MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-044D01
Chromosome	2 (Build37)
Map Location	151,155,557 - 151,156,619
singlet/doublet	singlet
Overlap gene	none
Upstream gene	3300002I08Rik, LOC100043832, OTTMUSG00000015730, LOC668924, OTTMUSG00000015743, LOC545472, Cst7, 2310001A20Rik, Acss1, Vsx1, Entpd6, LOC100043605, Pygb, Abhd12, Gins1, LOC668925, 4930519N13Rik, LOC668926, Nanp, LOC433486, LOC381390, 4930442J19Rik
Downstream gene	LOC100043839, LOC100043840, 4921509C19Rik, Nsfl1c, Fkbp1a, Sdcbp2, Snph, LOC668929, BC052486, 5430405G05Rik, Psmf1, Rspo4, Angpt4, 5430432M24Rik, 2310046K01Rik, Scrt2, Srxn1, Tcf15, LOC100043843, Csnk2a1, Tbc1d20, Rbck1
Link	Open Mouse BAC browser

Click to get alignment info.

name	3300002I08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69277 MGI:1916527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043832 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 30 ESTs, 34 Proteins pseudo : _no_value

name	OTTMUSG00000015730 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668923 MGI:3651999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 1 Protein

name	LOC668924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 3 Proteins pseudo : _no_value

name	OTTMUSG00000015743 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545471 MGI:3652219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545472 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 177 ESTs, 23 Proteins

name	Cst7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13011 MGI:1298217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310001A20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71881 MGI:1919131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68738 MGI:1915988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vsx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114889 MGI:1890816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Entpd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12497 MGI:1202295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043605 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Pygb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110078 MGI:97828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76192 MGI:1923442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gins1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69270 MGI:1916520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 53 ESTs, 3 Proteins

name	LOC668925 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	4930519N13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78177 MGI:1925427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668926 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins pseudo : _no_value

name	Nanp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67311 MGI:1914561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433486 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 39 Proteins

name	LOC381390 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381390
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 38 Proteins

name	4930442J19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74660 MGI:1921910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100043839 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 140 ESTs, 5 Proteins

name	LOC100043840 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 53 mRNAs, 2805 ESTs, 35 Proteins pseudo : _no_value

name	4921509C19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381393 MGI:2685851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsfl1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:386649 MGI:3042273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14225 MGI:95541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdcbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228765 MGI:2385156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241727 MGI:2139270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668929 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	BC052486 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228767 MGI:3039588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs

name	5430405G05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108832 MGI:1918629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 3 Proteins

name	Psmf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228769 MGI:1346072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rspo4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228770 MGI:1924467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Angpt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11602 MGI:1336887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430432M24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73847 MGI:1921097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2310046K01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69698 MGI:1916948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scrt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545474 MGI:2139287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein

name	Srxn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76650 MGI:104971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcf15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21407 MGI:104664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043843 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 665 ESTs, 7 Proteins pseudo : _no_value

name	Csnk2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12995 MGI:88543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67231 MGI:1914481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbck1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24105 MGI:1344372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	3300002I08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21746148 GeneID:69277 MGI:1916527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3300002I08 gene transcript_id : NM_027017.1

name	OTTMUSG00000015730 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250198 GeneID:668923 MGI:3651999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 1 Protein product : predicted gene, OTTMUSG00000015730 transcript_id : XM_001481090.1

name	OTTMUSG00000015743 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367199 GeneID:545471 MGI:3652219
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000015743 transcript_id : NM_001034900.2

name	LOC545472 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250050 GeneID:545472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 177 ESTs, 23 Proteins product : similar to BTB (POZ) domain containing 1 transcript_id : XM_619824.4

name	Cst7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892388 GeneID:13011 MGI:1298217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystatin F (leukocystatin) transcript_id : NM_009977.2

name	2310001A20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802875 GeneID:71881 MGI:1919131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310001A20 gene transcript_id : NM_027977.2

name	Acss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18034772 GeneID:68738 MGI:1915988
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase short-chain family member 1 transcript_id : NM_080575.1

name	Vsx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254121 GeneID:114889 MGI:1890816
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : visual system homeobox 1 homolog (zebrafish) transcript_id : NM_054068.2

name	Entpd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802024 GeneID:12497 MGI:1202295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 6 transcript_id : NM_172117.3

name	LOC100043605 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250052 GeneID:100043605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043605 transcript_id : XM_001480518.1

name	Pygb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418918 GeneID:110078 MGI:97828
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain glycogen phosphorylase transcript_id : NM_153781.1

name	Abhd12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130714 GeneID:76192 MGI:1923442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 12 transcript_id : NM_024465.2

name	Gins1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250201 GeneID:69270 MGI:1916520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 53 ESTs, 3 Proteins product : GINS complex subunit 1 (Psf1 homolog), transcript variant 1 transcript_id : XM_130416.6

