MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-354J02
Chromosome	19 (Build37)
Map Location	3,345,560 - 3,345,897
singlet/doublet	singlet
Overlap gene	Cpt1a
Upstream gene	LOC630980, LOC665804, EG665806, EG665810, LOC100039218, Ighmbp2, Mrpl21, LOC665826
Downstream gene	Mtl5, Gal, Saps3, LOC100043581, Lrp5, 1810055G02Rik, LOC100039289, Suv420h1, Chka, Tcirg1, Ndufs8, Aldh3b1, Unc93b1, LOC100039337, 1700055N04Rik, Aldh3b2, Acy3, Tbx10, Nudt8, Doc2g, Ndufv1, Gstp1, Gstp2, BC021614, Cabp2, Cdk2ap2, Pitpnm1, Aip, Tmem134, Cabp4, Gpr152, Coro1b, Ptprcap, Rps6kb2, AI790298, Tbc1d10c, Ppp1ca, Rad9, Clcf1, Pold4, Ssh3, Ankrd13d, Adrbk1, Fbxl11
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC630980 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630980
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC665804 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG665806 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665806 MGI:3643126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 3 Proteins pseudo : _no_value

name	EG665810 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665810 MGI:3643377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100039218 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Ighmbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20589 MGI:99954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353242 MGI:2660674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665826 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 9 Proteins pseudo : _no_value

name	Cpt1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12894 MGI:1098296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17771 MGI:1340029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gal (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14419 MGI:95637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Saps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52036 MGI:1921807
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043581 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043581
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Lrp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16973 MGI:1278315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810055G02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72056 MGI:1919306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039289 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Suv420h1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225888 MGI:2444557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chka (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12660 MGI:107760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tcirg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27060 MGI:1350931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufs8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225887 MGI:2385079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh3b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67689 MGI:1914939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc93b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54445 MGI:1859307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039337 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	1700055N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73458 MGI:1920708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 21 Proteins

name	Aldh3b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621603 MGI:2147613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 27 ESTs, 25 Proteins

name	Acy3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71670 MGI:1918920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbx10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109575 MGI:1261436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nudt8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66387 MGI:1913637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Doc2g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60425 MGI:1926250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17995 MGI:107851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14870 MGI:95865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14869 MGI:95864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC021614 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225884 MGI:2385078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cabp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29866 MGI:1352749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk2ap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52004 MGI:1098779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pitpnm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18739 MGI:1197524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11632 MGI:109622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem134 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66990 MGI:1914240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cabp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73660 MGI:1920910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr152 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269053 MGI:2685519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coro1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23789 MGI:1345963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptprcap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19265 MGI:97811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps6kb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58988 MGI:1927343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI790298 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107239 MGI:2147595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 51 ESTs, 3 Proteins

name	Tbc1d10c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108995 MGI:1922072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1ca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19045 MGI:103016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rad9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19367 MGI:1328356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clcf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56708 MGI:1930088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pold4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69745 MGI:1916995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssh3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245857 MGI:2683546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd13d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68423 MGI:1915673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adrbk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110355 MGI:87940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225876 MGI:1354736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665804 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94405687 GeneID:665804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC665804 transcript_id : XM_979552.1

name	Ighmbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678028 GeneID:20589 MGI:99954
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin mu binding protein 2 transcript_id : NM_009212.1

name	Mrpl21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385334 GeneID:353242 MGI:2660674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L21 transcript_id : NM_172252.3

name	Cpt1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27804308 GeneID:12894 MGI:1098296
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carnitine palmitoyltransferase 1a, liver transcript_id : NM_013495.1

name	Mtl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89111948 GeneID:17771 MGI:1340029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : metallothionein-like 5, testis-specific (tesmin) transcript_id : NM_001039657.1

name	Mtl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89111944 GeneID:17771 MGI:1340029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : metallothionein-like 5, testis-specific (tesmin) transcript_id : NM_001039658.1

name	Gal (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129967 GeneID:14419 MGI:95637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galanin transcript_id : NM_010253.3

name	Saps3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22726196 GeneID:52036 MGI:1921807
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SAPS domain family, member 3 transcript_id : NM_029456.1

name	LOC100043581 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270264 GeneID:100043581
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043581 transcript_id : XM_001480817.1

name	Lrp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381607 GeneID:16973 MGI:1278315
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : low density lipoprotein receptor-related protein 5 transcript_id : NM_008513.2

name	1810055G02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803062 GeneID:72056 MGI:1919306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810055G02 gene transcript_id : NM_028077.2

name	Suv420h1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801842 GeneID:225888 MGI:2444557
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of variegation 4-20 homolog 1 (Drosophila) transcript_id : NM_144871.3

