1 product : similar to prostatic steroid binding protein protein_id : XP_001474179.1

name	LOC100040137 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270356 GeneID:100040137
definition	codon_start : 1 product : similar to steroid-binding protein C1 protein_id : XP_001474190.1

name	LOC100040143 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270358 GeneID:100040143
definition	codon_start : 1 product : similar to steroid-binding protein C1 protein_id : XP_001474206.1

name	LOC100040152 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270360 GeneID:100040152
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001474221.1

name	Stxbp3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270362 GeneID:619371 MGI:3586869
definition	codon_start : 1 product : syntaxin-binding protein 3B protein_id : XP_001474240.1

name	LOC623688 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270364 GeneID:623688
definition	codon_start : 1 product : similar to prostatic steroid binding protein protein_id : XP_001474256.1

name	LOC100040178 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270366 GeneID:100040178
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474276.1

name	LOC100040192 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270368 GeneID:100040192
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474293.1

name	6720475J19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270377 GeneID:68157 MGI:1915407
definition	codon_start : 1 product : hypothetical protein LOC68157 protein_id : XP_001474946.1

name	LOC100040203 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270370 GeneID:100040203
definition	codon_start : 1 product : similar to prostatein C3 subunit protein_id : XP_001474309.1

name	Incenp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710040 GeneID:16319 MGI:1313288
definition	GO_component : GO:0000801 - central element [Evidence IDA]; GO:0005721 - centric heterochromatin [Evidence ISS]; GO:0000775 - chromosome, pericentric region [Evidence IDA] [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA]; GO:0030496 - midbody [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence ISS]; GO:0005819 - spindle [Evidence ISS]; GO:0000795 - synaptonemal complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007059 - chromosome segregation [Evidence ISS]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : inner centromere protein protein_id : NP_057901.1

name	LOC100040215 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270372 GeneID:100040215
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474350.1

name	Fth1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753912 CCDS:CCDS29567.1 GeneID:14319 MGI:95588
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008199 - ferric iron binding [Evidence IEA]; GO:0004322 - ferroxidase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0019900 - kinase binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence ISS]; GO:0006879 - iron ion homeostasis [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS] codon_start : 1 product : ferritin heavy chain 1 protein_id : NP_034369.1

name	Best1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50233765 CCDS:CCDS29568.1 GeneID:24115 MGI:1346332
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA] [Evidence ND] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : best macular dystrophy; vitelliform macular dystrophy 2 homolog product : bestrophin protein_id : NP_036043.1

name	Rab3il1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362337 CCDS:CCDS29569.1 GeneID:74760 MGI:1922010
definition	GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0017112 - Rab guanyl-nucleotide exchange factor activity [Evidence ISS] codon_start : 1 product : RAB3A interacting protein (rabin3)-like 1 protein_id : NP_653121.1

name	Fads3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887801 CCDS:CCDS29570.1 GeneID:60527 MGI:1928740
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0006636 - fatty acid desaturation [Evidence IEA] codon_start : 1 product : fatty acid desaturase 3 protein_id : NP_068690.3

name	Fads2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790071 CCDS:CCDS29571.1 GeneID:56473 MGI:1930079
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA]; GO:0004768 - stearoyl-CoA 9-desaturase activity [Evidence IDA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0006636 - fatty acid desaturation [Evidence IEA] codon_start : 1 note : delta-6 fatty acid desaturase product : fatty acid desaturase 2 protein_id : NP_062673.1

name	Fads1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164784 CCDS:CCDS29572.1 GeneID:76267 MGI:1923517
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016213 - linoleoyl-CoA desaturase activity [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0006636 - fatty acid desaturation [Evidence ISS] [Evidence IEA]; GO:0042759 - long-chain fatty acid biosynthesis [Evidence ISS] codon_start : 1 product : delta-5 desaturase protein_id : NP_666206.1

