MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-323F23
Chromosome	19 (Build37)
Map Location	46,250,343 - 46,412,541
singlet/doublet	doublet
Overlap gene	Gbf1, LOC668094, Nfkb2, Psd, Fbxl15, Cuedc2
Upstream gene	Lbx1, Btrc, EG627889, Poll, 5330431N19Rik, Fbxw4, Fgf8, Npm3, Mgea5, E330018D03Rik, Kcnip2, 9130011E15Rik, EG627939, 4930505N22Rik, Hps6, Ldb1, Pprc1, Nolc1, Elovl3, Pitx3
Downstream gene	2310034G01Rik, Tmem180, Actr1a, Sufu, Trim8, Arl3, Sfxn2, D19Wsu162e, Cyp17a1, EG629359, 2010012O05Rik, As3mt, Cnnm2, Nt5c2, Ina, Pcgf6, LOC100042842, Taf5, Usmg5, Pdcd11, 2810048G17Rik, EG546729, EG240669, EG629389, Neurl, EG329070, Sh3pxd2a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Lbx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16814 MGI:104867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btrc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12234 MGI:1338871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG627889 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627889 MGI:3649145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 1451 ESTs, 8 Proteins

name	Poll (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56626 MGI:1889000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5330431N19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226162 MGI:1924407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30838 MGI:1354698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14179 MGI:99604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18150 MGI:894653
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgea5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76055 MGI:1932139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E330018D03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320319 MGI:2443808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80906 MGI:2135916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	9130011E15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71617 MGI:1918867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627939 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627939 MGI:3645759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 986 ESTs, 10 Proteins

name	4930505N22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75056 MGI:1922306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Hps6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20170 MGI:2181763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ldb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16825 MGI:894762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pprc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226169 MGI:2385096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nolc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70769 MGI:1918019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Elovl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12686 MGI:1195976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pitx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18742 MGI:1100498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gbf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107338 MGI:1861607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668094 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 184 ESTs, 3 Proteins pseudo : _no_value

name	Nfkb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18034 MGI:1099800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73728 MGI:1920978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68431 MGI:1915681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cuedc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67116 MGI:1914366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310034G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75579 MGI:1922829
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	Tmem180 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75146 MGI:1922396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actr1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54130 MGI:1858964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sufu (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24069 MGI:1345643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Trim8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93679 MGI:1933302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56350 MGI:1929699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfxn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94279 MGI:2137678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D19Wsu162e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226178 MGI:107577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp17a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13074 MGI:88586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG629359 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629359 MGI:3648147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	2010012O05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66439 MGI:1913689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	As3mt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57344 MGI:1929882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnnm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94219 MGI:2151054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nt5c2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76952 MGI:2178563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ina (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226180 MGI:96568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcgf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71041 MGI:1918291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042842 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Taf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226182 MGI:2442144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usmg5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66477 MGI:1891435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdcd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18572 MGI:1341788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810048G17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72691 MGI:1919941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546729 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546729 MGI:3643383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG240669 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240669 MGI:3645665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG629389 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629389 MGI:3645322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 17 Proteins

name	Neurl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18011 MGI:1334263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG329070 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329070 MGI:3647497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3pxd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14218 MGI:1298393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lbx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891740 GeneID:16814 MGI:104867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ladybird homeobox homolog 1 (Drosophila) transcript_id : NM_010691.5

name	Btrc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373205 GeneID:12234 MGI:1338871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-transducin repeat containing protein transcript_id : NM_009771.2

name	Btrc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649722 GeneID:12234 MGI:1338871
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-transducin repeat containing protein transcript_id : NM_001037758.1

name	EG627889 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270559 GeneID:627889 MGI:3649145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 556 ESTs, 4 Proteins product : predicted gene, EG627889, transcript variant 2 transcript_id : XM_001480230.1

name	EG627889 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270557 GeneID:627889 MGI:3649145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 1450 ESTs, 8 Proteins product : predicted gene, EG627889, transcript variant 1 transcript_id : XM_001480227.1

name	Poll (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130528 GeneID:56626 MGI:1889000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), lambda transcript_id : NM_020032.2

name	5330431N19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363411 GeneID:226162 MGI:1924407
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5330431N19 gene transcript_id : NM_172639.2

name	Fbxw4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130948 GeneID:30838 MGI:1354698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 4 transcript_id : NM_013907.2

name	Fgf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22094092 GeneID:14179 MGI:99604
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 8 transcript_id : NM_010205.1

name	Npm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679109 GeneID:18150 MGI:894653
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoplasmin 3 transcript_id : NM_008723.1

name	Mgea5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130599 GeneID:76055 MGI:1932139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : meningioma expressed antigen 5 (hyaluronidase) transcript_id : NM_023799.3

name	E330018D03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802104 GeneID:320319 MGI:2443808
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E330018D03 gene transcript_id : NM_177133.2

name	Kcnip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281736 GeneID:80906 MGI:2135916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kv channel-interacting protein 2 transcript_id : NM_145704.1

name	Kcnip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21746188 GeneID:80906 MGI:2135916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kv channel-interacting protein 2 transcript_id : NM_030716.2

name	Kcnip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281733 GeneID:80906 MGI:2135916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kv channel-interacting protein 2 transcript_id : NM_145703.1

name	9130011E15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139947659 GeneID:71617 MGI:1918867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130011E15 gene transcript_id : NM_198296.2

name	EG627939 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270561 GeneID:627939 MGI:3645759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 986 ESTs, 10 Proteins product : predicted gene, EG627939 transcript_id : XM_894710.3