name	Chka (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:95147346 GeneID:12660 MGI:107760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : choline kinase alpha transcript_id : NM_013490.3

name	Chka (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70908365 GeneID:12660 MGI:107760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : choline kinase alpha transcript_id : NM_001025566.1

name	Tcirg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980623 GeneID:27060 MGI:1350931
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3 transcript_id : NM_016921.2

name	Ndufs8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364966 GeneID:225887 MGI:2385079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) Fe-S protein 8 transcript_id : NM_144870.4

name	Aldh3b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328287 GeneID:67689 MGI:1914939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 3 family, member B1 transcript_id : NM_026316.2

name	Unc93b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956093 GeneID:54445 MGI:1859307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-93 homolog B1 (C. elegans) transcript_id : NM_019449.1

name	1700055N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405716 GeneID:73458 MGI:1920708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 21 Proteins product : RIKEN cDNA 1700055N04 gene, transcript variant 1 transcript_id : XM_895013.2

name	Aldh3b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405693 GeneID:621603 MGI:2147613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 27 ESTs, 25 Proteins product : aldehyde dehydrogenase 3 family, member B2 transcript_id : XM_129134.7

name	Acy3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893369 GeneID:71670 MGI:1918920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aspartoacylase (aminoacylase) 3 transcript_id : NM_027857.3

name	Tbx10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47604969 GeneID:109575 MGI:1261436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 10 transcript_id : NM_001001320.1

name	Tbx10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133506835 GeneID:109575 MGI:1261436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 10 transcript_id : NM_011533.1

name	Nudt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381955 GeneID:66387 MGI:1913637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 8 transcript_id : NM_025529.3

name	Doc2g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139949244 GeneID:60425 MGI:1926250
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : double C2, gamma transcript_id : NM_021791.3

name	Ndufv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130958 GeneID:17995 MGI:107851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) flavoprotein 1 transcript_id : NM_133666.2

name	Gstp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10092607 GeneID:14870 MGI:95865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, pi 1 transcript_id : NM_013541.1

name	Gstp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45597456 GeneID:14869 MGI:95864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, pi 2 transcript_id : NM_181796.2

name	BC021614 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130056 GeneID:225884 MGI:2385078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC021614 transcript_id : NM_144869.2

name	Cabp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304940 GeneID:29866 MGI:1352749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding protein 2 transcript_id : NM_013878.1

name	Cdk2ap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348581 GeneID:52004 MGI:1098779
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDK2-associated protein 2 transcript_id : NM_026373.2

name	Pitpnm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357370 GeneID:18739 MGI:1197524
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol membrane-associated 1 transcript_id : NM_008851.2

name	Aip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131102 GeneID:11632 MGI:109622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aryl-hydrocarbon receptor-interacting protein transcript_id : NM_016666.2

name	Tmem134 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118403329 GeneID:66990 MGI:1914240
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 134 transcript_id : NM_001078649.1

name	Tmem134 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118403318 GeneID:66990 MGI:1914240
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 134 transcript_id : NM_025889.2

name	Cabp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982570 GeneID:73660 MGI:1920910
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding protein 4 transcript_id : NM_144532.2

name	Gpr152 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71534279 GeneID:269053 MGI:2685519
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 152 transcript_id : NM_206973.2

name	Coro1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388278 GeneID:23789 MGI:1345963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 1B transcript_id : NM_011778.2

name	Ptprcap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60499027 GeneID:19265 MGI:97811
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, C polypeptide-associated protein transcript_id : NM_016933.3

name	Rps6kb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130463 GeneID:58988 MGI:1927343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S6 kinase, polypeptide 2 transcript_id : NM_021485.2

name	AI790298 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270257 GeneID:107239 MGI:2147595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 51 ESTs, 3 Proteins product : expressed sequence AI790298, transcript variant 3 transcript_id : XM_902445.3

name	Tbc1d10c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517464 GeneID:108995 MGI:1922072
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 10c transcript_id : NM_178650.3

name	Ppp1ca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892519 GeneID:19045 MGI:103016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, catalytic subunit, alpha isoform transcript_id : NM_031868.2

name	Rad9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892125 GeneID:19367 MGI:1328356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD9 homolog (S. pombe) transcript_id : NM_011237.2

name	Clcf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373681 GeneID:56708 MGI:1930088
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cardiotrophin-like cytokine factor 1 transcript_id : NM_019952.2

name	Pold4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367718 GeneID:69745 MGI:1916995
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA-directed), delta 4 transcript_id : NM_027196.2

name	Ssh3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130790 GeneID:245857 MGI:2683546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : slingshot homolog 3 (Drosophila) transcript_id : NM_198113.2