name	Fen1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46048490 CCDS:CCDS29573.1 GeneID:14156 MGI:102779
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IDA]; GO:0048256 - flap endonuclease activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IDA]; GO:0030145 - manganese ion binding [Evidence IDA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IMP]; GO:0006260 - DNA replication [Evidence IMP] codon_start : 1 note : flap endonuclease 1 product : flap structure specific endonuclease 1 protein_id : NP_032025.2

name	1810006K21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63737442 GeneID:69038 MGI:1916288
definition	codon_start : 1 product : hypothetical protein LOC69038 protein_id : XP_622862.1

name	Gm98 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270387 GeneID:225908 MGI:2684944
definition	codon_start : 1 product : hypothetical protein LOC225908 isoform 2 protein_id : XP_893679.2

name	Dagla (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674271 CCDS:CCDS29574.1 GeneID:269060 MGI:2677061
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004806 - triacylglycerol lipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : neural stem cell-derived dendrite regulator protein_id : NP_932782.1

name	Syt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281824 CCDS:CCDS29576.1 GeneID:54525 MGI:1859545
definition	GO_component : GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0001778 - plasma membrane repair [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : beta isoform is encoded by transcript variant 2; synaptotagmin 7 product : synaptotagmin VII beta isoform protein_id : NP_775090.1

name	Syt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281840 GeneID:54525 MGI:1859545
definition	GO_component : GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0001778 - plasma membrane repair [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : gamma isoform is encoded by transcript variant 3; synaptotagmin 7 product : synaptotagmin VII gamma isoform protein_id : NP_775091.1

name	Syt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055364 CCDS:CCDS29575.1 GeneID:54525 MGI:1859545
definition	GO_component : GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0001778 - plasma membrane repair [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : alpha isoform is encoded by transcript variant 1; synaptotagmin 7 product : synaptotagmin VII alpha isoform protein_id : NP_061271.1

name	Gm705 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270375 GeneID:278795 MGI:2685551
definition	codon_start : 1 product : hypothetical protein protein_id : XP_204937.5

name	4930579J09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526858 CCDS:CCDS29577.1 GeneID:67752 MGI:1915002
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : IIIG9 protein protein_id : NP_598450.1

name	0610038F07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560262 CCDS:CCDS29578.1 GeneID:66072 MGI:1913322
definition	codon_start : 1 product : hypothetical protein LOC66072 protein_id : NP_079609.2

name	5730453I16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982055 CCDS:CCDS29579.1 GeneID:269061 MGI:1917826
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pre-mRNA cleavage factor I, 59 kDa subunit protein_id : NP_758506.2

name	2810441K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312086 GeneID:68642 MGI:1920020
definition	codon_start : 1 product : hypothetical protein LOC68642 protein_id : NP_081074.1

name	Tmem138 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21624623 CCDS:CCDS29581.1 GeneID:72982 MGI:1920232
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC72982 protein_id : NP_082687.1

name	Cybasc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235724 CCDS:CCDS29582.1 GeneID:225912 MGI:2686925
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : cytochrome b, ascorbate dependent 3 protein protein_id : NP_958739.1

name	Dak (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703976 GeneID:225913 MGI:2385084
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004371 - glycerone kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006071 - glycerol metabolism [Evidence IEA] codon_start : 1 product : dihydroxyacetone kinase 2 homolog protein_id : NP_663471.1

name	Ddb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657011 GeneID:13194 MGI:1202384
definition	codon_start : 1 note : damage specific DNA binding protein 1 (127 kDa); DNA repair protein; damage-specific DNA-binding protein, DNA repair; damaged-DNA recognition protein 1 product : damage specific DNA binding protein 1 protein_id : NP_056550.1

name	Vwce (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998150 GeneID:71768 MGI:1919018
definition	codon_start : 1 product : von Willebrand factor C and EGF domains isoform 2 protein_id : XP_894372.1

name	Pga5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981154 CCDS:CCDS29584.1 GeneID:58803 MGI:1915935
definition	GO_component : GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IDA] GO_process : GO:0019538 - protein metabolism [Evidence TAS] codon_start : 1 note : pepsinogen A5; pepsinogen F product : pepsinogen 5, group I protein_id : NP_067428.2

