MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-064F10
Chromosome	2 (Build37)
Map Location	175,723,829 - 175,724,471
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC545487, LOC100043760, LOC100043761, LOC620790, LOC665001, LOC100043762, LOC100043763, LOC100043764, LOC100043914, LOC100043915, LOC668009, LOC100038953, LOC620804, LOC100039000, LOC100043126
Downstream gene	LOC100039017, LOC100039036, LOC100039049, LOC626832, OTTMUSG00000016203, LOC100039060, LOC668030, LOC627914, LOC100039093, LOC668039, LOC100039109, LOC100043381, LOC100043387, LOC100039123, LOC626877, LOC100039156
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC545487 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 315 ESTs, 7 Proteins

name	LOC100043760 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100043761 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 3 Proteins pseudo : _no_value

name	LOC620790 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC665001 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 65 ESTs, 4 Proteins

name	LOC100043762 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043763 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 1341 ESTs, 7 Proteins

name	LOC100043764 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	LOC100043914 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs

name	LOC100043915 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 1 Protein

name	LOC668009 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668009
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 36 ESTs

name	LOC100038953 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 1 Protein pseudo : _no_value

name	LOC620804 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 ESTs, 2 Proteins

name	LOC100043126 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs

name	LOC100039017 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	LOC100039036 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 1339 ESTs, 7 Proteins

name	LOC100039049 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039049
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC626832 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 71 ESTs

name	OTTMUSG00000016203 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667962 MGI:3709288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs

name	LOC100039060 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	LOC668030 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins

name	LOC627914 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 3 Proteins

name	LOC100039093 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 ESTs, 3 Proteins pseudo : _no_value

name	LOC668039 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 3 Proteins

name	LOC100039109 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043381 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 1 Protein

name	LOC100043387 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 1 Protein

name	LOC100039123 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 2 Proteins

name	LOC626877 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 1 Protein

name	LOC100039156 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC545487 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367661 GeneID:545487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 315 ESTs, 7 Proteins product : similar to ribosomal protein L27a-like transcript_id : XM_619852.3

name	LOC100043760 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250146 GeneID:100043760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to M03D4.4b transcript_id : XM_001480905.1

name	LOC620790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250149 GeneID:620790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001480909.1

name	LOC665001 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250272 GeneID:665001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 65 ESTs, 3 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 1 transcript_id : XM_973954.2

name	LOC100043763 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250153 GeneID:100043763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 1341 ESTs, 7 Proteins product : similar to ribosomal protein S8 transcript_id : XM_001480910.1

name	LOC100043764 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250155 GeneID:100043764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001480913.1

name	LOC100043914 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250274 GeneID:100043914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001481228.1

name	LOC100043915 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250276 GeneID:100043915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 1 Protein product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 1 transcript_id : XM_001481229.1

name	LOC100043915 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250278 GeneID:100043915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 50 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 2 transcript_id : XM_001481230.1

name	LOC668009 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367710 GeneID:668009
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 36 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001004283.1

name	LOC100039000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250457 GeneID:100039000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 ESTs, 2 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001472066.1

name	LOC100043126 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250465 GeneID:100043126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001480068.1

name	LOC100039017 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250459 GeneID:100039017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001472096.1

name	LOC100039036 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250461 GeneID:100039036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 1339 ESTs, 7 Proteins product : similar to ribosomal protein S8 transcript_id : XM_001472131.1

name	LOC626832 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250467 GeneID:626832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 71 ESTs product : similar to gonadotropin inducible ovarian transcription factor 1, transcript variant 3 transcript_id : XM_001004273.2

name	OTTMUSG00000016203 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367700 GeneID:667962 MGI:3709288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs product : predicted gene, OTTMUSG00000016203 transcript_id : XM_001004267.1

name	LOC100039060 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250463 GeneID:100039060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001472180.1

name	LOC668030 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250469 GeneID:668030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : similar to gonadotropin inducible ovarian transcription factor 1 transcript_id : XM_001487779.1

name	LOC627914 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250479 GeneID:627914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 3 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 6 transcript_id : XM_902680.3

name	LOC668039 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250481 GeneID:668039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 3 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 10 transcript_id : XM_902710.3

name	LOC100039109 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250472 GeneID:100039109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001472282.1

name	LOC100043381 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250483 GeneID:100043381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 1 Protein product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 1 transcript_id : XM_001480586.1