name	Ankrd13d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363887 GeneID:68423 MGI:1915673
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 13 family, member D transcript_id : NM_026720.2

name	Adrbk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859768 GeneID:110355 MGI:87940
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor kinase, beta 1 transcript_id : NM_130863.1

name	Fbxl11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100818177 GeneID:225876 MGI:1354736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 11 transcript_id : NM_001001984.2

name	LOC665804 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94405688 GeneID:665804
definition	codon_start : 1 product : hypothetical protein protein_id : XP_984646.1

name	Ighmbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678029 CCDS:CCDS29393.1 GeneID:20589 MGI:99954
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0043025 - cell soma [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation function : specific to 5'-phosphorylated, G-rich single stranded DNA note : immunoglobulin S mu binding protein 2; antifreeze enhancer-binding protein; neuromuscular degeneration; p110 subunit product : immunoglobulin mu binding protein 2 protein_id : NP_033238.1

name	Mrpl21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982032 CCDS:CCDS29394.1 GeneID:353242 MGI:2660674
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L21 protein_id : NP_758456.2

name	Cpt1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27804309 CCDS:CCDS29395.1 GeneID:12894 MGI:1098296
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004095 - carnitine O-palmitoyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carnitine palmitoyltransferase 1, liver; L-CPT I product : carnitine palmitoyltransferase 1a, liver protein_id : NP_038523.1

name	Mtl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89111949 GeneID:17771 MGI:1340029
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : metallothionein-like 5, testis-specific isoform a protein_id : NP_001034746.1

name	Mtl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89111945 GeneID:17771 MGI:1340029
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : metallothionein-like 5, testis-specific isoform b protein_id : NP_001034747.1

name	Gal (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753940 CCDS:CCDS29396.1 GeneID:14419 MGI:95637
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] GO_process : GO:0007399 - nervous system development [Evidence IMP]; GO:0007218 - neuropeptide signaling pathway [Evidence IMP] codon_start : 1 product : galanin protein_id : NP_034383.1

name	Saps3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22726197 CCDS:CCDS29397.1 GeneID:52036 MGI:1921807
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : sporulation-induced transcript 4-associated protein product : SAPS domain family, member 3 protein_id : NP_083732.1

name	LOC100043581 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270265 GeneID:100043581
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480867.1

name	Lrp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678716 GeneID:16973 MGI:1278315
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IGI]; GO:0042074 - cell migration involved in gastrulation [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0042733 - embryonic digit morphogenesis [Evidence IGI]; GO:0006897 - endocytosis [Evidence IEA]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IGI]; GO:0016055 - Wnt receptor signaling pathway [Evidence IGI] codon_start : 1 exception : mismatches in translation note : low density lipoprotein-related protein 5 product : low density lipoprotein receptor-related protein 5 protein_id : NP_032539.1

name	1810055G02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312486 GeneID:72056 MGI:1919306
definition	codon_start : 1 product : hypothetical protein LOC72056 protein_id : NP_082353.1

name	Suv420h1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542284 CCDS:CCDS29399.1 GeneID:225888 MGI:2444557
definition	GO_component : GO:0000780 - condensed nuclear chromosome, pericentric region [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0042799 - histone lysine N-methyltransferase activity (H4-K20 specific) [Evidence IDA] GO_process : GO:0016571 - histone methylation [Evidence IDA] codon_start : 1 exception : mismatches in translation product : suppressor of variegation 4-20 homolog 1 protein_id : NP_659120.2

name	Chka (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70908364 CCDS:CCDS29400.1 GeneID:12660 MGI:107760
definition	GO_function : GO:0004103 - choline kinase activity [Evidence IDA]; GO:0004104 - cholinesterase activity [Evidence IDA]; GO:0004305 - ethanolamine kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006656 - phosphatidylcholine biosynthesis [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; CK/EK-alpha; choline/ethanolamine kinase alpha; choline/ethanolamine kinase-alpha product : choline kinase alpha isoform 1 protein_id : NP_038518.2

name	Chka (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70908366 GeneID:12660 MGI:107760
definition	GO_function : GO:0004103 - choline kinase activity [Evidence IDA]; GO:0004104 - cholinesterase activity [Evidence IDA]; GO:0004305 - ethanolamine kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006656 - phosphatidylcholine biosynthesis [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; CK/EK-alpha; choline/ethanolamine kinase alpha; choline/ethanolamine kinase-alpha product : choline kinase alpha isoform 2 protein_id : NP_001020737.1

name	Tcirg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980624 CCDS:CCDS29401.1 GeneID:27060 MGI:1350931
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0015992 - proton transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : osteosclerotic; ATPase, H+ transporting, lysosomal I; V-ATPase a3 product : T-cell, immune regulator 1 protein_id : NP_058617.2