name	4930519N13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402161 GeneID:78177 MGI:1925427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930519N13 gene transcript_id : NM_207204.1

name	Nanp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385585 GeneID:67311 MGI:1914561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylneuraminic acid phosphatase transcript_id : NM_026086.1

name	LOC433486 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367310 GeneID:433486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 39 Proteins product : serine/threonine kinase transcript_id : XM_485079.3

name	LOC381390 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250203 GeneID:381390
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 38 Proteins product : hypothetical LOC381390 transcript_id : XM_355352.4

name	4930442J19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250204 GeneID:74660 MGI:1921910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA 4930442J19 gene transcript_id : XM_001481096.1

name	LOC100043839 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250206 GeneID:100043839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 140 ESTs, 5 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase transcript_id : XM_001481097.1

name	4921509C19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130885 GeneID:381393 MGI:2685851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921509C19 gene transcript_id : NM_198655.2

name	Nsfl1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130836 GeneID:386649 MGI:3042273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NSFL1 (p97) cofactor (p47) transcript_id : NM_198326.2

name	Fkbp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94158952 GeneID:14225 MGI:95541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 1a transcript_id : NM_008019.2

name	Sdcbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704053 GeneID:228765 MGI:2385156
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syndecan binding protein (syntenin) 2 transcript_id : NM_145535.1

name	Snph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130824 GeneID:241727 MGI:2139270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaphilin transcript_id : NM_198214.2

name	LOC668929 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250058 GeneID:668929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to syntaphilin transcript_id : XM_001004826.2

name	BC052486 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367316 GeneID:228767 MGI:3039588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs product : cDNA sequence BC052486 transcript_id : XM_619827.3

name	5430405G05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367317 GeneID:108832 MGI:1918629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 3 Proteins product : RIKEN cDNA 5430405G05 gene transcript_id : XM_130642.6

name	Psmf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74136560 GeneID:228769 MGI:1346072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) inhibitor subunit 1 transcript_id : NM_144889.2

name	Psmf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47078286 GeneID:228769 MGI:1346072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) inhibitor subunit 1 transcript_id : NM_212446.1

name	Rspo4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100817772 GeneID:228770 MGI:1924467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : R-spondin family, member 4 transcript_id : NM_001040689.1

name	Angpt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753005 GeneID:11602 MGI:1336887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiopoietin 4 transcript_id : NM_009641.1

name	5430432M24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165379 GeneID:73847 MGI:1921097
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430432M24 gene transcript_id : NM_146127.1

name	5430432M24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28077016 GeneID:73847 MGI:1921097
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430432M24 gene transcript_id : NM_028666.1

name	2310046K01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350464 GeneID:69698 MGI:1916948
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310046K01 gene transcript_id : NM_027172.2

name	Scrt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250060 GeneID:545474 MGI:2139287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein product : scratch homolog 2, zinc finger protein (Drosophila) transcript_id : XM_619828.4

name	Srxn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802557 GeneID:76650 MGI:104971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfiredoxin 1 homolog (S. cerevisiae) transcript_id : NM_029688.3

name	Tcf15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185897 GeneID:21407 MGI:104664
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 15 transcript_id : NM_009328.2

name	Csnk2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542426 GeneID:12995 MGI:88543
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein kinase 2, alpha 1 polypeptide transcript_id : NM_007788.2

name	Tbc1d20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378176 GeneID:67231 MGI:1914481
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 20 transcript_id : NM_024196.2

name	Rbck1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046238 GeneID:24105 MGI:1344372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RanBP-type and C3HC4-type zinc finger containing 1 transcript_id : NM_019705.3

name	Rbck1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046256 GeneID:24105 MGI:1344372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RanBP-type and C3HC4-type zinc finger containing 1 transcript_id : NM_001083921.1

name	3300002I08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229083 GeneID:69277 MGI:1916527
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69277 protein_id : NP_081293.2

name	OTTMUSG00000015730 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250199 GeneID:668923 MGI:3651999
definition	codon_start : 1 product : similar to Predicted gene, OTTMUSG00000015730 protein_id : XP_001481140.1

name	OTTMUSG00000015743 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77861899 GeneID:545471 MGI:3652219
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC545471 protein_id : NP_001030072.1

name	LOC545472 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63492503 GeneID:545472
definition	codon_start : 1 product : similar to BTB (POZ) domain containing 1 protein_id : XP_619824.1

name	Cst7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753544 CCDS:CCDS16857.1 GeneID:13011 MGI:1298217
definition	GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : cystatin 7; Leukocystatin; cystatin-like metastasis-associated protein product : cystatin F (leukocystatin) protein_id : NP_034107.1

name	2310001A20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313668 CCDS:CCDS16858.1 GeneID:71881 MGI:1919131
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016844 - strictosidine synthase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : RIKEN cDNA 2310001A20 protein_id : NP_082253.1