name	2210404E10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270389 GeneID:72305 MGI:1919555
definition	codon_start : 1 product : hypothetical protein LOC72305 protein_id : XP_001475618.1

name	Vps37c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088908 CCDS:CCDS29585.1 GeneID:107305 MGI:2147661
definition	codon_start : 1 product : vacuolar protein sorting 37C protein_id : NP_852068.1

name	Cd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517489 CCDS:CCDS29586.1 GeneID:12507 MGI:88340
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005044 - scavenger receptor activity [Evidence IEA] GO_process : GO:0008624 - induction of apoptosis by extracellular signals [Evidence IDA]; GO:0031295 - T cell costimulation [Evidence IDA] codon_start : 1 product : CD5 antigen protein_id : NP_031676.3

name	LOC100040227 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040227
definition	number : 5 pseudo : _no_value

name	LOC100040227 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040227
definition	number : 4 pseudo : _no_value

name	LOC100040227 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040227
definition	number : 3 pseudo : _no_value

name	LOC100040227 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040227
definition	number : 2 pseudo : _no_value

name	LOC100040227 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040227
definition	number : 1 pseudo : _no_value

name	Pcna-ps2 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	note : homology to exons of PCNA gene pseudo : _no_value

name	LOC100039957 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270347 GeneID:100039957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Interferon induced transmembrane protein 2 pseudo : _no_value transcript_id : XR_031693.1

name	EG621699 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94405836 GeneID:621699 MGI:3644748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1534 ESTs, 5 Proteins product : predicted gene, EG621699 transcript_id : XR_001587.1