name	Ndufs8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195430 CCDS:CCDS29402.1 GeneID:225887 MGI:2385079
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) Fe-S protein 8 protein_id : NP_659119.2

name	Aldh3b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328288 CCDS:CCDS29403.1 GeneID:67689 MGI:1914939
definition	GO_function : GO:0004030 - aldehyde dehydrogenase [NAD(P)+] activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006081 - aldehyde metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : ALDH class 3-like; microsomal aldehyde dehydrogenase-like product : fatty aldehyde dehydrogenase-like protein_id : NP_080592.2

name	Unc93b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956094 CCDS:CCDS29404.1 GeneID:54445 MGI:1859307
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP]; GO:0008063 - Toll signaling pathway [Evidence IMP] codon_start : 1 exception : mismatches in translation note : unc-93 homolog B product : unc93 homolog B protein_id : NP_062322.1

name	1700055N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82997826 GeneID:73458 MGI:1920708
definition	codon_start : 1 product : hypothetical protein LOC73458 isoform 1 protein_id : XP_900106.1

name	Aldh3b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38084778 GeneID:621603 MGI:2147613
definition	codon_start : 1 product : similar to Aldehyde dehydrogenase 3 family, member B1 protein_id : XP_129134.2

name	Acy3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982632 CCDS:CCDS29406.1 GeneID:71670 MGI:1918920
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004046 - aminoacylase activity [Evidence IDA]; GO:0019807 - aspartoacylase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IDA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : acylase III; hepatitis C virus core-binding protein 1 product : aspartoacylase-3 protein_id : NP_082133.2

name	Tbx10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47604970 CCDS:CCDS29407.1 GeneID:109575 MGI:1261436
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; T-box 13; dancer product : T-box 10 isoform 1 protein_id : NP_001001320.1

name	Tbx10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133506836 GeneID:109575 MGI:1261436
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; T-box 13; dancer product : T-box 10 isoform 2 protein_id : NP_035663.1

name	Nudt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384950 CCDS:CCDS29408.1 GeneID:66387 MGI:1913637
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : nudix-type motif 8 protein_id : NP_079805.1

name	Doc2g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254529 CCDS:CCDS29409.1 GeneID:60425 MGI:1926250
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : double C2, gamma protein_id : NP_068563.2

name	Ndufv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526814 CCDS:CCDS29410.1 GeneID:17995 MGI:107851
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0010181 - FMN binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0016651 - oxidoreductase activity, acting on NADH or NADPH [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : NADH dehydrogenase flavoprotein 1; 24 kDa (FP) product : NADH dehydrogenase (ubiquinone) flavoprotein 1 protein_id : NP_598427.1

name	Gstp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10092608 CCDS:CCDS29411.1 GeneID:14870 MGI:95865
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006749 - glutathione metabolism [Evidence IDA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : Gst p-1 product : glutathione S-transferase, pi 1 protein_id : NP_038569.1

name	Gstp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32401425 CCDS:CCDS29412.1 GeneID:14869 MGI:95864
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IDA] GO_process : GO:0006749 - glutathione metabolism [Evidence IDA] codon_start : 1 note : Gst p-2 product : glutathione S-transferase, pi 2 protein_id : NP_861461.1

name	BC021614 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450105 GeneID:225884 MGI:2385078
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC225884 protein_id : NP_659118.1

name	Cabp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304941 CCDS:CCDS29413.1 GeneID:29866 MGI:1352749
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : calcium binding protein 2 protein_id : NP_038906.1

name	Cdk2ap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385870 CCDS:CCDS29414.1 GeneID:52004 MGI:1098779
definition	codon_start : 1 product : DOC-1 related protein protein_id : NP_080649.1

name	Pitpnm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679339 GeneID:18739 MGI:1197524
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005543 - phospholipid binding [Evidence ISS] GO_process : GO:0015031 - protein transport [Evidence IEA] codon_start : 1 note : retinal degeneration 9 product : phosphatidylinositol membrane-associated 1 protein_id : NP_032877.1

name	Aip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7709982 CCDS:CCDS29415.1 GeneID:11632 MGI:109622
definition	GO_component : GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003712 - transcription cofactor activity [Evidence IPI] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006805 - xenobiotic metabolism [Evidence IPI] codon_start : 1 product : aryl-hydrocarbon receptor-interacting protein protein_id : NP_057875.1

name	Tmem134 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118403330 GeneID:66990 MGI:1914240
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform a is encoded by transcript variant 1 product : hypothetical protein LOC66990 isoform a protein_id : NP_001072117.1