name	Acss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18034773 CCDS:CCDS16859.1 GeneID:68738 MGI:1915988
definition	GO_component : GO:0005759 - mitochondrial matrix [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003987 - acetate-CoA ligase activity [Evidence IDA]; GO:0016208 - AMP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0006085 - acetyl-CoA biosynthesis [Evidence IDA] codon_start : 1 note : acetyl-Coenzyme A synthetase 2 (AMP forming)-like product : acetyl-CoA synthetase 2-like protein_id : NP_542142.1

name	Vsx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905095 CCDS:CCDS16860.1 GeneID:114889 MGI:1890816
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 product : visual system homeobox 1 homolog protein_id : NP_473409.1

name	Entpd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921570 CCDS:CCDS16861.1 GeneID:12497 MGI:1202295
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 note : CD39 antigen-like 2 product : ectonucleoside triphosphate diphosphohydrolase 6 protein_id : NP_742115.2

name	LOC100043605 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250053 GeneID:100043605
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480568.1

name	Pygb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418919 CCDS:CCDS16862.1 GeneID:110078 MGI:97828
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004645 - phosphorylase activity [Evidence IEA]; GO:0030170 - pyridoxal phosphate binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 product : brain glycogen phosphorylase protein_id : NP_722476.1

name	Abhd12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277372 GeneID:76192 MGI:1923442
definition	codon_start : 1 product : abhydrolase domain containing 12 protein_id : NP_077785.1

name	Gins1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28487734 GeneID:69270 MGI:1916520
definition	codon_start : 1 product : GINS complex subunit 1 (Psf1 homolog) isoform 1 protein_id : XP_130416.2

name	4930519N13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402162 GeneID:78177 MGI:1925427
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC78177 protein_id : NP_997087.1

name	Nanp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385586 CCDS:CCDS16864.1 GeneID:67311 MGI:1914561
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0050124 - N-acylneuraminate-9-phosphatase activity [Evidence IEA] [Evidence ISS]; GO:0008967 - phosphoglycolate phosphatase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0046380 - N-acetylneuraminate biosynthesis [Evidence ISS] codon_start : 1 product : haloacid dehalogenase-like hydrolase domain containing 4 protein_id : NP_080362.1

name	LOC433486 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51706423 GeneID:433486
definition	codon_start : 1 product : hypothetical protein protein_id : XP_485079.1

name	LOC381390 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:38075170 GeneID:381390
definition	codon_start : 1 product : hypothetical protein protein_id : XP_355352.1

name	4930442J19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250205 GeneID:74660 MGI:1921910
definition	codon_start : 1 product : hypothetical protein LOC74660 protein_id : XP_001481146.1

name	LOC100043839 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250207 GeneID:100043839
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481147.1

name	4921509C19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348544 GeneID:381393 MGI:2685851
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : novel protein tyrosine kinase (4921509C19Rik) product : hypothetical protein LOC381393 protein_id : NP_941057.1

name	Nsfl1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38198665 CCDS:CCDS16868.1 GeneID:386649 MGI:3042273
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : p47 protein protein_id : NP_938085.1

name	Fkbp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679803 CCDS:CCDS16869.1 GeneID:14225 MGI:95541
definition	GO_function : GO:0005528 - FK506 binding [Evidence ISS]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : FK506 binding protein 1a (12 kDa); FK506 Binding Protein12-T1; FK506 binding protein12-T2 product : FK506 binding protein 1a protein_id : NP_032045.1

name	Sdcbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704054 CCDS:CCDS16870.1 GeneID:228765 MGI:2385156
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008022 - protein C-terminus binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0046907 - intracellular transport [Evidence ISS]; GO:0007399 - nervous system development [Evidence ISS] codon_start : 1 product : syndecan binding protein (syntenin) 2 protein_id : NP_663510.1

name	Snph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016174 CCDS:CCDS16871.1 GeneID:241727 MGI:2139270
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0045806 - negative regulation of endocytosis [Evidence ISS]; GO:0006906 - vesicle fusion [Evidence ISS] codon_start : 1 product : syntaphilin protein_id : NP_937857.1

name	LOC668929 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250059 GeneID:668929
definition	codon_start : 1 product : similar to syntaphilin protein_id : XP_001004826.2

name	BC052486 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63492515 GeneID:228767 MGI:3039588
definition	codon_start : 1 product : hypothetical protein protein_id : XP_619827.1

name	5430405G05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94367318 GeneID:108832 MGI:1918629
definition	codon_start : 1 product : hypothetical protein LOC108832 protein_id : XP_130642.2

name	Psmf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47078287 CCDS:CCDS16872.1 GeneID:228769 MGI:1346072
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : proteasome inhibitor subunit 1 isoform a protein_id : NP_997611.1

name	Psmf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74136561 CCDS:CCDS16873.1 GeneID:228769 MGI:1346072
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : proteasome inhibitor subunit 1 isoform b protein_id : NP_659138.2

name	Rspo4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100817773 GeneID:228770 MGI:1924467
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; R-spondin-like protein product : R-spondin family, member 4 isoform 1 protein_id : NP_001035779.1