name	LOC100043381 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250485 GeneID:100043381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 50 ESTs, 1 Protein product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 2 transcript_id : XM_001480589.1

name	LOC100043387 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250487 GeneID:100043387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 61 ESTs, 1 Protein product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 1 transcript_id : XM_001480593.1

name	LOC100043387 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250489 GeneID:100043387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 59 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 2 transcript_id : XM_001480597.1

name	LOC100039123 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250474 GeneID:100039123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 2 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001472314.1

name	LOC545487 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82887979 GeneID:545487
definition	codon_start : 1 product : similar to ribosomal protein L27a-like protein_id : XP_619852.2

name	LOC100043760 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250147 GeneID:100043760
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480955.1

name	LOC620790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250150 GeneID:620790
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001480959.1

name	LOC665001 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250273 GeneID:665001
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 1 protein_id : XP_979048.2

name	LOC100043763 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250154 GeneID:100043763
definition	codon_start : 1 product : similar to ribosomal protein S8 protein_id : XP_001480960.1

name	LOC100043764 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250156 GeneID:100043764
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001480963.1

name	LOC100043914 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250275 GeneID:100043914
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001481278.1

name	LOC100043915 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250277 GeneID:100043915
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 1 protein_id : XP_001481279.1

name	LOC100043915 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250279 GeneID:100043915
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 2 protein_id : XP_001481280.1

name	LOC668009 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367711 GeneID:668009
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001004283.1

name	LOC100039000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250458 GeneID:100039000
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001472116.1

name	LOC100043126 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250466 GeneID:100043126
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001480118.1

name	LOC100039017 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250460 GeneID:100039017
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001472146.1

name	LOC100039036 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250462 GeneID:100039036
definition	codon_start : 1 product : similar to ribosomal protein S8 protein_id : XP_001472181.1

name	LOC626832 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367703 GeneID:626832
definition	codon_start : 1 product : similar to LOC329575 protein isoform 3 protein_id : XP_001004273.1

name	OTTMUSG00000016203 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94367701 GeneID:667962 MGI:3709288
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001004267.1

name	LOC100039060 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250464 GeneID:100039060
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001472230.1

name	LOC668030 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250470 GeneID:668030
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001487829.1

name	LOC627914 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250480 GeneID:627914
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 6 protein_id : XP_907773.3

name	LOC668039 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250482 GeneID:668039
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 10 protein_id : XP_907803.2

name	LOC100039109 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250473 GeneID:100039109
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001472332.1

name	LOC100043381 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250484 GeneID:100043381
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 1 protein_id : XP_001480636.1

name	LOC100043381 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250486 GeneID:100043381
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 2 protein_id : XP_001480639.1

name	LOC100043387 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250488 GeneID:100043387
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 1 protein_id : XP_001480643.1

name	LOC100043387 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250490 GeneID:100043387
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 2 protein_id : XP_001480647.1

name	LOC100039123 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250475 GeneID:100039123
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001472364.1

name	LOC100043762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043762
definition	number : 5 pseudo : _no_value

name	LOC100043762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043762
definition	number : 4 pseudo : _no_value

name	LOC100043762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043762
definition	number : 3 pseudo : _no_value

name	LOC100043762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043762
definition	number : 2 pseudo : _no_value

name	LOC100043762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043762
definition	number : 1 pseudo : _no_value

name	LOC620804 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620804
definition	number : 3 pseudo : _no_value

name	LOC620804 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620804
definition	number : 2 pseudo : _no_value

name	LOC620804 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620804
definition	number : 1 pseudo : _no_value

name	LOC100039049 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039049
definition	number : 1 pseudo : _no_value

name	LOC100039049 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039049
definition	number : 2 pseudo : _no_value

name	LOC100039049 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039049
definition	number : 3 pseudo : _no_value

name	LOC100039049 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039049
definition	number : 4 pseudo : _no_value

name	LOC100039049 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039049
definition	number : 5 pseudo : _no_value

name	LOC100039049 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039049
definition	number : 6 pseudo : _no_value

name	LOC100039049 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039049
definition	number : 7 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 7 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 6 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 5 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 4 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 3 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 2 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 1 pseudo : _no_value

name	LOC100043761 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250148 GeneID:100043761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 3 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein pseudo : _no_value transcript_id : XR_034901.1

name	LOC100038953 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250456 GeneID:100038953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 1 Protein product : similar to zinc finger protein 586 pseudo : _no_value transcript_id : XR_030511.1