name	Tmem134 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385378 GeneID:66990 MGI:1914240
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform b is encoded by transcript variant 2 product : hypothetical protein LOC66990 isoform b protein_id : NP_080165.1

name	Cabp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746185 CCDS:CCDS29416.1 GeneID:73660 MGI:1920910
definition	GO_component : GO:0009288 - flagellum (sensu Bacteria) [Evidence IEA] GO_process : GO:0001539 - ciliary or flagellar motility [Evidence IEA] codon_start : 1 product : calcium binding protein 4 protein_id : NP_653115.1

name	Gpr152 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195446 CCDS:CCDS29417.1 GeneID:269053 MGI:2685519
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : putative G-protein coupled receptor protein_id : NP_996856.1

name	Coro1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753494 CCDS:CCDS29418.1 GeneID:23789 MGI:1345963
definition	GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : coronin 1b; coronin 2 product : coronin, actin binding protein 1B protein_id : NP_035908.1

name	Ptprcap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18640746 GeneID:19265 MGI:97811
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 note : CD45-associated protein product : protein tyrosine phosphatase, receptor type, C polypeptide-associated protein protein_id : NP_058629.2

name	Rps6kb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946894 CCDS:CCDS29419.1 GeneID:58988 MGI:1927343
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : S6 kinase 2; ribosomal protein S6 kinase, 70kD, polypeptide 2 product : ribosomal protein S6 kinase, polypeptide 2 protein_id : NP_067460.1

name	AI790298 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270258 GeneID:107239 MGI:2147595
definition	codon_start : 1 product : hypothetical protein LOC107239 isoform 3 protein_id : XP_907538.3

name	Tbc1d10c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517465 GeneID:108995 MGI:1922072
definition	codon_start : 1 note : EBP50-PDZ interactor of 64 kD product : TBC1 domain family, member 10c protein_id : NP_848765.2

name	Ppp1ca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994195 CCDS:CCDS29421.1 GeneID:19045 MGI:103016
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0000163 - protein phosphatase type 1 activity [Evidence ISS] [Evidence TAS] [Evidence IDA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence IDA] GO_process : GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence TAS]; GO:0007143 - female meiosis [Evidence TAS]; GO:0005977 - glycogen metabolism [Evidence TAS]; GO:0030324 - lung development [Evidence IMP]; GO:0008152 - metabolism [Evidence TAS]; GO:0006470 - protein amino acid dephosphorylation [Evidence TAS] [Evidence IDA]; GO:0006417 - regulation of protein biosynthesis [Evidence TAS] codon_start : 1 product : protein phosphatase 1, catalytic subunit, alpha protein_id : NP_114074.1

name	Rad9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755282 CCDS:CCDS29422.1 GeneID:19367 MGI:1328356
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0008853 - exodeoxyribonuclease III activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000075 - cell cycle checkpoint [Evidence IGI]; GO:0000077 - DNA damage checkpoint [Evidence ISS]; GO:0006281 - DNA repair [Evidence IEA]; GO:0043065 - positive regulation of apoptosis [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0009314 - response to radiation [Evidence ISS] codon_start : 1 note : Rad9-like protein product : RAD9 homolog protein_id : NP_035367.1

name	Clcf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910314 CCDS:CCDS29423.1 GeneID:56708 MGI:1930088
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0005125 - cytokine activity [Evidence ISS] [Evidence IDA]; GO:0008083 - growth factor activity [Evidence ISS] GO_process : GO:0030183 - B cell differentiation [Evidence IDA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence ISS]; GO:0007259 - JAK-STAT cascade [Evidence IDA]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0042517 - positive regulation of tyrosine phosphorylation of Stat3 protein [Evidence ISS] codon_start : 1 note : neurotrophin-1/B-cell stimulating factor-3; NNT-1/BSF-3; B-cell stimulating factor 3 product : cardiotrophin-like cytokine factor 1 protein_id : NP_064336.1

name	Pold4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312396 CCDS:CCDS29424.1 GeneID:69745 MGI:1916995
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0001938 - positive regulation of endothelial cell proliferation [Evidence IMP] codon_start : 1 note : DNA polymerase delta smallest subunit p12 product : small subunit DNA polymerase delta p12 protein_id : NP_081472.1

name	Ssh3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674269 CCDS:CCDS29425.1 GeneID:245857 MGI:2683546
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : slingshot-3L; slingshot-like 3 product : slingshot homolog 3 protein_id : NP_932781.1

name	Ankrd13d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:142363888 GeneID:68423 MGI:1915673
definition	codon_start : 1 product : ankyrin repeat domain 13 family, member D protein_id : NP_080996.2