name	4930505N22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406023 GeneID:75056 MGI:1922306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930505N22 gene transcript_id : XM_001001649.1

name	Hps6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383223 GeneID:20170 MGI:2181763
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Hermansky-Pudlak syndrome 6 transcript_id : NM_176785.2

name	Ldb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754519 GeneID:16825 MGI:894762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domain binding 1 transcript_id : NM_010697.1

name	Pprc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487054 GeneID:226169 MGI:2385096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome proliferative activated receptor, gamma, coactivator-related 1 transcript_id : NM_001081214.1

name	Nolc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198328 GeneID:70769 MGI:1918019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar and coiled-body phosphoprotein 1 transcript_id : NM_001039352.1

name	Nolc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198330 GeneID:70769 MGI:1918019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar and coiled-body phosphoprotein 1 transcript_id : NM_053086.2

name	Nolc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198332 GeneID:70769 MGI:1918019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar and coiled-body phosphoprotein 1 transcript_id : NM_001039353.1

name	Nolc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198326 GeneID:70769 MGI:1918019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar and coiled-body phosphoprotein 1 transcript_id : NM_001039351.1

name	Elovl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671751 GeneID:12686 MGI:1195976
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 transcript_id : NM_007703.1

name	Pitx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802180 GeneID:18742 MGI:1100498
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired-like homeodomain transcription factor 3 transcript_id : NM_008852.2

name	Gbf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52138535 GeneID:107338 MGI:1861607
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi-specific brefeldin A-resistance factor 1 transcript_id : NM_178930.3

name	Nfkb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130743 GeneID:18034 MGI:1099800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 transcript_id : NM_019408.2

name	Psd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51317391 GeneID:73728 MGI:1920978
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin and Sec7 domain containing transcript_id : NM_028627.2

name	Fbxl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140970873 GeneID:68431 MGI:1915681
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 15 transcript_id : NM_133694.2

name	Cuedc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13195619 GeneID:67116 MGI:1914366
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CUE domain containing 2 transcript_id : NM_024192.1

name	2310034G01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270493 GeneID:75579 MGI:1922829
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : RIKEN cDNA 2310034G01 gene transcript_id : XM_001478866.1

name	Tmem180 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114051516 GeneID:75146 MGI:1922396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 180 transcript_id : NM_029186.2

name	Actr1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8392846 GeneID:54130 MGI:1858964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ARP1 actin-related protein 1 homolog A (yeast) transcript_id : NM_016860.1

name	Sufu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70794804 GeneID:24069 MGI:1345643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of fused homolog (Drosophila) transcript_id : NM_015752.2

name	Sufu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70794806 GeneID:24069 MGI:1345643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of fused homolog (Drosophila) transcript_id : NM_001025391.1

name	Trim8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716392 GeneID:93679 MGI:1933302
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 8 transcript_id : NM_053100.1

name	Arl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254549 GeneID:56350 MGI:1929699
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 3 transcript_id : NM_019718.2

name	Sfxn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86439983 GeneID:94279 MGI:2137678
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sideroflexin 2 transcript_id : NM_053196.3

name	D19Wsu162e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68341986 GeneID:226178 MGI:107577
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 19, Wayne State University 162, expressed transcript_id : NM_146099.2

name	Cyp17a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476041 GeneID:13074 MGI:88586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 17, subfamily a, polypeptide 1 transcript_id : NM_007809.2

name	2010012O05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893035 GeneID:66439 MGI:1913689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010012O05 gene transcript_id : NM_025563.3

name	As3mt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392104 GeneID:57344 MGI:1929882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arsenic (+3 oxidation state) methyltransferase transcript_id : NM_020577.2

name	Cnnm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130766 GeneID:94219 MGI:2151054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin M2 transcript_id : NM_033569.2

name	Nt5c2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802147 GeneID:76952 MGI:2178563
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5'-nucleotidase, cytosolic II transcript_id : NM_029810.3

name	Ina (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354520 GeneID:226180 MGI:96568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : internexin neuronal intermediate filament protein, alpha transcript_id : NM_146100.3

name	Pcgf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351956 GeneID:71041 MGI:1918291
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycomb group ring finger 6 transcript_id : NM_027654.2

name	Taf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665721 GeneID:226182 MGI:2442144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_177342.3

name	Usmg5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351604 GeneID:66477 MGI:1891435
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upregulated during skeletal muscle growth 5 transcript_id : NM_023211.4

name	Pdcd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607127 GeneID:18572 MGI:1341788
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : programmed cell death protein 11 transcript_id : NM_011053.2

name	2810048G17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801704 GeneID:72691 MGI:1919941
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810048G17 gene transcript_id : NM_133746.3

name	EG546729 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486908 GeneID:546729 MGI:3643383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546729 transcript_id : NM_001081271.1

name	EG240669 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270501 GeneID:240669 MGI:3645665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG240669 transcript_id : XM_140729.8

name	EG629389 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406028 GeneID:629389 MGI:3645322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 17 Proteins product : predicted gene, EG629389 transcript_id : XM_894271.2

name	Neurl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71534277 GeneID:18011 MGI:1334263
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuralized-like homolog (Drosophila) transcript_id : NM_021360.3

name	EG329070 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342895 GeneID:329070 MGI:3647497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG329070 transcript_id : NM_177833.2

name	Sh3pxd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351646 GeneID:14218 MGI:1298393
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 and PX domains 2A transcript_id : NM_008018.2