clone name	MSMg01-531A04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-317M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522A10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-338N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516E24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-297M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343E21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059E04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-293O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-295N12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450J21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-093D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-476D04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-309E03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-464B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022P21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-257C16.b	B6Ng01-257C16.g
ACC	GA062934	GA062935
length	1,055	1,078
definition	B6Ng01-257C16.b	B6Ng01-257C16.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(9,829,812 - 9,830,340)	(21,710,962 - 21,712,048)
sequence	gaattctcccactattattgtgtgaggtgcaatgtgtgctttgagcttta ctaaagtttctttaatgaatgtagatgcccttgtatttggagcatagata ttcagaattgatagttcctcttggagtattttacctttgatgagtatgaa gtgcccctccttgtcttttttgataacttttggttggaagtcaattttat tagatattagaatggctcctccagcttgtttcttcataccatttgcttgg aaaatttttttccagcctttcattctgaggtagtgtttatgtttttctct gagatgagttttctgtaagcagcaaaatgttgggtcttatttgtgtagcc agtttgttagtctatatctctttattgggaagttgaatacattgatatta agagatattaaggaaaagtaattgttgcttcctgttatttttgttgttag agttggcattctgttcttgtggctgtcttcttttaggtttgttgagggat taccttcttgttttttctagggcatggttcccgtccttttattggttttt ggttgttgttgttgttattatcctttgaagggctggatttgtggagagat aatgtgtgaatttggttttgttgtggaatactttggtttctccatctatg gtaattgagagtttggctgggtatagtagcctgggctggaatttgtgttc tcttagtgtctgtataacatctgtccaggctcttctggccttcacagtct ctggtgaaaaatctggtgtaattctgataggcttgcctttatatgttact tgacctttttcccttactgcttttagtattctatttttatttagtgcatt tgttgttttgattattatgtgtctggaggaatttctttttctggtccagt ctatttggagttctgtagtttttcttgtattgttcatgggcatctcattc tttagattcggagttttcttcaataattttgttgaagatgtttactgatc ctttgagttgaaaattcttcattctcatccactcctattatctgtaggtt tggtc	gaattccacttacaccttaaaacgctaggaggcactttgtgtttatcaaa gccattcttttcacaaacaaagcagttactaaggagctctaatttttcaa taatacacaagccctgctgtagaggatcttcagctggaatccatattttg tagtacctagcccttcatgttacaaaaacactagtcttactgttaaaaag agttttggtcttatttgtttttgtccttagatacggttgattttctacca gtatttccatttgatgtcttaaaaaatgcctttctaattagttttgtttc tctttgcaaggattttcctgatacttattaaacactaatatagaagtgtt gaaataatgtctaggcaaggctagaaacataaatgagtcagtaaagaaac tgattaaaggccatccagagactgccccacctggcgatccatcccatata cagtcaccaaacccagacactgttgtggaagccaagaaatgcttgctgac aggagcctgatatagctgtctgctgaaaggctctgccagagcctgacaaa tacagaggcagacgctcacagcctactattggattgaccacgggtcccca atggaggagttagagaaagaactgaaggagctgaagaggtttgcaacctc ataggaagaacaacaatatcaaccaaccagacccctcagagctcccaggg actaaaccaccaactaaagagtacacatggaaggacccatggctccagct tcctatgtagcagagaatggccttgtcaggtatcagtctccttgtcagga gaggtcattggtcctatgaaggctctatgccccagtgtaggggaacgtca gggcagggaggcaggagtgggtaggtgggcaggggaaaccctcatagaac ctggggatgggataggaggtttcagggttggagggcccagtaagggataa catttgaaatgtaaataacgaaaatatcattaaaaaaaaaaaactatgta tgaataaaaaaagaaagtggttagtggtgaatgccagctgattcaagcag ttcaacagctttgtctggacatcatgct