name	LOC100039093 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250471 GeneID:100039093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 ESTs, 3 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein pseudo : _no_value transcript_id : XR_030632.1

name	LOC626877 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250476 GeneID:626877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 1 Protein product : similar to zinc finger protein 709 transcript_id : XR_030668.1

clone name	MSMg01-461G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495B08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518C07
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-235N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300N16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-064F10.b	B6Ng01-064F10.g
ACC	DH884157	DH884158
length	1,257	658
definition	DH884157\|Mus musculus domesticus DNA, BAC clone: B6Ng01-064F10, 5' end.	DH884158\|Mus musculus domesticus DNA, BAC clone: B6Ng01-064F10, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcttttaaaaattggcttcattcaaaagagcaatctaatgttaatg taatatgcctttgtttgcattcaaaggtgttctcctcgttatggattgtt ttacatctttgaggatacatgaaatgggaacagtattgattatctggctc acatttatagcatactttttgtataaaaggttattcacatatttaaaaaa aacaggaagaactcaaagtctttgcacactgattgcattcacaaattctg ttatcatgagagtaatactacatttggaacatgaacaaatgcaaacagaa tataatttctactaccctaattctaattatgattttcagcagtttcagtt ggaaaatgtccccaataatgttgggaaactaagtacttataaacttacag cacatttagaatgtcactcaaagtatgttatactgcatatcctcttgttg ttctgaaaaagtgaaaggtatgtggcatctttcaatacccctatgctcac aagggctgtatccatagtaacgtatgacaaccatattaaaagagaataac aagtgtaaaggttccatattacattcacacacgtgacttttttcctcata gagatgtagtatagcgattaaggtttttccaccaaaccatttttgaatct tatgaactgtccatctcactaaatttagcaatgatattacaagtatatca ttgagctcagatatactatggattatttgcttattactaggttttagaca tatacttgtcacctaatcactgtgtgttccttttgcaatagctaagcgat atgagactgaagacactcgcacttgtacagcatggctctactaggcttga tttaaacagtaacatacctgttaagccattatttctctgtctttgaacta atagaaagtcttgcaaacaataattacatatctgccatagacatatatga ttttatgaaattcataaacatccataactgaaagcagtgctattgtaccc tatggtttctttactacttgtagcacacgtaaactttctcataggcattt tctctcagcttgcaaggaaaattactttccatgacttctagaggtttgaa tggtcttcaattgtatgtttcttcccaactgtacttaacacgtaccctag agtatgttacgttatggccatagcactttagttctattcctgactacctg acgatatttaccgattctcctctttcattagatccaaccataacaatatc agcaagg	gaattcatgaggtgctgagaagaagttatattgcattgtgtttgggtgga acatcctatagatgtttgttaagtctatttgattcatagtgtctgttagt ttcattatctctctgtttagttcttgcatgttcacatgcatgtagggatc aaggctgggtgccttcttcattcagaccccaccttctgtattcagccagt tctctctctgaacctgagtagactagcttgcaggcaagccctgaggttgc tcctgtctctgcctcaccagtgctgggattacagcaagtgctaccactct cagattttatgtgagtacttgggatctgaacttgggtccctgtgttgatg cttgtgaaagaaccacaacgtgaggactcccccacgttctgactcaggag aggtgacaccccaaatcactcatgagtaaaggtcttactgcaaactgcaa gaggacttttattatcaagagtgctctcgggctcacggtcataaaccaca caggggtagagaaccgtggctccccgagtatctgggtaagggggtattta aaggaagaaaccacaactcaaaggggtggggagaaaaacaccaaaatacc agttaagaattacaaggaagtggaaagtcaagacagttacaatgaacctt ctagcaat