name	Lbx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059020 CCDS:CCDS29859.1 GeneID:16814 MGI:104867
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0001947 - heart looping [Evidence IMP]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0045665 - negative regulation of neuron differentiation [Evidence IMP]; GO:0048664 - neuron fate determination [Evidence IGI] [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : lady bird-like homeobox 1 homolog product : ladybird homeobox homolog 1 protein_id : NP_034821.2

name	Btrc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649723 CCDS:CCDS29860.1 GeneID:12234 MGI:1338871
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant 1; SCF b-TRCP product : beta-transducin repeat containing protein isoform a protein_id : NP_001032847.1

name	Btrc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753210 GeneID:12234 MGI:1338871
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; SCF b-TRCP product : beta-transducin repeat containing protein isoform b protein_id : NP_033901.1

name	EG627889 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270560 GeneID:627889 MGI:3649145
definition	codon_start : 1 product : similar to ribosomal protein L6 isoform 2 protein_id : XP_001480280.1

name	EG627889 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270558 GeneID:627889 MGI:3649145
definition	codon_start : 1 product : similar to ribosomal protein L6 isoform 1 protein_id : XP_001480277.1

name	Poll (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910500 CCDS:CCDS29861.1 GeneID:56626 MGI:1889000
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003890 - beta DNA polymerase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence ISS] [Evidence IDA]; GO:0016449 - lambda DNA polymerase activity [Evidence ISS]; GO:0016829 - lyase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006287 - base-excision repair, gap-filling [Evidence ISS]; GO:0006260 - DNA replication [Evidence IEA] [Evidence ISS]; GO:0006289 - nucleotide-excision repair [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0016446 - somatic hypermutation of immunoglobulin genes [Evidence ISS] codon_start : 1 note : DNA polymerase lambda product : polymerase (DNA directed), lambda protein_id : NP_064416.1

name	5330431N19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541998 CCDS:CCDS29862.1 GeneID:226162 MGI:1924407
definition	codon_start : 1 product : DPCD protein protein_id : NP_766227.1

name	Fbxw4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14780880 CCDS:CCDS29863.1 GeneID:30838 MGI:1354698
definition	GO_process : GO:0007275 - development [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : F-box protein Fbw4; dactylaplasia product : F-box and WD repeat domain containing 4 protein_id : NP_038935.1

name	Fgf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094093 CCDS:CCDS29864.1 GeneID:14179 MGI:99604
definition	GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0045165 - cell fate commitment [Evidence IGI]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0009792 - embryonic development (sensu Metazoa) [Evidence IMP]; GO:0035050 - embryonic heart tube development [Evidence IMP]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IGI]; GO:0008543 - fibroblast growth factor receptor signaling pathway [Evidence IMP]; GO:0048699 - generation of neurons [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0001759 - induction of an organ [Evidence IGI]; GO:0042472 - inner ear morphogenesis [Evidence IGI]; GO:0001822 - kidney development [Evidence IMP]; GO:0035108 - limb morphogenesis [Evidence IGI]; GO:0000165 - MAPKKK cascade [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP] [Evidence IGI]; GO:0043524 - negative regulation of neuron apoptosis [Evidence IMP]; GO:0001569 - patterning of blood vessels [Evidence IGI]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP] [Evidence IGI]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007435 - salivary gland morphogenesis [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0001658 - ureteric bud branching [Evidence IMP] codon_start : 1 product : fibroblast growth factor 8 protein_id : NP_034335.1

name	Npm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679110 CCDS:CCDS29865.1 GeneID:18150 MGI:894653
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IDA]; GO:0009303 - rRNA transcription [Evidence IDA] codon_start : 1 function : putative molecular chaperone product : nucleoplasmin 3 protein_id : NP_032749.1

name	Mgea5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15011884 CCDS:CCDS29866.1 GeneID:76055 MGI:1932139
definition	codon_start : 1 note : nuclear cytoplasmic O-GlcNAcase and acetyltransferase product : meningioma expressed antigen 5 (hyaluronidase) protein_id : NP_076288.1

name	E330018D03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239385 GeneID:320319 MGI:2443808
definition	codon_start : 1 product : hypothetical protein LOC320319 protein_id : NP_796107.1

name	Kcnip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281737 CCDS:CCDS29868.1 GeneID:80906 MGI:2135916
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant c; potassium channel-interacting protein 2; potassium channel interacting protein 2 product : Kv channel-interacting protein 2 isoform c protein_id : NP_663750.1

name	Kcnip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746189 GeneID:80906 MGI:2135916
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant b; potassium channel-interacting protein 2; potassium channel interacting protein 2 product : Kv channel-interacting protein 2 isoform b protein_id : NP_109641.2

name	Kcnip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281734 GeneID:80906 MGI:2135916
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant a; potassium channel-interacting protein 2; potassium channel interacting protein 2 product : Kv channel-interacting protein 2 isoform a protein_id : NP_663749.1

name	9130011E15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139947660 GeneID:71617 MGI:1918867
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71617 protein_id : NP_938038.2

name	EG627939 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998606 GeneID:627939 MGI:3645759
definition	codon_start : 1 product : hypothetical protein protein_id : XP_899803.1

name	4930505N22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406024 GeneID:75056 MGI:1922306
definition	codon_start : 1 product : hypothetical protein LOC75056 protein_id : XP_001001649.1

name	Hps6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28603820 CCDS:CCDS29869.1 GeneID:20170 MGI:2181763
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006996 - organelle organization and biogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : ruby eye product : Hermansky-Pudlak syndrome 6 protein_id : NP_789742.1