name	Angpt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753006 CCDS:CCDS16874.1 GeneID:11602 MGI:1336887
definition	GO_function : GO:0005172 - vascular endothelial growth factor receptor binding [Evidence TAS] GO_process : GO:0007492 - endoderm development [Evidence TAS]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : angiopoietin 3 product : angiopoietin 4 protein_id : NP_033771.1

name	5430432M24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165380 CCDS:CCDS16875.1 GeneID:73847 MGI:1921097
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; novel transcript product : hypothetical protein LOC73847 isoform 2 protein_id : NP_666239.1

name	5430432M24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077017 GeneID:73847 MGI:1921097
definition	codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1; novel transcript product : hypothetical protein LOC73847 isoform 1 protein_id : NP_082942.1

name	2310046K01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312364 CCDS:CCDS16876.1 GeneID:69698 MGI:1916948
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69698 protein_id : NP_081448.1

name	Scrt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250061 GeneID:545474 MGI:2139287
definition	codon_start : 1 product : similar to Transcriptional repressor scratch 2 (Scratch homolog 2 zinc finger protein) protein_id : XP_619828.4

name	Srxn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313268 CCDS:CCDS16877.1 GeneID:76650 MGI:104971
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0016209 - antioxidant activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016667 - oxidoreductase activity, acting on sulfur group of donors [Evidence IDA] GO_process : GO:0006979 - response to oxidative stress [Evidence IDA] codon_start : 1 note : neoplastic progression 3 product : sulfiredoxin 1 homolog protein_id : NP_083964.1

name	Tcf15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185898 CCDS:CCDS16878.1 GeneID:21407 MGI:104664
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : paraxis product : transcription factor 15 protein_id : NP_033354.2

name	Csnk2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542427 CCDS:CCDS16879.1 GeneID:12995 MGI:88543
definition	GO_component : GO:0005956 - protein kinase CK2 complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008013 - beta-catenin binding [Evidence IPI]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0019888 - protein phosphatase regulator activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : casein kinase II, alpha 1 related sequence 4 product : casein kinase II, alpha 1 polypeptide protein_id : NP_031814.2

name	Tbc1d20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789165 CCDS:CCDS16880.1 GeneID:67231 MGI:1914481
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] codon_start : 1 product : TBC1 domain family, member 20 protein_id : NP_077158.1

name	Rbck1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046257 GeneID:24105 MGI:1344372
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ubiquitin conjugating enzyme 7 interacting protein 3; novel zinc finger, C3HC4 type (RING finger) protein product : RanBP-type and C3HC4-type zinc finger containing 1 protein_id : NP_001077390.1

name	Rbck1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046239 GeneID:24105 MGI:1344372
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ubiquitin conjugating enzyme 7 interacting protein 3; novel zinc finger, C3HC4 type (RING finger) protein product : RanBP-type and C3HC4-type zinc finger containing 1 protein_id : NP_062679.2

name	LOC668925 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668925
definition	number : 1 pseudo : _no_value

name	LOC100043832 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250197 GeneID:100043832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 30 ESTs, 34 Proteins product : similar to protein phosphatase 1, catalytic subunit, gamma isoform pseudo : _no_value transcript_id : XR_034989.1

name	LOC668924 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250200 GeneID:668924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 3 Proteins product : similar to RIKEN cDNA 1110005A03 gene pseudo : _no_value transcript_id : XR_034990.1

name	LOC668926 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250202 GeneID:668926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins product : similar to 60S ribosomal protein L7a (Surfeit locus protein 3) pseudo : _no_value transcript_id : XR_034992.1

name	LOC100043840 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250208 GeneID:100043840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 53 mRNAs, 2805 ESTs, 35 Proteins product : similar to alpha-tubulin isotype M-alpha-2 pseudo : _no_value transcript_id : XR_034993.1

name	LOC100043843 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250209 GeneID:100043843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 665 ESTs, 7 Proteins product : similar to hCG1994130 pseudo : _no_value transcript_id : XR_034998.1