quality values	Open. Hide. 58 36 27 38 62 62 62 62 62 37 31 62 47 62 62 54 62 54 62 47 47 47 54 62 62 62 59 59 59 62 51 43 46 37 28 38 34 54 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 59 62 59 59 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 42 42 49 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 42 62 62 62 62 62 62 62 52 62 62 47 52 62 62 47 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 41 58 58 42 58 36 58 58 46 54 47 58 58 44 58 45 41 58 58 54 54 54 52 47 52 54 58 54 58 54 58 33 38 30 46 58 58 58 52 58 54 45 58 52 54 34 39 54 54 58 36 54 46 52 54 52 58 58 27 52 54 52 58 54 58 58 54 52 58 54 38 47 58 52 53 50 50 51 51 53 49 49 58 58 48 36 51 49 46 50 48 58 53 45 53 49 52 39 35 52 53 58 58 42 38 50 40 37 50 50 50 37 38 50 46 40 50 44 18 42 48 43 32 34 39 40 40 52 52 40 50 32 50 58 26 53 58 58 58 58 39 32 39 40 44 58 32 51 34 53 54 41 49 39 40 30 49 30 30 29 44 40 36 29 26 19 51 50 58 28 41 32 34 37 52 53 19 37 35 51 34 38 31 33 38 35 53 53 52 41 32 49 54 54 28 37 42 39 53 40 50 33 42 30 36 23 9 29 28 31 31 14 22 30 45 51 46 21 39 32 52 26 29 33 34 41 40 52 21 18 12 53 10 41 9 6 40 41 31 22 32 30 14 31 12 32 47 29 53 34 37 32 40 16 27 18 31 11 15 23 19 33 47 31 32 11 53 52 45 19 14 26 35 19 33 31 30 31 31 28 36 17 35 30 37 30 23 25 27 30 26 46 18 26 32 6 8 26 17 41 45 46 7 8 18 13 22 9 11 7 7 14 14 31 27 18 20 27 46 41 29 31 31 20 31 32 25 9 32 37 25 46 28 14 6 28 21 32 29 36 6 15 6 5 41 31 39 24 23 18 11 10 29 30 31 12 25 32 15 17 21 18 20 17 25 14 6 21 9 31 26 38 7 16 8 10 24 5 25 32 18 30 24 37 24 31 17 19 26 21 33 41 34 9 8 8 7 20 10 8 15 24 21 19 7 7 10 10 21 32 7 10 7 9 16 11 9 6 7 9 11 21 23 19 5 4 6 27 8 36 27 33 9 6 7	Open. Hide. 62 54 42 44 62 62 44 42 49 62 59 56 59 30 56 56 56 43 46 45 59 59 62 62 62 62 62 62 62 59 59 59 54 54 59 62 62 62 62 62 49 54 62 59 62 62 59 62 62 62 62 62 59 59 62 62 62 49 54 62 62 62 54 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 54 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 56 62 62 54 56 62 62 62 62 54 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 42 62 62 52 62 62 62 62 47 52 52 62 62 62 62 62 62 62 62 54 58 58 58 54 58 49 54 58 58 58 54 54 54 54 58 58 58 58 58 58 58 58 58 58 58 42 39 58 58 54 54 42 39 58 54 58 58 58 54 58 41 58 52 58 58 58 58 47 42 58 54 29 54 54 39 54 58 50 58 58 58 52 58 44 36 58 58 58 54 46 58 58 47 58 58 58 58 49 34 44 19 42 47 58 58 51 51 46 41 42 48 50 51 40 58 53 42 54 49 43 47 58 48 34 47 50 51 50 58 58 53 51 53 53 50 58 50 49 49 50 48 39 50 54 48 50 43 43 49 52 46 39 58 26 49 49 35 54 49 46 50 58 58 32 32 49 46 44 39 52 52 37 40 37 29 39 43 52 42 58 58 41 51 35 52 33 41 31 50 32 40 54 58 53 44 18 58 39 23 22 39 25 50 50 54 40 40 33 54 23 37 45 51 42 34 40 42 42 42 52 37 33 39 52 53 34 54 18 36 47 42 53 46 23 53 37 50 49 24 29 45 35 54 32 37 45 37 33 32 37 40 45 40 40 42 39 42 37 34 39 21 28 31 20 30 18 37 23 33 31 44 40 34 32 26 31 32 33 34 28 31 37 29 21 41 28 40 32 36 31 32 34 32 40 32 40 33 21 22 47 35 14 10 49 49 21 43 29 20 30 42 39 12 27 51 26 31 31 25 46 17 6 9 33 21 31 25 32 29 18 31 31 51 31 29 31 26 30 29 46 48 31 31 38 24 47 47 31 38 42 24 13 36 31 34 32 34 34 31 13 31 31 30 28 20 32 14 37 22 8 7 25 46 22 19 13 27 15 21 39 11 33 26 48 32 26 11 6 46 21 5 9 31 16 16 9 23 36 6 37 39 17 25 38 27 14 5 5 5 8 12 24 18 26 13 12 31 35 17 12 27 20 24 9 6 14 36 31 16 19 21 5 15 23 29 32 31 24 12 26 28 9 6 23 21 32 37 28 31 17 9 21 37 24 37 18 19 18 15 19 14 11 12 10 32 18 8 15 18 14 11 17 19 21 6 11 27 32 7 10 7 4 9 24 13 21 4 9 15 9 8 11 21 13 9 9 21 6 8 21 20 8 18 28 6 4 14 34 17 20 8 16 16 17 5 20 19 6 14 11 28 19 27 13 8 12 6 15 3 5 11 3 4 11 31 6 14 6 8 12 22