name	Ldb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754520 CCDS:CCDS29870.1 GeneID:16825 MGI:894762
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0030274 - LIM domain binding [Evidence IPI]; GO:0003712 - transcription cofactor activity [Evidence IEA] GO_process : GO:0009948 - anterior/posterior axis specification [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IMP]; GO:0016055 - Wnt receptor signaling pathway [Evidence IMP] codon_start : 1 product : LIM domain binding 1 protein_id : NP_034827.1

name	Pprc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487055 GeneID:226169 MGI:2385096
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : peroxisome proliferative activated receptor, gamma, coactivator-related 1 protein_id : NP_001074683.1

name	Nolc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198329 GeneID:70769 MGI:1918019
definition	GO_component : GO:0015030 - Cajal body [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA]; GO:0030532 - small nuclear ribonucleoprotein complex [Evidence TAS] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0007000 - nucleolus organization and biogenesis [Evidence IDA] codon_start : 1 note : isoform C is encoded by transcript variant 3 product : nucleolar and coiled-body phosphoprotein 1 isoform C protein_id : NP_001034441.1

name	Nolc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198331 GeneID:70769 MGI:1918019
definition	GO_component : GO:0015030 - Cajal body [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA]; GO:0030532 - small nuclear ribonucleoprotein complex [Evidence TAS] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0007000 - nucleolus organization and biogenesis [Evidence IDA] codon_start : 1 note : isoform A is encoded by transcript variant 1 product : nucleolar and coiled-body phosphoprotein 1 isoform A protein_id : NP_444316.2

name	Nolc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198333 GeneID:70769 MGI:1918019
definition	GO_component : GO:0015030 - Cajal body [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA]; GO:0030532 - small nuclear ribonucleoprotein complex [Evidence TAS] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0007000 - nucleolus organization and biogenesis [Evidence IDA] codon_start : 1 note : isoform D is encoded by transcript variant 4 product : nucleolar and coiled-body phosphoprotein 1 isoform D protein_id : NP_001034442.1

name	Nolc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198327 GeneID:70769 MGI:1918019
definition	GO_component : GO:0015030 - Cajal body [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA]; GO:0030532 - small nuclear ribonucleoprotein complex [Evidence TAS] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0007000 - nucleolus organization and biogenesis [Evidence IDA] codon_start : 1 note : isoform B is encoded by transcript variant 2 product : nucleolar and coiled-body phosphoprotein 1 isoform B protein_id : NP_001034440.1

name	Elovl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671752 CCDS:CCDS29871.1 GeneID:12686 MGI:1195976
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 note : cold inducible glycoprotein 30 product : elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 protein_id : NP_031729.1

name	Pitx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679341 CCDS:CCDS29872.1 GeneID:18742 MGI:1100498
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0030901 - midbrain development [Evidence IMP]; GO:0048666 - neuron development [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 function : transcription factor note : aphakia product : paired-like homeodomain transcription factor 3 protein_id : NP_032878.1

name	Gbf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138536 CCDS:CCDS29873.1 GeneID:107338 MGI:1861607
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 product : golgi-specific brefeldin A-resistance factor 1 protein_id : NP_849261.2

name	Nfkb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506921 CCDS:CCDS29874.1 GeneID:18034 MGI:1099800
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0048535 - lymph node development [Evidence TAS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : NF kappaB2 product : nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 protein_id : NP_062281.1

name	Psd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51317392 CCDS:CCDS29875.1 GeneID:73728 MGI:1920978
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 note : pleckstrin-Sec7 domains gene-like product : pleckstrin and Sec7 domain containing homolog protein_id : NP_082903.2

name	Fbxl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140970874 GeneID:68431 MGI:1915681
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box only protein 37 product : F-box and leucine-rich repeat protein 15 protein_id : NP_598455.2

name	Cuedc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195620 CCDS:CCDS29876.1 GeneID:67116 MGI:1914366
definition	codon_start : 1 exception : mismatches in translation product : CUE domain containing 2 protein_id : NP_077154.1

name	2310034G01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270494 GeneID:75579 MGI:1922829
definition	codon_start : 1 product : hypothetical protein LOC75579 protein_id : XP_001478916.1

name	Tmem180 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114051517 CCDS:CCDS29877.1 GeneID:75146 MGI:1922396
definition	codon_start : 1 product : hypothetical protein LOC75146 protein_id : NP_083462.2

name	Actr1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8392847 CCDS:CCDS29878.1 GeneID:54130 MGI:1858964
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : actin-related protein 1 alpha; Arp1 contractin alpha; Arp1 centractin alpha; actin-related protein 1 homolog A product : ARP1 actin-related protein 1 homolog A protein_id : NP_058556.1

name	Sufu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794805 GeneID:24069 MGI:1345643
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0045879 - negative regulation of smoothened signaling pathway [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : suppressor of fused homolog isoform 1 protein_id : NP_056567.2

name	Sufu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794807 CCDS:CCDS29879.1 GeneID:24069 MGI:1345643
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0045879 - negative regulation of smoothened signaling pathway [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : suppressor of fused homolog isoform 2 protein_id : NP_001020562.1

name	Trim8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716393 GeneID:93679 MGI:1933302
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ring finger protein 27 product : tripartite motif protein 8 protein_id : NP_444330.1

name	Arl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789881 GeneID:56350 MGI:1929699
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IDA]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : ADP-ribosylation factor-like protein 3; ADP-ribosylation-like 3 product : ADP-ribosylation factor-like 3 protein_id : NP_062692.1