clone name	MSMg01-539F24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-342L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352J23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-420N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408H09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533K23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339N08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-098O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-501F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389F06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216H18
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-044D01.b	B6Ng01-044D01.g
ACC	DH870016	DH870017
length	1,230	1,066
definition	DH870016\|Mus musculus domesticus DNA, BAC clone: B6Ng01-044D01, 5' end.	DH870017\|Mus musculus domesticus DNA, BAC clone: B6Ng01-044D01, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaaggcccatacctaaacatgataaaagcaatctacagcaaacca gtagccaacatcaaagtaaatggagagaagctggaagcaatcccactaaa atcagggactagacaaggctgcccactttctccctaccttttcaacatag tacttgaagtattagccagagcaattcgacaacaaaaggagatcaagggg atacaaattggaaaggaggaagtcaaaatatcactttttgcagatgatat gatagtatatataagtgaccctaaaaattccaccagagaactcctaaacc tgataaacagcttcggtgaagtagctggatataaaattaactcaaacaag tcaatggcctttctctacacaaagaataaacaggctgagaaagaaattag ggaaacaacacccttctcaatagtcacaaataatataaaatatctcggcg tgactctaactaaggaagtgaaagatctgtatgataaaaacttcaagtct ctgaagaaagaaattaaagaagatctcagaagatggaaagatctcccatg ctcatggattggcaggatcaatattgtaaaaatggctatcttgccaaaag caatctacagattcaatgcaatccccatcaaaattccaactcaattcttc aacgaattagaaggagcaatttgcaaatcatctggaataacaaaaaacct aggatagcaaaaactcttctcaaggataaaagaacctctggtggaatcac catgcctgacctaaagctttactacagagcaattgtggtaaaaactgcat ggtactggtatagagacagacaagtagaccaatggaatagaattgaagac ccagaaatgaacccacacacctatggtcacttgatcttcgacaagggagc taaaaccatccagtggaagaaagacagcattttcaacaaatggtgctggc acaactgggttgttatcatgtagaagaatgcgaatcgatccatacttatc tccttgtactagtcaaatctaaatggatcaagacttcacataaaaccaga gacactgaactataaggagaaagtgggaaaagcgtgaagatatgggcaca ggaaattctgaacaaacgcaatggctggctgtagatcgaatgacatggac tatgaactcagttctgcagcagacgtctagactaagacacccacagatag aagacttacattctaaattcagatggggca	gaattctatgtggacaaacatacagtagtttgtataccttctgcactaaa cagaatccttttgaccaggatggaggaggcacacagctgcctggccttgg ttaagctttctactgtggctgtctgcatccataccaggtttgtcagcctg tggggagcccacctgctcccgtggtattggagagcaacatgacatgggga agggacttcaggtgacattgaaatatgggtaattaatctttgaccatcca ggaaggccatgtgttaaaatgaatctctcgctcattcctcctgagtgacc gtttttccccccatcatcagccctcctttcccattaattcttggcctcca ggcaccattttctattggatagtctcattcaactttctcagaagggatat tctgtgggaattgctttcttagatgacaaatgtgttaagtccgccaaccc taaaatatttatatttgagaaggatatttgaaataatgaagataaaatgt agaaatacatgcaggcactccacctgtttgtttccacaagcatctccact gttttcatggctcactggtaggtgtctctttgtggccataaggcatagtc tgtgaaagcagtttgcaatttgattttcttggtctcttgctttttcagaa atgctctgacacacctttgtgctgtctgatgaattattccttaagtgaat tctgcaggggttttgattgcgtggtcctggctagtaaggcatgcacatag gtccacagatggtggatcctcagagggaagtctgatatgacttcatttct ccatgttgtatgtgatagtgcttttctttcagaagttgtgtaagcctttg tcactcagacatgttcctgagagtcacctaaaggtgaactatacctagag tgaatcccagtatggaagtctactgtgtgctgtggagcaaatggctatct gaagagcaaagtacacatgtgatttcagagacaaccctgagaataaacgt taatcctgaaactaccatatactgaaaagtattggcaattctgggatgtg tagatttggttcagtg