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_9829812_9830340
seq2: B6Ng01-257C16.b_564_1103 (reverse)

seq1  GACCAAACCTACGGATAATAGGAGTGGATGAGAATGAAG-ATTTTCAACT  49
      |||||||||||| |||||||||||||||||||||||||| ||||||||||
seq2  GACCAAACCTACAGATAATAGGAGTGGATGAGAATGAAGAATTTTCAACT  50

seq1  CAAAGGTCCAGCAAACATCTTCAACAAAATTATTGAAGAAAACTTCCCAA  99
      ||||||  ||| ||||||||||||||||||||||||||||||||  || |
seq2  CAAAGGATCAGTAAACATCTTCAACAAAATTATTGAAGAAAACT--CCGA  98

seq1  ATCTAAAGAATGAGATGCCTATGAAC-ATACAAG-AAGCCTACAGAACTC  147
      ||||||||||||||||||| |||||| ||||||| ||  |||||||||||
seq2  ATCTAAAGAATGAGATGCCCATGAACAATACAAGAAAAACTACAGAACTC  148

seq1  CAAATAGACTGGACCAG-AAAAGAAATTCCTCCCGACACATAATAATCAG  196
      ||||||||||||||||| ||||||||||||||| ||||||||||||||| 
seq2  CAAATAGACTGGACCAGAAAAAGAAATTCCTCCAGACACATAATAATCAA  198

seq1  AACAACAAATGCACTAAATAAAGATAGAATACTAAAAGCAGTAAGGGAAA  246
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  AACAACAAATGCACTAAATAAAAATAGAATACTAAAAGCAGTAAGGGAAA  248

seq1  AAGGTCAAGTAACATATAAAGGCAAGCCTATCAGAATTACACCAGATTTT  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTCAAGTAACATATAAAGGCAAGCCTATCAGAATTACACCAGATTTT  298

seq1  TCACCAGAGACTATGAAATCCAGAAGAGCCTGGACAGATGTTATACAGAC  346
      |||||||||||| ||||  |||||||||||||||||||||||||||||||
seq2  TCACCAGAGACTGTGAAGGCCAGAAGAGCCTGGACAGATGTTATACAGAC  348

seq1  ACTAAGAGAACACAAATTCCAGCCCAGGCTACTATACCCAGCCAAACTCT  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAAGAGAACACAAATTCCAGCCCAGGCTACTATACCCAGCCAAACTCT  398

seq1  CAATTATCATAGATGGAGAAACCAAAGTATTCCACGACAAAACCAAATTC  446
      |||||| |||||||||||||||||||||||||||| ||||||||||||||
seq2  CAATTACCATAGATGGAGAAACCAAAGTATTCCACAACAAAACCAAATTC  448

seq1  ACACATTATCTCTCCACGAATCCAGCCCTTCAAAGGATAATAACAGAA--  494
      ||||||||||||||||| |||||||||||||||||||||||||||  |  
seq2  ACACATTATCTCTCCACAAATCCAGCCCTTCAAAGGATAATAACAACAAC  498

seq1  -------AAAAACCAATACAAGGACGGGAACCACCCCCTAGA  529
             ||||||||||| ||||||||||||||  |||||||
seq2  AACAACCAAAAACCAATAAAAGGACGGGAACCATGCCCTAGA  540

seq1: chr15_21710962_21712048
seq2: B6Ng01-257C16.g_70_1147

seq1  GAATTCCACTTACACCTTAAAACGCTAGGAGGCACTTTGTGTTTATCAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCACTTACACCTTAAAACGCTAGGAGGCACTTTGTGTTTATCAAA  50

seq1  GCCATTCTTTTCACAAACAAAGCAGTTACTAAGGAGCTCTAATTTTTCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATTCTTTTCACAAACAAAGCAGTTACTAAGGAGCTCTAATTTTTCAA  100

seq1  TAATACACAAGCCCTGCTGTAGAGGATCTTCAGCTGGAATCCATATTTTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATACACAAGCCCTGCTGTAGAGGATCTTCAGCTGGAATCCATATTTTG  150

seq1  TAGTACCTAGCCCTTCATGTTACAAAAACACTAGTCTTACTGTTAAAAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTACCTAGCCCTTCATGTTACAAAAACACTAGTCTTACTGTTAAAAAG  200

seq1  AGTTTTGGTCTTATTTGTTTTTGTCCTTAGATACGGTTGATTTTCTACCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTTGGTCTTATTTGTTTTTGTCCTTAGATACGGTTGATTTTCTACCA  250

seq1  GTATTTCCATTTGATGTCTTAAAAAATGCCTTTCTAATTAGTTTTGTTTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATTTCCATTTGATGTCTTAAAAAATGCCTTTCTAATTAGTTTTGTTTC  300