name	Sfxn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86439984 CCDS:CCDS29880.1 GeneID:94279 MGI:2137678
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sideroflexin 2 protein_id : NP_444426.3

name	D19Wsu162e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68341987 CCDS:CCDS29881.1 GeneID:226178 MGI:107577
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC226178 protein_id : NP_666211.2

name	Cyp17a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476042 CCDS:CCDS29882.1 GeneID:13074 MGI:88586
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004508 - steroid 17-alpha-monooxygenase activity [Evidence IMP] GO_process : GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 17; cytochrome P450, 17a1 product : cytochrome P450, family 17, subfamily a, polypeptide 1 protein_id : NP_031835.2

name	2010012O05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385000 GeneID:66439 MGI:1913689
definition	codon_start : 1 product : hypothetical protein LOC66439 protein_id : NP_079839.1

name	As3mt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392105 GeneID:57344 MGI:1929882
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0030791 - arsenite methyltransferase activity [Evidence ISS]; GO:0030792 - methylarsonite methyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018872 - arsonoacetate metabolism [Evidence ISS]; GO:0046685 - response to arsenic [Evidence ISS]; GO:0009404 - toxin metabolism [Evidence ISS] codon_start : 1 note : S-adenosylmethionine:arsenic (III) methyltransferase; methylarsonite methyltransferase; methyltransferase Cyt19 product : arsenic (+3 oxidation state) methyltransferase protein_id : NP_065602.2

name	Cnnm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809000 GeneID:94219 MGI:2151054
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ancient conserved domain protein 2 product : cyclin M2 protein_id : NP_291047.1

name	Nt5c2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560044 CCDS:CCDS29883.1 GeneID:76952 MGI:2178563
definition	GO_function : GO:0008253 - 5'-nucleotidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : 5'-nucleotidase, cytosolic II protein_id : NP_084086.2

name	Ina (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328368 GeneID:226180 MGI:96568
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045104 - intermediate filament cytoskeleton organization and biogenesis [Evidence IMP]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : internexin neuronal intermediate filament protein, alpha protein_id : NP_666212.2

name	Pcgf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076973 CCDS:CCDS29885.1 GeneID:71041 MGI:1918291
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0019904 - protein domain specific binding [Evidence ISS]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Mel18- and Bmi1-like RING finger protein; Mel18 and Bmi1-like RING finger protein; ring finger protein 134 product : polycomb group ring finger 6 protein_id : NP_081930.1

name	Taf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665722 CCDS:CCDS29886.1 GeneID:226182 MGI:2442144
definition	GO_component : GO:0005669 - transcription factor TFIID complex [Evidence ISS] GO_function : GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa product : Tbp-associated factor 5 protein_id : NP_796316.2

name	Usmg5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404294 GeneID:66477 MGI:1891435
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] codon_start : 1 product : upregulated during skeletal muscle growth 5 protein_id : NP_075700.2

name	Pdcd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607128 CCDS:CCDS29888.1 GeneID:18572 MGI:1341788
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA] [Evidence ISS] [Evidence TAS]; GO:0043123 - positive regulation of I-kappaB kinase/NF-kappaB cascade [Evidence ISS] [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS] [Evidence ISS] [Evidence IDA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : programmed cell death protein 7 product : programmed cell death protein 11 protein_id : NP_035183.2

name	2810048G17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981572 CCDS:CCDS29889.1 GeneID:72691 MGI:1919941
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72691 protein_id : NP_598507.2

name	EG546729 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486909 GeneID:546729 MGI:3643383
definition	codon_start : 1 product : predicted gene, EG546729 protein_id : NP_001074740.1

name	EG240669 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270502 GeneID:240669 MGI:3645665
definition	codon_start : 1 product : similar to Family with sequence similarity 26, member A protein_id : XP_140729.8

name	EG629389 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406029 GeneID:629389 MGI:3645322
definition	codon_start : 1 product : similar to Histone H1 protein_id : XP_899364.2

name	Neurl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71534278 CCDS:CCDS29890.1 GeneID:18011 MGI:1334263
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007595 - lactation [Evidence IMP]; GO:0009605 - response to external stimulus [Evidence IMP]; GO:0007288 - sperm axoneme assembly [Evidence IMP]; GO:0030317 - sperm motility [Evidence IMP] codon_start : 1 exception : mismatches in translation product : neuralized homolog protein_id : NP_067335.3

name	EG329070 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244408 GeneID:329070 MGI:3647497
definition	codon_start : 1 product : hypothetical protein LOC329070 protein_id : NP_808501.1

name	Sh3pxd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679801 CCDS:CCDS29891.1 GeneID:14218 MGI:1298393
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : five SH3 domains product : SH3 multiple domains 1 protein_id : NP_032044.1

name	EG629359 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629359
definition	number : 2 pseudo : _no_value

name	EG629359 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629359
definition	number : 1 pseudo : _no_value

name	LOC100042842 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042842
definition	number : 2 pseudo : _no_value

name	LOC100042842 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042842
definition	number : 1 pseudo : _no_value

name	LOC668094 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270562 GeneID:668094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 184 ESTs, 3 Proteins product : similar to U1 snRNP-specific protein C pseudo : _no_value transcript_id : XR_034633.1