name	Adrbk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859769 CCDS:CCDS29426.1 GeneID:110355 MGI:87940
definition	GO_component : GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004703 - G-protein coupled receptor kinase activity [Evidence IDA] [Evidence IMP]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0002026 - cardiac inotropy [Evidence IGI]; GO:0002029 - desensitization of G-protein coupled receptor protein signaling pathway [Evidence IGI] [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007507 - heart development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : beta ARK; beta ARK1; beta-AR kinase-1; beta-adrenergic receptor kinase-1 product : adrenergic receptor kinase, beta 1 protein_id : NP_570933.1

name	Fbxl11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100818178 GeneID:225876 MGI:1354736
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box protein containing leucine repeats product : F-box and leucine-rich repeat protein 11 protein_id : NP_001001984.2

name	LOC630980 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630980
definition	number : 1 pseudo : _no_value

name	LOC630980 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630980
definition	number : 2 pseudo : _no_value

name	LOC630980 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630980
definition	number : 3 pseudo : _no_value

name	LOC630980 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630980
definition	number : 4 pseudo : _no_value

name	EG665810 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665810
definition	number : 1 pseudo : _no_value

name	EG665810 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665810
definition	number : 2 pseudo : _no_value

name	EG665810 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665810
definition	number : 3 pseudo : _no_value

name	LOC100039218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039218
definition	number : 3 pseudo : _no_value

name	LOC100039218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039218
definition	number : 2 pseudo : _no_value

name	LOC100039218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039218
definition	number : 1 pseudo : _no_value

name	LOC100039289 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039289
definition	number : 2 pseudo : _no_value

name	LOC100039289 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039289
definition	number : 1 pseudo : _no_value

name	LOC100039337 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039337
definition	number : 3 pseudo : _no_value

name	LOC100039337 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039337
definition	number : 2 pseudo : _no_value

name	LOC100039337 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039337
definition	number : 1 pseudo : _no_value

name	EG665806 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270263 GeneID:665806 MGI:3643126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 3 Proteins product : predicted gene, EG665806 pseudo : _no_value transcript_id : XR_001789.2

name	LOC665826 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270256 GeneID:665826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 9 Proteins product : similar to Ribosomal protein L7a pseudo : _no_value transcript_id : XR_030727.1