quality values	Open. Hide. 61 47 36 37 61 61 61 61 61 47 50 61 61 61 50 61 49 61 47 55 61 61 49 31 61 61 11 11 16 15 11 10 18 10 12 12 35 26 44 59 59 59 61 59 61 61 61 61 59 59 61 59 61 61 61 59 59 61 59 55 59 61 61 61 61 61 59 61 61 61 36 43 27 26 28 28 35 37 59 55 44 55 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 52 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 53 61 61 57 52 57 53 50 57 57 57 57 57 57 46 36 57 57 53 45 52 53 57 53 53 53 53 53 57 57 53 53 53 57 53 57 57 57 57 53 50 57 57 57 57 53 53 53 53 53 53 39 50 53 52 57 50 47 30 53 45 53 50 53 53 50 52 47 53 57 52 36 37 52 52 26 41 12 53 57 45 50 47 39 30 47 57 39 52 50 45 47 32 53 57 57 57 57 47 53 57 38 53 38 41 53 33 52 45 57 42 53 57 41 52 43 21 53 52 52 43 39 52 52 39 57 47 42 57 39 38 32 53 50 39 50 53 42 42 42 37 33 31 52 27 33 40 52 43 42 50 42 42 35 53 52 53 53 42 53 53 50 36 33 52 32 36 40 35 41 33 43 40 53 35 37 24 41 26 16 57 39 37 40 36 40 36 22 25 30 35 35 40 40 37 13 57 57 41 52 24 48 33 22 48 33 48 37 41 29 32 40 36 37 28 35 57 37 32 39 29 36 30 36 34 44 27 47 28 53 27 30 34 53 30 57 57 47 39 33 33 27 29 39 28 30 34 29 33 13 38 28 31 14 28 30 34 48 28 39 28 30 31 32 39 28 32 16 20 30 38 29 28 33 31 31 28 28 29 28 24 29 28 27 24 29 33 29 46 28 35 36 34 28 29 28 28 25 48 28 29 33 29 25 14 51 38 27 43 33 30 25 27 28 43 28 27 14 35 28 26 34 27 32 24 19 23 30 30 36 17 12 10 24 12 16 41 29 33 29 32 28 29 22 35 33 51 32 29 39 28 28 29 28 25 29 33 24 31 51 27 14 16 28 16 28 35 24 23 36 18 23 24 28 29 34 28 11 36 24 30 14 31 33 29 28 28 30 19 29 14 18 23 19 33 28 23 33 23 12 14 21 17 28 27 51 51 22 29 16 18 27 51 31 18 31 28 36 17 16 51 20 30 17 22 18 22 22 30 9 23 25 34 29 25 51 28 13 25 23 23 22 36 20 38 16 16 18 29 14 17 19 32 26 21 14 28 16 25 16 44 26 26 20 42 27 15 34 31 28 27 9 21 34 22 33 19 25 7 10 15 22 13 30 10 35 19 26 38 38 8 6 16 9 17 16 26 16 31 22 14 25 37 33 12 6 8 6 3 13 16 20 23 23 12 23 10 3 4 7 7 27 36 36 9 17 29 22 16 12 37 15 15 20 18 18 14 11 5 15 13 11 10 7 6 25 7 6 12 25 5 9 3 20 11 15 19 8 23 14 13 10 13 7 7 5 3 3 7 6 10 5 15 9 6 9 16 10 27 25 6 9 11 14 11 4 4 4 5 4 15 4 5 5 7 23 5 6 23 25 2 2 4 1 4 1 4 4 9 11 4 18 6 22 3 7 5 4 9 3 13 4 5 17 27 7 18 6 9 3 3 22 8 8 3 3 3 7 5 7 1 1 4 3 3 3 14 6 4 4 2 8 4 4 5 5 5 3 6 6 18 22 4 5 9 17 5 5 5 8 7 13 7 14 5 18 3 6 6 5 7 13 5 21 3 6 12 8 6 10 13 5 5 4 1 7 21 6 8 10 3 3 2 3 23 6 4 12 2 2 2	Open. Hide. 55 61 38 49 61 49 17 13 11 13 10 12 16 20 12 32 41 59 36 61 61 59 61 61 38 59 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 43 43 45 24 28 28 26 35 43 45 55 52 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 59 59 59 52 59 59 61 59 49 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 47 52 55 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 55 55 52 61 61 55 61 50 61 61 61 61 61 61 55 61 61 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 53 61 61 61 61 61 61 61 47 47 61 53 61 53 53 61 53 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 52 61 53 61 61 53 53 61 61 53 61 61 61 61 53 61 61 57 57 57 57 53 47 57 57 57 57 53 57 57 57 57 57 46 47 57 57 57 52 57 53 53 53 53 53 52 52 52 57 57 53 57 53 53 47 27 42 29 47 47 41 41 50 53 50 53 57 50 41 37 41 38 53 39 50 53 52 57 57 53 50 35 43 33 47 42 53 53 53 53 53 53 53 35 18 57 34 32 43 23 52 53 53 31 39 38 53 57 34 33 18 41 53 53 53 36 52 50 50 42 53 57 57 31 40 29 57 46 37 53 26 48 29 53 35 43 37 53 36 47 57 44 37 40 53 33 37 37 32 46 21 41 40 27 33 57 57 33 36 32 33 33 36 40 21 53 34 46 35 27 39 27 39 48 31 37 18 46 45 30 34 34 29 48 30 46 24 48 31 39 22 51 29 33 48 28 47 32 38 18 8 39 46 29 29 30 28 45 29 30 29 27 48 33 31 29 30 17 30 31 51 51 46 20 30 18 28 30 28 29 26 29 51 43 29 31 33 28 51 51 51 43 26 26 22 51 43 26 46 33 26 36 23 31 17 33 51 29 31 43 26 26 12 33 41 31 28 17 41 25 26 46 46 35 34 43 51 51 33 29 15 18 36 38 51 26 28 12 24 23 33 38 36 22 12 9 34 31 28 29 25 19 13 20 12 9 17 9 21 17 21 11 14 33 22 20 29 31 22 15 28 14 33 28 23 26 21 23 15 17 33 23 14 28 14 29 19 31 9 28 27 34 21 17 38 12 6 6 6 11 19 25 31 33 19 29