clone name	MSMg01-345P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108K11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-545A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186D09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-323F23.b	B6Ng01-323F23.g
ACC	GA111967	GA111968
length	986	796
definition	B6Ng01-323F23.b	B6Ng01-323F23.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(46,411,564 - 46,412,541)	(46,250,343 - 46,251,138)
sequence	gaattctccatccacatggcctgctctcaattgatacttagtgcctctcc actccaagggagtaccatgacactacgtaattgcccagaagatccctcta gccccgcatcccctaataatgtgtctgaagggtgcaggcgggtacctagt cctttgggaggctcgcaagccatctcgggccagtgaggatggggatagct gagttagttggctgtagagaaggaagtgattcctgaggagtcgtgtttgt agaggcagagggaaagatgttttgaattgatgtttgaaagatgtcctgag atgggacggacacgcaaagactctgctgtaggcaaggctgatggccaggc aggagaggccacaccactggcgtggtgagaggtggagcattagttaacaa agactttctccgtgggactctgcgattaacctaccctgtgacctgagggg agtttctcaaaatttcagggccttcatttcctttcaggtaacaggcatca tagaattagccacggtttaagcggctatgaggactaagaaaagttaatga aatgctttatatgcagtcagtagatgctgctttttgccatcatcggagat gttttccctaatgtttttagatttatttaatcaaactatatgtatgtgta ttactcttttgcttgcatgtatgactgtgtaccacatgcatgcccggtac ccttgagctcaaagagaatgttgtatccccagggactggagtttctgggg tagttgtgagtgcggggaatccaacttaggtctaaggcaggatcaagtgc ttcttaactgtttgatctggctctccagcccccatcagaggtattttagc aggatttcatgatacaatggttgtcacatttccatggggtaccatcaatc agcgatatctcattggggcttcttaagaagtaatgggattctatggtcta ttatcttggaatttgaaaatcccaaggaaatcctga	gaattcactatgtagatcaggctaccctggaatgcagatgtctttctacc tctgtcttctgagtgctgagattaaaagtgtatatcactatgtctggcaa gaattgaacttttaaaatttcaaggtataacagaaaactatttttgtttc tttttagaggaaattaaaagaaccaagtttgtcagataaatttatataaa tgactgaatattggaaggggcaaagttggccaaatatatgtatttcctat accacttatttactttcttggtttataataaacataagatgatatatata aatgtagtatatatttacatgcatacatacatacatacacacacagagac aaaacataagattgatgagcatgttagagtgtggcttgattactgggcac agtaactatatttccagctgtttgcgaagtagaggcaggattgctgaggc tcagcagttcaaatcatgatggagcaacaaaatgagaccttgttaaaaaa aggttacaagatcctgcctcaaaattaaggtgaagaataatagaagatgg ccaatggtgacctttggttcaatgatcatgagctcatgtagacacaaaca tgcatacatatgatggggtaataaagactcttgagactagatagctgggt gtggtggtgcgtgcctgttataacatgggagactgacgcggctgcatcat gagtttgagaccagcctggattatacaggtccaggaagggatgagcatag tgagaccctgtctccgaaggaggaagggaaagggaaggagagggtt
quality values	Open. Hide. 49 31 27 24 58 58 62 62 31 23 62 62 37 23 47 37 62 62 62 47 62 62 62 62 62 62 62 47 51 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 49 59 62 62 59 59 62 62 54 49 32 59 62 62 59 62 59 62 59 59 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 59 62 59 62 54 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 49 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 59 62 49 62 62 62 59 62 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 62 62 59 59 59 62 62 62 62 59 59 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 51 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 47 54 47 43 49 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 56 62 62 56 47 51 56 56 56 62 56 51 47 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 54 49 62 62 62 62 56 62 62 56 62 62 62 62 62 43 62 62 62 62 56 62 40 62 52 62 62 62 42 62 62 62 62 62 62 52 62 62 62 62 52 62 53 62 62 62 62 62 62 52 62 62 62 62 62 62 62 52 52 58 58 58 54 54 54 52 52 52 58 54 54 54 42 58 54 54 58 54 54 54 58 54 54 38 23 39 46 54 52 52 54 54 54 44 58 27 37 35 46 54 58 54 34 40 41 41 52 50 54 54 54 41 58 58 58 52 42 52 49 26 58 52 52 42 58 36 35 58 54 54 52 58 54 58 50 58 51 45 34 58 43 54 58 58 51 58 49 54 52 50 52 52 51 52 52 58 58 44 54 33 52 54 51 41 37 52 58 50 58 42 46 53 37 51 58 38 36 26 27 36 37 22 38 50 53 46 30 40 50 50 44 34 48 33 46 35 37 39 49 46 48 48 32 44 15 50 52 35 19 50 51 40 39 39 51 22 30 32 14 29 51 37 32 39 37 35 35 26 27 23 39 32 21 18 40 51 42 37 28 38 58 12 13 35 32 58 58 19 30 32 35 54 32 47 39 35 39 28 45 40 32 37 50 44 29 31 22 29 34 42 26 32 31 17 21 9 6 16 25 37 42 39 24 10 37 13 16 11 39 25 28 23 34 40 26 27 44 21 23 7 9 38 20 31 31 27 14 10 6 41 14 18 31 31 31 20 18 42 21 26 22 37 53 26 31 24 32 27 13 24 12 12 42 31 37 21 15 8 51 18 30 28 34 45 41 42 13 31 26 20 18 29 28 18 10 17 12 22 32 32 18 16 20 14 18 14 38 8 7 27 8 7 21 11 17 13 31 24 29 7 8 8 9 17 29 30 22 29 8 10 9 11 6 12 9 31 7 9 12 8 12 6 24 26 16 20 11 7 9 18 18 34 28 25 15 17 10 10 16 13 15 12 14 16 11 13 33 21 28 31 16 16 41 29 29 31 28 32 11 11 10 8 6 13 9 32 31 31 13 8 13 25 27 31 9 30 18 29 31 24 30 22 10 27 31 16 9 6 7 16 16 18 9 8 13 8 38 26 26 24 12 5 14 11	Open. Hide. 62 47 56 47 62 47 32 47 47 62 62 62 44 51 31 44 47 44 47 62 62 62 59 62 62 62 62 62 59 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 56 59 46 33 46 56 62 62 59 59 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 47 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 54 42 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 58 58 58 54 54 54 54 58 52 54 58 58 58 58 58 52 45 28 46 54 54 58 58 54 58 58 58 58 58 58 58 58 49 39 54 54 54 41 54 58 54 49 54 58 52 58 41 52 54 54 52 58 58 54 54 54 54 58 54 54 52 58 58 58 52 58 54 54 54 58 58 58 52 58 58 51 58 29 58 58 42 54 43 54 54 58 58 52 51 46 39 47 48 48 49 45 49 51 51 50 52 58 58 58 58 51 58 54 54 58 58 50 58 58 53 53 53 58 51 52 37 51 50 46 50 34 43 39 44 50 51 51 49 46 53 50 48 37 52 54 58 58 58 41 58 58 58 54 50 49 54 52 51 58 51 49 51 35 46 50 53 51 51 54 30 39 32 40 51 47 39 49 52 49 50 50 54 54 51 52 54 50 54 54 37 54 54 37 54 42 52 51 51 44 44 52 54 54 39 42 40 39 46 53 40 41 54 32 33 25 26 31 18 39 53 46 30 41 47 34 42 35 34 40 37 25 41 37 40 44 41 46 31 52 49 40 32 53 34 29 9 30 23 32 40 40 32 52 32 32 18 37 31 32 31 32 24 34 53 45 28 34 30 30 30 36 30 22 51 36 26 31 31 51 31 51 31 32 30 31 42 43 41 31 20 10 32 11 19 45 35 31 31 18 33 6 29 29 22 46 31 20 27 34 31 34 47 13 25 46 28 25 46 25 32 46 15 33 9 6 28 18 40 32 20 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_46411564_46412541
seq2: B6Ng01-323F23.b_47_1032 (reverse)