clone name	MSMg01-485A23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-477M18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-490C05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386K13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487H08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-491I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319D05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-082J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-539N05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-395L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045G17
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-354J02.T7 (MSMg01no354_j02.b1)	MSMg01-354J02.TJ (MSMg01no354_j02.g1)
ACC	AG465165	AG465166
length	728	731
length of high quality (start - end)	568 (75 - 642)	545 (85 - 629)
definition	CHROMAT_FILE: MSMg01no354_j02.b1 PHD_FILE: MSMg01no354_j02.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:47:45 2005	CHROMAT_FILE: MSMg01no354_j02.g1 PHD_FILE: MSMg01no354_j02.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:47:45 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	CCTCTTTTCTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXCGCGGAATTCAGTCTTTTTCGAATGTTTCATCAGGTGGCTAAACTGTA CAGATTCTGCTGGAAATGTTCCATGGTATTTCAGTAGCCAGAATGAATAA CTTGGCTAAGTCCAGAGCCCTGCTCTCTGAGCATCTGCCCCAGATACAGA GGCAGAGTATGAAGTGGAACATTGTTTTATTCCTAGGTGCTCAGGACAGA CTGATCAACCTCCAGTAACATATGTGGTTAGTAAGTGCTTCATCTTGTGC AGCCATTAATAACCAAGTCATAGGATAGTGAATCTAAAATACTTCTGGGT AAAATTTGTATTAGAATGGGGAAAAAAATGAGGGTCAGAAAGGTGAGCTA ACTTCAAGTTGGATAACCCCCTCTATTTTGTTTGTTTTAGTCTGTCCACA ACATGAAAATATACAAAAACTATATTTTAAAAATCAGTTTACTTTCATCT TTTCTCTTTAGGCTTTCAATAAAGACCAGAAGGACTGATAGACAGCTAGA GAGGATCGTGTAGGCATCCAGATTAGAATGGGAGAATCCATGACGATCTG AAGACTGCTTTGACATCACCCATGGAGATACAGAGTTTGGCGTTTGCCCA GCTGGTTTCCTGTCTTTCTTTGGGGATTACAGCTAAGTGGTTGTATGAAT CTCATACTACACCTTGAACTTTGGATTT	TCCCCCCCCGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCAGGCTGGACTACAGA CAGATCTTGTAGCAAGAACAAAAACAAACGAACTCAATAAATACATTAAT GAACTTTTGAAACACCGGGGAACTATTTCGATGCAAACTTTTCTGTATGT GTATGTGAGTGCACATGCGTTCGTGGGTGTGCATACCTGCAGGCCTGAGT TCAACACGAGATGCATTCTTCTGTGGCTTATAACCTTACTGTTTGGAGGC AAGGTCTCTCACAGGACCTGGAGCACGCTGACTGGCTGAGTGATCCGTGA ACCCGAGGAACCTCCTGCTCCCACCACCAACCCCAGCACTGGAAACTGAC CTGCGCTTCTGTTCTCAGCACTTTCCATGGATACTGAGGCTCAAACTCAG GCCCTCAAGCCCAGCCTGCACTTTACCCACTGAGTCATCTCCCCAGCTCA CAAGGGGGTTGTTAACAGCAGTGGATTAAACACAGTGTTGCAATTAATTC TATCCAAAGTCATGAACCCCATGTTTGCCCGGAAACCAAACCTGGTCTCA GGACAATCATGGGGCCTGGGAATATTTATGGTGTCCTTTCCAGGGTGAAA TAGCCCCTGTACATGACCTGAGTCTAATGTTCAGAACCACCCGAACCTAC CAAGTGTGACGGCACAAGCCTATATATCCAA
quality values	Open. Hide. 6 6 6 8 10 10 9 9 12 12 10 10 9 9 11 15 23 34 33 32 30 27 28 28 23 23 24 28 28 28 37 44 22 19 10 9 10 8 10 8 10 8 10 15 16 33 33 28 28 28 30 30 30 48 57 48 35 31 28 28 28 28 30 27 18 13 14 11 7 6 6 6 8 8 10 23 23 47 33 33 33 36 36 50 57 57 50 59 59 57 57 57 59 57 57 57 57 57 48 42 42 42 42 42 54 68 50 57 57 57 57 59 59 51 51 50 50 50 50 50 50 47 54 57 57 57 57 57 57 57 57 57 57 57 57 57 47 47 47 47 57 57 57 57 50 47 50 50 51 47 57 57 57 57 57 57 57 59 59 59 48 50 50 54 59 57 50 52 52 57 59 57 57 57 59 59 68 57 57 57 57 57 57 57 57 57 52 52 52 52 52 52 57 57 57 57 37 37 57 57 57 57 57 57 57 57 57 57 68 68 57 57 57 57 57 57 57 57 57 57 57 57 59 68 68 68 68 68 57 57 57 57 57 59 59 59 59 59 57 57 57 43 39 57 62 62 62 62 62 62 62 68 62 62 62 62 62 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 68 62 62 62 62 52 52 62 62 62 62 62 62 52 45 43 43 43 39 39 39 43 62 62 62 62 62 62 43 52 43 59 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 44 44 35 35 31 44 44 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 43 43 35 35 35 43 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 57 57 57 57 52 52 52 59 57 57 57 59 59 57 57 57 57 57 54 54 43 57 39 39 35 38 24 28 28 44 44 57 57 57 57 59 59 52 52 43 43 43 43 52 52 52 57 57 57 57 37 43 52 57 44 59 43 43 38 43 43 52 52 59 59 59 59 59 57 57 57 52 52 52 52 59 52 43 43 35 35 35 44 44 57 68 68 57 57 57 48 57 59 59 59 57 57 57 59 59 59 59 59 59 59 57 57 57 57 43 43 43 57 44 44 43 37 42 36 36 25 28 28 39 39 43 46 46 48 48 44 39 30 30 30 32 31 35 37 37 42 41 37 33 33 39 42 48 34 32 22 23 28 30 30 20 20 18 19 14 24 14 18 23 28 30 30 18 18 20 30 30 27 24 33 34 37 26 26 22 22 14 18 24 34 28 28 28 28 37 33 37 28 24 14 14 14 30 30 48 48 48 48 43 37 37 19 18 11 11 11 16 25 29 34 24 22 22 22 22 23 24 25 12 12 12 22 22 28 28 34 28 24 24 20 20 11 12 12 19 15 20 18 20 28 34 37 37 37 37 37 37 32 32 23 24 13 21 11 12 14 28 22 20 21 15 15 13 13 15 21 24 22 19 12 11 11 18 12 13 13 14 14 16 16 15 15 15 15 13 10 10 10 10 10 10 9 9 9 9 9 9 13 15 16 11 11 11 10 10 8 8 8 9 9 8 11 13 18 17 14	Open. Hide. 9 9 10 9 11 13 13 6 7 6 8 10 10 10 10 10 11 7 9 9 9 13 14 31 31 44 44 44 41 42 50 50 50 50 50 47 34 34 28 20 10 8 8 8 8 8 19 10 18 18 33 27 43 43 43 48 39 39 47 47 37 48 41 59 47 43 25 18 12 9 9 10 15 22 22 47 47 47 29 29 35 35 36 35 36 36 36 42 59 57 57 57 47 47 43 48 47 47 47 47 48 48 53 53 54 68 54 57 59 59 54 54 54 54 54 48 50 48 54 54 54 57 57 54 54 54 57 57 57 57 59 57 57 57 54 54 57 57 68 68 57 57 57 57 57 57 57 68 68 68 57 57 57 57 57 57 57 68 68 68 68 57 57 57 57 57 59 57 57 50 50 50 50 68 68 59 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 57 57 57 59 59 59 59 59 59 59 57 59 57 59 59 59 59 59 57 57 57 57 57 57 57 57 59 57 57 59 43 43 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 45 45 62 62 62 62 62 62 62 62 62 62 52 43 43 43 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 52 52 52 62 52 52 62 62 62 62 62 52 62 62 52 62 62 62 62 62 62 62 62 62 62 62 54 52 62 62 62 68 68 68 68 44 44 35 35 35 44 44 57 52 52 52 57 59 59 59 57 57 57 57 57 57 57 57 57 43 52 43 59 59 57 45 52 52 57 52 57 57 59 57 57 52 59 57 52 52 57 57 57 57 59 52 52 52 57 52 52 52 52 52 59 59 54 54 57 59 59 54 54 54 57 57 57 57 57 57 57 54 52 57 52 57 57 57 57 57 50 48 59 57 43 44 43 43 43 44 44 59 48 48 48 48 57 57 57 59 57 42 42 35 42 37 37 35 35 37 42 42 44 44 37 37 37 41 39 39 39 37 39 47 59 57 57 54 54 48 57 48 48 47 48 46 42 48 54 42 42 39 42 42 48 42 42 47 42 39 40 40 30 30 32 37 39 39 39 43 43 43 43 34 37 30 37 30 37 25 30 30 20 20 25 35 35 39 39 40 47 39 35 35 32 32 24 24 12 21 19 30 34 30 30 28 24 21 16 17 18 19 19 32 24 25 28 28 25 20 28 24 24 24 24 24 20 28 23 18 18 12 19 19 30 21 17 15 18 16 24 20 22 22 19 20 17 11 11 11 10 11 11 10 15 8 8 8 10 10 19 22 30 24 24 18 21 12 11 11 24 23 16 10 10 10 11 11 16 11 12 11 12 12 11 11 11 20 13 19 11 10 8 8 10 10 8 10 10 10 12 14 11 16 11 15 14 16 8 8 6 6 6 8 11 11 11 10 10 7 7 6 8 8 10 10 10 10