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_175723829_175724471
seq2: B6Ng01-064F10.g_69_710

seq1  GAATTCATGAGGTGCTGAGAAGAAGTTATATTGCATTGTGTTTGGGTGGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATGAGGTGCTGAGAAGAAGTTATATTGCATTGTGTTTGGGTGGA  50

seq1  ACATCCTATAGATGTTTGTTAAGTCTATTTGATTCATAGTGTCTGTTAGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCCTATAGATGTTTGTTAAGTCTATTTGATTCATAGTGTCTGTTAGT  100

seq1  TTCATTATCTCTCTGTTTAGTTCTTGCATGTTCACATGCATGTAGGGATC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATTATCTCTCTGTTTAGTTCTTGCATGTTCACATGCATGTAGGGATC  150

seq1  AAGGCTGGGTGCCTTCTTCATTCAGACCCCACCTTCTGTATTCAGCCAGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCTGGGTGCCTTCTTCATTCAGACCCCACCTTCTGTATTCAGCCAGT  200

seq1  TCTCTCTCTGAACCTGAGTAGACTAGCTTGCAGGCAAGCCCTGAGGTTGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCTCTGAACCTGAGTAGACTAGCTTGCAGGCAAGCCCTGAGGTTGC  250

seq1  TCCTGTCTCTGCCTCACCAGTGCTGGGATTACAGCAAGTGCTACCACTCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGTCTCTGCCTCACCAGTGCTGGGATTACAGCAAGTGCTACCACTCT  300

seq1  CAGATTTTATGTGAGTACTTGGGATCTGAACTTGGGTCCCTGTGTTGATG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGATTTTATGTGAGTACTTGGGATCTGAACTTGGGTCCCTGTGTTGATG  350

seq1  CTTGTGAAAGAACCACAACGTGAGGACTCCCCCACGTTCTGACTCAGGAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTGAAAGAACCACAACGTGAGGACTCCCCCACGTTCTGACTCAGGAG  400

seq1  AGGTGACACCCCAAATCACTCATGAGTAAAGGTCTTACTGCAAACTGCAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGACACCCCAAATCACTCATGAGTAAAGGTCTTACTGCAAACTGCAA  450

seq1  GAGGACTTTTATTATCAAGAGTGCTCTCGGGCTCACGGTCATAAACCACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGACTTTTATTATCAAGAGTGCTCTCGGGCTCACGGTCATAAACCACA  500

seq1  CAGGGGTAGAGAACCGTGGCTCCCCGAGTATCTGGGTAAGGGGGTATTTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGGTAGAGAACCGTGGCTCCCCGAGTATCTGGGTAAGGGGGTATTTA  550

seq1  AAGGAAGAAACCACAACTCAAAGGGGTGGGGAGAAAAACACCAAAAATAC  600
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  AAGGAAGAAACCACAACTCAAAGGGGTGGGGAGAAAAACACC-AAAATAC  599

seq1  CAGTTAAGAATTACAAGGAAGTGGAAAGTCAAGACAGTTACAA  643
      |||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTTAAGAATTACAAGGAAGTGGAAAGTCAAGACAGTTACAA  642

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information