seq1  TCAGGATTTCCTTGGGACTTTTCAAATTCC-AGATAATAGCCCATAGAAT  49
      ||||||||||||||||| |||||||||||| ||||||||| |||||||||
seq2  TCAGGATTTCCTTGGGA-TTTTCAAATTCCAAGATAATAGACCATAGAAT  49

seq1  CCCATTACTTCTTGAG-AGCCCCAATGAGATATCGCTGTTTGGTGGTA-C  97
      ||||||||||||| || ||||||||||||||||||||| ||| ||||| |
seq2  CCCATTACTTCTTAAGAAGCCCCAATGAGATATCGCTGATTGATGGTACC  99

seq1  CCAT-GAAATGTGACAACCATTGTATCATG-AATCCTGCTAAAATACCTC  145
      |||| ||||||||||||||||||||||||| |||||||||||||||||||
seq2  CCATGGAAATGTGACAACCATTGTATCATGAAATCCTGCTAAAATACCTC  149

seq1  TGATGGGGGCTGGAGAGCCAGATC-AACAGTTAAG-AGCACTTGATCCTG  193
      |||||||||||||||||||||||| |||||||||| ||||||||||||||
seq2  TGATGGGGGCTGGAGAGCCAGATCAAACAGTTAAGAAGCACTTGATCCTG  199

seq1  CCTTAGACCTAAGTTGGATTCCCCGCACTCACAACTA-CCCAG-AACTCC  241
      ||||||||||||||||||||||||||||||||||||| ||||| ||||||
seq2  CCTTAGACCTAAGTTGGATTCCCCGCACTCACAACTACCCCAGAAACTCC  249

seq1  AGTCCCTGGGGATACAACATTCTCTTTGAGCTCAAGGGTACCGGGCATGC  291
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCCTGGGGATACAACATTCTCTTTGAGCTCAAGGGTACCGGGCATGC  299

seq1  ATGTGGTACACAGTCATACATGCAAGCAAAAGAGTAATACACATACATAT  341
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGGTACACAGTCATACATGCAAGCAAAAGAGTAATACACATACATAT  349

seq1  AGTTTGATTAAATAAATCTAAAAACATTAGGGAAAACATCTCCGATGATG  391
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTGATTAAATAAATCTAAAAACATTAGGGAAAACATCTCCGATGATG  399

seq1  GCAAAAAGCAGCATCTACTGACTGCATATAAAGCATTTCATTAACTTTTC  441
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAAAGCAGCATCTACTGACTGCATATAAAGCATTTCATTAACTTTTC  449

seq1  TTAGTCCTCATAGCCGCTTAAACCGTGGCTAATTCTATGATGCCTGTTAC  491
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTCCTCATAGCCGCTTAAACCGTGGCTAATTCTATGATGCCTGTTAC  499

seq1  CTGAAAGGAAATGAAGGCCCTGAAATTTTGAGAAACTCCCCTCAGGTCAC  541
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAAAGGAAATGAAGGCCCTGAAATTTTGAGAAACTCCCCTCAGGTCAC  549

seq1  AGGGTAGGTTAATCGCAGAGTCCCACGGAGAAAGTCTTTGTTAACTAATG  591
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTAGGTTAATCGCAGAGTCCCACGGAGAAAGTCTTTGTTAACTAATG  599