quality values	Open. Hide. 61 43 23 35 53 38 35 37 55 61 50 61 47 35 61 50 55 55 55 41 49 41 38 38 49 61 39 43 38 33 32 22 21 32 27 35 41 49 49 43 59 59 59 59 59 59 61 59 59 59 44 59 59 49 59 59 59 59 59 52 59 59 39 49 52 45 52 43 41 49 43 59 49 61 59 52 43 49 41 36 45 61 61 61 61 59 59 59 49 52 59 59 59 59 59 61 55 59 52 59 59 59 59 49 45 61 61 59 61 61 59 39 52 52 39 52 36 59 44 59 59 52 59 59 59 59 61 59 59 44 44 59 59 59 59 59 59 59 59 61 61 59 59 52 59 59 52 59 59 52 59 61 61 61 59 61 59 59 59 59 59 59 59 59 52 59 59 43 52 61 59 55 59 59 59 59 59 49 59 59 59 59 61 49 59 59 59 59 61 61 61 61 59 59 52 52 52 61 59 61 59 61 61 61 59 59 59 59 59 61 59 61 59 61 59 61 61 59 59 59 59 49 59 52 39 49 52 59 61 59 61 59 52 59 61 59 59 61 59 59 59 44 35 59 59 59 61 61 59 61 59 61 59 59 52 61 59 61 59 59 59 59 61 61 59 61 61 61 61 61 59 59 59 59 59 59 59 61 61 61 61 59 61 61 59 49 61 52 61 61 61 61 61 61 61 59 59 59 59 59 59 59 59 59 52 59 59 59 52 59 61 61 61 61 59 61 52 59 59 59 52 59 59 52 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 59 59 59 52 52 59 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 52 59 59 59 59 59 59 61 59 59 61 61 61 61 61 59 61 61 61 59 61 61 59 59 59 59 49 61 61 61 61 61 61 59 55 55 49 52 55 55 55 61 61 61 61 55 55 61 61 55 52 52 52 55 49 52 55 55 61 61 61 61 55 55 55 55 61 55 61 61 55 55 55 52 55 61 55 61 61 61 61 61 61 55 50 55 55 55 55 61 61 61 61 61 55 61 61 61 61 61 50 61 55 55 55 55 61 55 61 61 61 61 50 55 55 55 55 55 61 55 55 50 55 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 43 61 61 45 61 47 53 53 53 61 61 53 61 47 61 61 61 61 61 53 61 61 61 61 61 53 61 61 53 47 47 50 61 47 53 53 53 61 61 47 61 53 46 61 61 61 61 61 52 53 53 61 53 53 61 61 61 61 61 53 61 61 61 61 61 53 53 43 50 50 47 42 47 43 46 53 57 53 53 53 52 50 57 52 57 53 42 53 57 57 53 43 47 53 53 47 53 53 40 53 57 45 42 50 37 37 53 53 47 38 53 53 53 52 50 42 53 57 53 53 57 53 45 57 53 53 57 50 40 53 53 37 53 53 28 57 53 45 57 45 45 52 57 57 52 53 30 57 38 52 45 45 52 47 52 53 53 52 38 32 45 42 53 16 32 35 34 43 43 43 46 47 53 31 34 45 29 50 39 42 28 53 57 53 41 50 53 45 52 53 50 44 47 24 34 52 53 31 21 19 53 53 53 18 39 37 36 53 44 40 50 52 37 30 50 53 52 31 24 42 20 33 46 30 47 53 37 40 33 53 52 28 38 35 52 44 52 28 33 26 53 53 25 37 33 34 39 18 21 53 25 41 29 30 33 53 44 36 53 44 21 16 57 57 57 30 30 29 47 35 24 37 40 40 9 27 37 30 41 40 32 30 38 30 27 47 29 30 30 27 30 32 27 22 43 27 30 32 32 29 21 29 23 38 29 45 32 29 30 28 29 29 48 29 27 48 29 29 47 13 36 21 36 30 24 28 46 47 30 28 29 33 25 29 37 40 14 29 24 31 21 31 34 29 25 35 38 31 28 34 23 30 24 29 29 27 28 29 28 29 29 22 28 21 19 7 11 32 13 28 28 28 28 29 41 41 14 18 29 14 34 21 32 18 29 23 26 30 28 28 24 34 36 30 18 28 23 29 29 29 20 43 51 51 11 23 34 14 21 20 51 24 27 23 31 23 28 23 13 25 23 10 13 17 8 12 28 31 17 42 12 32 6 23 31 26 14 18 23 17 31 29 16 19 19 39 17 9 28 15 7 16 17 6 33 22 31 21 21 23 30 22 26 10 26 29 33 28 9 25 31 28 23 9 29 7 15 22 20 15 24 16 4 5 5 14 10 30 19 13 28 9 19 36 21 12 22 14 12 29 5 7 13 13 17 9 14 19 11 6 20 14 20 14 30 29 19 14 23 4 5 10 8 18 8 5 23 24 18 8 9 6 6 7 8 5 6 12 6 13 8 23 27 21 7 13 13 18 14 4 26 31 18 6 14 6 16 20 24 9 6 22 5 3 6 10 32 13 5 7 6 4 6 3 4 36 14 3 1 11 13 16 20 19 5 4 19 20 6 10 16 14 12 13 19 13 13 22 3 3 3 5 5 6 27 5 18 4 18 5 4 9 9 6 4 4 10 3 13 12 8 8 5 13 7 12 12 14 3 4 2 4 1 6 9 8 16 12 17 13 18 4 11 3 4 7 5 12 4 4 3 2 3 3 3 1 8 8 8 4 