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no354_j02.g1 MSMg01no354_j02.g1 CHROMAT_FILE:
MSMg01no354_j02.g1 PHD_FILE: MSMg01no354_j02.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 22:47:45 2005
         (545 letters)



>mm_chr19_3345560_3346504
          Length = 945

 Score =  654 bits (338), Expect = 0.0
 Identities = 338/338 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   caggctggactacagacagatcttgtagcaagaacaaaaacaaacgaactcaataaatac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 338 caggctggactacagacagatcttgtagcaagaacaaaaacaaacgaactcaataaatac 279

                                                                       
Query: 61  attaatgaacttttgaaacaccggggaactatttcgatgcaaacttttctgtatgtgtat 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 278 attaatgaacttttgaaacaccggggaactatttcgatgcaaacttttctgtatgtgtat 219

                                                                       
Query: 121 gtgagtgcacatgcgttcgtgggtgtgcatacctgcaggcctgagttcaacacgagatgc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 218 gtgagtgcacatgcgttcgtgggtgtgcatacctgcaggcctgagttcaacacgagatgc 159

                                                                       
Query: 181 attcttctgtggcttataaccttactgtttggaggcaaggtctctcacaggacctggagc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 158 attcttctgtggcttataaccttactgtttggaggcaaggtctctcacaggacctggagc 99

                                                                       
Query: 241 acgctgactggctgagtgatccgtgaacccgaggaacctcctgctcccaccaccaacccc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 98  acgctgactggctgagtgatccgtgaacccgaggaacctcctgctcccaccaccaacccc 39

                                                 
Query: 301 agcactggaaactgacctgcgcttctgttctcagcact 338
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 38  agcactggaaactgacctgcgcttctgttctcagcact 1


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 18
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 545
Length of database: 945
Length adjustment: 10
Effective length of query: 535
Effective length of database: 935
Effective search space:   500225
Effective search space used:   500225
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information