seq1  CTCCACCTCTCACCACGCCAGTGGTGTGGCCTCTCCTGCCTGGCCATCAG  641
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCACCTCTCACCACGCCAGTGGTGTGGCCTCTCCTGCCTGGCCATCAG  649

seq1  CCTTGCCTACAGCAGAGTCTTTGCGTGTCCGTCCCATCTCAGGACATCTT  691
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGCCTACAGCAGAGTCTTTGCGTGTCCGTCCCATCTCAGGACATCTT  699

seq1  TCAAACATCAATTCAAAACATCTTTCCCTCTGCCTCTACAAACACGACTC  741
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAACATCAATTCAAAACATCTTTCCCTCTGCCTCTACAAACACGACTC  749

seq1  CTCAGGAATCACTTCCTTCTCTACAGCCAACTAACTCAGCTATCCCCATC  791
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGGAATCACTTCCTTCTCTACAGCCAACTAACTCAGCTATCCCCATC  799

seq1  CTCACTGGCCCGAGATGGCTTGCGAGCCTCCCAAAGGACTAGGTACCCGC  841
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACTGGCCCGAGATGGCTTGCGAGCCTCCCAAAGGACTAGGTACCCGC  849

seq1  CTGCACCCTTCAGACACATTATTAGGGGATGCGGGGCTAGAGGGATCTTC  891
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCACCCTTCAGACACATTATTAGGGGATGCGGGGCTAGAGGGATCTTC  899

seq1  TGGGCAATTACGTAGTGTCATGGTACTCCCTTGGAGTGGAGAGGCACTAA  941
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCAATTACGTAGTGTCATGGTACTCCCTTGGAGTGGAGAGGCACTAA  949

seq1  GTATCAATTGAGAGCAGGCCATGTGGATGGAGAATTC  978
      |||||||||||||||||||||||||||||||||||||
seq2  GTATCAATTGAGAGCAGGCCATGTGGATGGAGAATTC  986

seq1: chr19_46250343_46251138
seq2: B6Ng01-323F23.g_66_861

seq1  GAATTCACTATGTAGATCAGGCTACCCTGGAATGCAGATGTCTTTCTACC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTATGTAGATCAGGCTACCCTGGAATGCAGATGTCTTTCTACC  50

seq1  TCTGTCTTCTGAGTGCTGAGATTAAAAGTGTATATCACTATGTCTGGCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTCTTCTGAGTGCTGAGATTAAAAGTGTATATCACTATGTCTGGCAA  100

seq1  GAATTGAACTTTTAAAATTTCAAGGTATAACAGAAAACTATTTTTGTTTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTGAACTTTTAAAATTTCAAGGTATAACAGAAAACTATTTTTGTTTC  150

seq1  TTTTTAGAGGAAATTAAAAGAACCAAGTTTGTCAGATAAATTTATATAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTAGAGGAAATTAAAAGAACCAAGTTTGTCAGATAAATTTATATAAA  200

seq1  TGACTGAATATTGGAAGGGGCAAAGTTGGCCAAATATATGTATTTCCTAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTGAATATTGGAAGGGGCAAAGTTGGCCAAATATATGTATTTCCTAT  250

seq1  ACCACTTATTTACTTTCTTGGTTTATAATAAACATAAGATGATATATATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACTTATTTACTTTCTTGGTTTATAATAAACATAAGATGATATATATA  300

seq1  AATGTAGTATATATTTACATGCATACATACATACATACACACACAGAGAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTAGTATATATTTACATGCATACATACATACATACACACACAGAGAC  350

seq1  AAAACATAAGATTGATGAGCATGTTAGAGTGTGGCTTGATTACTGGGCAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACATAAGATTGATGAGCATGTTAGAGTGTGGCTTGATTACTGGGCAC  400

seq1  AGTAACTATATTTCCAGCTGTTTGCGAAGTAGAGGCAGGATTGCTGAGGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAACTATATTTCCAGCTGTTTGCGAAGTAGAGGCAGGATTGCTGAGGC  450

seq1  TCAGCAGTTCAAATCATGATGGAGCAACAAAATGAGACCTTGTTAAAAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCAGTTCAAATCATGATGGAGCAACAAAATGAGACCTTGTTAAAAAA  500

seq1  AGGTTACAAGATCCTGCCTCAAAATTAAGGTGAAGAATAATAGAAGATGG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTACAAGATCCTGCCTCAAAATTAAGGTGAAGAATAATAGAAGATGG  550

seq1  CCAATGGTGACCTTTGGTTCAATGATCATGAGCTCATGTAGACACAAACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAATGGTGACCTTTGGTTCAATGATCATGAGCTCATGTAGACACAAACA  600

seq1  TGCATACATATGATGGGGTAATAAAGACTCTTGAGACTAGATAGCTGGGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATACATATGATGGGGTAATAAAGACTCTTGAGACTAGATAGCTGGGT  650

seq1  GTGGTGGTGCGTGCCTGTTATAACATGGGAGACTGACGCGGCTGCATCAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTGGTGCGTGCCTGTTATAACATGGGAGACTGACGCGGCTGCATCAT  700

seq1  GAGTTTGAGACCAGCCTGGATTATACAGGTCCAGGAAGGGATGAGCATAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTTGAGACCAGCCTGGATTATACAGGTCCAGGAAGGGATGAGCATAG  750

seq1  TGAGACCCTGTCTCCGAAGGAGGAAGGGAAAGGGAAGGAGAGGGTT  796
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGACCCTGTCTCCGAAGGAGGAAGGGAAAGGGAAGGAGAGGGTT  796

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information