seq1  TCTTTGCAAGGATTTTCCTGATACTTATTAAACACTAATATAGAAGTGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTGCAAGGATTTTCCTGATACTTATTAAACACTAATATAGAAGTGTT  350

seq1  GAAATAATGTCTAGGCAAGGCTAGAAACATAAATGAGTCAGTAAAGAAAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATAATGTCTAGGCAAGGCTAGAAACATAAATGAGTCAGTAAAGAAAC  400

seq1  TGATTAAAGGCCATCCAGAGACTGCCCCACCTGGCGATCCATCCCATATA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTAAAGGCCATCCAGAGACTGCCCCACCTGGCGATCCATCCCATATA  450

seq1  CAGTCACCAAACCCAGACACTGTTGTGGAAGCCAAGAAATGCTTGCTGAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCACCAAACCCAGACACTGTTGTGGAAGCCAAGAAATGCTTGCTGAC  500

seq1  AGGAGCCTGATATAGCTGTCTGCTGAAAGGCTCTGCCAGAGCCTGACAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGCCTGATATAGCTGTCTGCTGAAAGGCTCTGCCAGAGCCTGACAAA  550

seq1  TACAGAGGCAGACGCTCACAGCCTACTATTGGATTGACCACGGGTCCCCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGAGGCAGACGCTCACAGCCTACTATTGGATTGACCACGGGTCCCCA  600

seq1  ATGGAGGAGTTAGAGAAAGAACTGAAGGAGCTGAAGAGGTTTGCAACCTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGAGGAGTTAGAGAAAGAACTGAAGGAGCTGAAGAGGTTTGCAACCTC  650

seq1  ATAGGAAGAACAACAATATCAACCAACCAGACCCCTCAGAGCTCCCAGGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGGAAGAACAACAATATCAACCAACCAGACCCCTCAGAGCTCCCAGGG  700

seq1  ACTAAACCACCAACTAAAGAGTACACATGGAAGGACCCATGGCTCCAGCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAAACCACCAACTAAAGAGTACACATGGAAGGACCCATGGCTCCAGCT  750

seq1  TCCTATGTAGCAGAGAATGGCCTTGTCAGGTATCAGTCTCCTTGTCAGGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTATGTAGCAGAGAATGGCCTTGTCAGGTATCAGTCTCCTTGTCAGGA  800

seq1  GAGGTCATTGGTCCTATGAAGGCTCTATGCCCCAGTGTAGGGGAACGTCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTCATTGGTCCTATGAAGGCTCTATGCCCCAGTGTAGGGGAACGTCA  850

seq1  GGGCAGGGAGGCAGGAGTGGGTAGGTGGGCAGGGGAAACCCTCATAGAAC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCAGGGAGGCAGGAGTGGGTAGGTGGGCAGGGGAAACCCTCATAGAAC  900

seq1  CTGGGGGATGGGATAGGAGGTTTCAGGGTGGAGGGGCCCAGTAAGGGGAT  950
      || |||||||||||||||||||||||||| |  ||||||||||| |||||
seq2  CT-GGGGATGGGATAGGAGGTTTCAGGGTTGGAGGGCCCAGTAA-GGGAT  948

seq1  AACATTTGAAATGTAAATAAAGAAAATATCCATTAAAAAAAAAAAACTAT  1000
      |||||||||||||||||||| |||||||| ||||||||||||||||||||
seq2  AACATTTGAAATGTAAATAACGAAAATAT-CATTAAAAAAAAAAAACTAT  997

seq1  GTATGAATAAAAAAAGAAAGGTTGTTAAGTGTGAATGCCAGCTGATACAA  1050
      ||||||||||||||||||| || ||||   |||||||||||||||| |||
seq2  GTATGAATAAAAAAAGAAA-GTGGTTAGTGGTGAATGCCAGCTGATTCAA  1046

seq1  AGGCAGTTCAAACAGCTTTGTCCTGGACATTCATGCT  1087
        ||||||| ||||||||||| ||||||| |||||||
seq2  --GCAGTTC-AACAGCTTTGT-CTGGACA-TCATGCT  1078

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information