4 20 14 8 5 6 9 6 20 6 4 13 14 9 20 6 4 5 4 1 13 4 12 6 8 4 1 13 5 13 6 9 7 4 15 6 13 20 3 1 1 3	Open. Hide. 61 47 43 38 61 41 25 28 26 19 21 27 25 36 36 28 49 59 59 49 59 49 59 33 37 41 52 36 52 52 52 59 52 45 59 49 59 59 59 59 61 59 61 59 59 61 61 61 59 59 59 43 35 59 59 59 50 43 59 59 59 59 59 59 61 59 59 59 49 59 59 59 59 59 35 55 61 59 61 52 52 59 52 59 45 59 59 61 61 61 61 59 55 59 59 61 61 61 61 61 61 61 59 59 49 59 59 59 44 55 59 59 59 59 61 52 59 59 52 59 59 59 59 59 59 61 59 61 61 61 59 59 59 59 59 59 49 61 61 61 52 59 59 59 43 44 61 61 59 61 59 61 61 44 59 61 61 61 61 61 59 61 61 61 61 61 59 59 59 59 59 61 61 61 59 61 61 59 61 59 61 52 61 59 59 52 59 59 59 61 59 59 61 59 59 61 59 59 61 61 61 59 61 61 61 61 61 59 59 59 50 61 61 61 61 61 59 61 61 59 59 59 59 59 59 59 61 61 61 61 59 59 59 59 59 59 61 61 59 59 59 59 59 59 61 59 61 59 59 59 52 59 61 59 59 61 59 61 59 61 61 59 61 61 59 59 59 59 59 59 59 61 61 61 59 61 61 61 61 59 59 61 61 59 59 59 61 59 59 59 59 59 59 59 59 59 61 61 59 59 61 59 61 61 61 61 61 61 59 59 59 59 52 59 59 49 59 59 49 43 61 61 59 61 59 61 59 61 61 61 61 61 59 61 61 61 61 61 61 59 59 59 61 59 59 61 61 61 61 59 43 59 59 59 59 61 61 61 61 59 59 52 52 52 52 61 61 61 61 59 59 59 59 59 59 59 59 59 59 59 52 59 59 61 59 59 59 61 61 59 52 61 61 59 61 59 61 59 59 59 61 61 59 61 59 61 59 59 61 61 61 59 59 59 59 59 59 59 59 55 52 43 55 55 55 55 52 49 52 52 61 61 52 55 52 52 52 52 52 52 52 52 41 52 55 52 55 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 55 52 61 61 55 55 55 55 55 55 61 61 61 61 55 55 61 61 61 61 50 61 55 55 61 55 61 55 61 55 55 50 61 61 55 61 55 55 50 61 61 61 50 61 61 61 55 61 61 61 61 55 55 61 55 61 47 55 55 55 55 55 55 55 55 49 55 55 55 50 53 43 50 50 50 50 47 50 47 50 61 50 53 53 50 50 43 50 53 52 43 50 47 50 43 53 61 61 47 43 41 47 50 53 53 53 52 61 53 53 61 61 50 61 43 39 61 50 61 53 61 33 61 50 53 50 53 50 50 61 61 61 53 61 61 61 50 33 53 53 50 52 61 61 61 47 52 47 61 61 61 61 42 30 53 50 30 42 61 61 61 61 53 61 50 52 50 47 53 47 61 61 61 53 30 47 53 15 47 38 38 32 47 43 53 45 57 57 53 45 53 38 47 35 53 52 43 50 43 45 45 43 45 40 38 50 45 34 53 23 36 47 47 34 52 42 30 39 53 52 53 43 38 50 38 47 45 53 30 38 45 45 42 26 28 39 42 57 53 39 12 46 50 43 45 40 14 13 47 38 17 23 57 22 17 31 30 32 38 52 30 45 40 36 15 14 13 8 10 14 37 50 45 39 45 50 38 52 32 8 25 32 23 47 14 38 31 27 53 27 26 41 12 47 28 45 17 21 30 26 28 24 15 52 7 32 25 34 45 23 33 40 42 50 37 25 32 34 30 33 36 50 35 29 10 31 53 30 38 36 53 47 19 29 35 12 28 25 22 38 27 50 30 40 39 24 53 35 29 44 21 52 25 37 32 31 22 32 30 30 12 10 16 22 23 21 29 41 26 35 30 48 26 23 29 38 15 37 33 37 13 32 24 25 36 24 24 12 29 19 9 8 19 21 20 18 24 30 37 43 14 37 11 26 12 20 27 35 21 29 28 18 20 27 15 21 26 30 15 30 21 29 31 53 22 18 28 10 29 21 12 30 28 23 21 26 29 11 29 17 24 13 30 32 11 9 43 19 29 23 24 30 27 25 18 8 20 20 20 28 34 34 13 29 18 27 9 17 24 30 32 25 36 29 24 32 13 22 20 9 11 30 10 5 30 19 25 10 7 6 4 7 13 7 7 11 4 22 28 28 25 27 16 14 12 20 5 8 8 5 14 18 6 19 15 6 20 7 13 29 11 25 7 19 8 25 10 7 8 10 46 18 18 28 29 20 20 23 11 12 9 8 26 18 28 22 7 7 7 13 12 11 20 18 12 15 18 19 7 11 20 28 19 29 13 7 9 12 7 11 21 23 27 30 11 28 15 12 8 11 6 5 5 17 19 29 21 13 14 13 21 8 9 5 5 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_151155557_151156619
seq2: B6Ng01-044D01.g_66_1131

seq1  GAATTCTATGTGGACAAACATACAGTAGTTTGTATACCTTCTGCACTAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTATGTGGACAAACATACAGTAGTTTGTATACCTTCTGCACTAAA  50

seq1  CAGAATCCTTTTGACCAGGATGGAGGAGGCACACAGCTGCCTGGCCTTGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAATCCTTTTGACCAGGATGGAGGAGGCACACAGCTGCCTGGCCTTGG  100

seq1  TTAAGCTTTCTACTGTGGCTGTCTGCATCCATACCAGGTTTGTCAGCCTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAGCTTTCTACTGTGGCTGTCTGCATCCATACCAGGTTTGTCAGCCTG  150

seq1  TGGGGAGCCCACCTGCTCCCGTGGTATTGGAGAGCAACATGACATGGGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGAGCCCACCTGCTCCCGTGGTATTGGAGAGCAACATGACATGGGGA  200

seq1  AGGGACTTCAGGTGACATTGAAATATGGGTAATTAATCTTTGACCATCCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGACTTCAGGTGACATTGAAATATGGGTAATTAATCTTTGACCATCCA  250

seq1  GGAAGGCCATGTGTTAAAATGAATCTCTCGCTCATTCCTCCTGAGTGACC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGCCATGTGTTAAAATGAATCTCTCGCTCATTCCTCCTGAGTGACC  300

seq1  GTTTTTCCCCCCATCATCAGCCCTCCTTTCCCATTAATTCTTGGCCTCCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTTCCCCCCATCATCAGCCCTCCTTTCCCATTAATTCTTGGCCTCCA  350

seq1  GGCACCATTTTCTATTGGATAGTCTCATTCAACTTTCTCAGAAGGGATAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCACCATTTTCTATTGGATAGTCTCATTCAACTTTCTCAGAAGGGATAT  400

seq1  TCTGTGGGAATTGCTTTCTTAGATGACAAATGTGTTAAGTCCGCCAACCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTGGGAATTGCTTTCTTAGATGACAAATGTGTTAAGTCCGCCAACCC  450

seq1  TAAAATATTTATATTTGAGAAGGATATTTGAAATAATGAAGATAAAATGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAATATTTATATTTGAGAAGGATATTTGAAATAATGAAGATAAAATGT  500

seq1  AGAAATACATGCAGGCACTCCACCTGTTTGTTTCCACAAGCATCTCCACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAATACATGCAGGCACTCCACCTGTTTGTTTCCACAAGCATCTCCACT  550

seq1  GTTTTCATGGCTCACTGGTAGGTGTCTCTTTGTGGCCATAAGGCATAGTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTCATGGCTCACTGGTAGGTGTCTCTTTGTGGCCATAAGGCATAGTC  600

seq1  TGTGAAAGCAGTTTGCAATTTGATTTTCTTGGTCTCTTGCTTTTTCAGAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGAAAGCAGTTTGCAATTTGATTTTCTTGGTCTCTTGCTTTTTCAGAA  650

seq1  ATGCTCTGACACACCTTTGTGCTGTCTGATGAATTATTCCTTAAGTGAAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTCTGACACACCTTTGTGCTGTCTGATGAATTATTCCTTAAGTGAAT  700

seq1  TCTGCAGGGG-TTTGATTGCGTGGTCCTGGCTAGTAAGGCATGCACATAG  749
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  TCTGCAGGGGTTTTGATTGCGTGGTCCTGGCTAGTAAGGCATGCACATAG  750

seq1  GTCCACAGATGGTGGATCCTCAGAGGGAAGTCTGATATGACTTCATTTCT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCACAGATGGTGGATCCTCAGAGGGAAGTCTGATATGACTTCATTTCT  800

seq1  CCATGTTGTATGTGATAGTGCTTTTCTTTCAGAAGTTGTGTAAGCCTTTG  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGTTGTATGTGATAGTGCTTTTCTTTCAGAAGTTGTGTAAGCCTTTG  850

seq1  TCACTCAGACATGTTCCTGAGAGTCACCTAAAGGTGAACTATACCTAGAG  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTCAGACATGTTCCTGAGAGTCACCTAAAGGTGAACTATACCTAGAG  900

seq1  TGAATCCAAGTATGGAAGTCTACTGTGTGCTGTGGAGCAAATGGCTATCT  949
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATCCCAGTATGGAAGTCTACTGTGTGCTGTGGAGCAAATGGCTATCT  950

seq1  GAAGAGCAGAGTACACCATGTGATTACAGAGACAACCC-GAGAATAAACG  998
      |||||||| |||||| ||||||||| |||||||||||| |||||||||||
seq2  GAAGAGCAAAGTACA-CATGTGATTTCAGAGACAACCCTGAGAATAAACG  999

seq1  TTAATCCTGAGACTACCATATACTGAAGAGTATTGGCAA-TCTGGGATGT  1047
      |||||||||| |||||||||||||||| ||||||||||| ||||||||||
seq2  TTAATCCTGAAACTACCATATACTGAAAAGTATTGGCAATTCTGGGATGT  1049

seq1  GT-GATTTGGTTCAGTG  1063
      || ||||||||||||||
seq2  GTAGATTTGGTTCAGTG  1066

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information