MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-097A09
Chromosome	2 (Build37)
Map Location	84,113,722 - 84,115,010
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC545429, Ppia-ps2_981.1, LOC100040818, LOC668077, Zc3h15, Itgav, Dnmt3l-ps1, D430039N05Rik, Zswim2, LOC668096, LOC668100, LOC545432, LOC668107, LOC668113, LOC668115, LOC668119, LOC383725
Downstream gene	Calcrl, Tfpi, LOC672763, Ctnnd1, 2700094K13Rik, Txndc14, Med19, Zdhhc5, Clp1, Ypel4, Serping1, Ube2l6, Smtnl1, Timm10, Slc43a1, Rtn4rl2, Slc43a3, Prg2, Prg3, P2rx3, Ssrp1, Tnks1bp1, Agtrl1, LOC625033, Lrrc55
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC545429 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 599 ESTs, 9 Proteins pseudo : _no_value

name	Ppia-ps2_981.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606538
definition	note : peptidylprolyl isomerase A pseudogene 2_981.1 pseudo : _no_value

name	LOC100040818 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040818
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC668077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Zc3h15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69082 MGI:1919747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgav (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16410 MGI:96608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnmt3l-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:445264 MGI:2674156
definition	note : DNA methyltransferase 3-like, pseudogene 1 pseudo : _no_value

name	D430039N05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241520 MGI:2444579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zswim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71861 MGI:1919111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668096 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 97 ESTs, 4 Proteins pseudo : _no_value

name	LOC668100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 ESTs, 4 Proteins pseudo : _no_value

name	LOC545432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 ESTs, 4 Proteins

name	LOC668107 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 ESTs, 4 Proteins pseudo : _no_value

name	LOC668113 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 4 Proteins pseudo : _no_value

name	LOC668115 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 4 Proteins pseudo : _no_value

name	LOC668119 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 96 ESTs, 4 Proteins pseudo : _no_value

name	LOC383725 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383725
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Calcrl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54598 MGI:1926944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tfpi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21788 MGI:1095418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672763 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Ctnnd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12388 MGI:105100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700094K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72657 MGI:1919907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Txndc14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66958 MGI:1914208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381379 MGI:1914234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228136 MGI:1923573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98985 MGI:2138968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ypel4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241525 MGI:3605071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serping1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12258 MGI:894696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2l6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56791 MGI:1914500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smtnl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68678 MGI:1915928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30059 MGI:1353429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc43a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72401 MGI:1931352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Rtn4rl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269295 MGI:2669796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc43a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58207 MGI:1931054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19074 MGI:103294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53856 MGI:1858200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228139 MGI:1097160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20833 MGI:107912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnks1bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228140 MGI:2446193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agtrl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23796 MGI:1346086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625033 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Lrrc55 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241528 MGI:2685197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3h15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130305 GeneID:69082 MGI:1919747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH-type containing 15 transcript_id : NM_026934.3

name	Itgav (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680485 GeneID:16410 MGI:96608
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha V transcript_id : NM_008402.1

name	D430039N05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803219 GeneID:241520 MGI:2444579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D430039N05 gene transcript_id : NM_175514.2

name	Zswim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803525 GeneID:71861 MGI:1919111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, SWIM domain containing 2 transcript_id : NM_027964.2

name	Calcrl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055257 GeneID:54598 MGI:1926944
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcitonin receptor-like transcript_id : NM_018782.1

name	Tfpi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859643 GeneID:21788 MGI:1095418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tissue factor pathway inhibitor transcript_id : NM_011576.1

name	LOC672763 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249856 GeneID:672763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical LOC672763 transcript_id : XM_001475504.1

name	Ctnnd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131110 GeneID:12388 MGI:105100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catenin (cadherin associated protein), delta 1 transcript_id : NM_007615.3

name	2700094K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82546882 GeneID:72657 MGI:1919907
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700094K13 gene transcript_id : NM_001037279.1

name	2700094K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82546880 GeneID:72657 MGI:1919907
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700094K13 gene transcript_id : NM_001033166.2

name	Txndc14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385816 GeneID:66958 MGI:1914208
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 14 transcript_id : NM_025868.2

name	Med19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922679 GeneID:381379 MGI:1914234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 19 homolog (yeast) transcript_id : NM_025885.2

name	Zdhhc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476269 GeneID:228136 MGI:1923573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 5 transcript_id : NM_144887.3

name	Clp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130843 GeneID:98985 MGI:2138968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae) transcript_id : NM_133840.2

name	Ypel4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53292601 GeneID:241525 MGI:3605071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : yippee-like 4 (Drosophila) transcript_id : NM_001005342.2

name	Serping1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370111 GeneID:12258 MGI:894696
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade G, member 1 transcript_id : NM_009776.2

name	Ube2l6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910601 GeneID:56791 MGI:1914500
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2L 6 transcript_id : NM_019949.1

name	Smtnl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129859 GeneID:68678 MGI:1915928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : smoothelin-like 1 transcript_id : NM_024230.2

name	Timm10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305574 GeneID:30059 MGI:1353429
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 10 homolog (yeast) transcript_id : NM_013899.1

name	Slc43a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139949131 GeneID:72401 MGI:1931352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 1 transcript_id : NM_001081349.2

name	Slc43a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948640 GeneID:72401 MGI:1931352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 1 transcript_id : NM_024497.1

name	Slc43a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948178 GeneID:72401 MGI:1931352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 1 transcript_id : NM_001083809.1

name	Rtn4rl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40363806 GeneID:269295 MGI:2669796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 4 receptor-like 2 transcript_id : NM_199223.1

name	Slc43a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120587004 GeneID:58207 MGI:1931054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 3 transcript_id : NM_021398.2

name	Prg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376074 GeneID:19074 MGI:103294
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteoglycan 2, bone marrow transcript_id : NM_008920.3

name	Prg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130834 GeneID:53856 MGI:1858200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteoglycan 3 transcript_id : NM_016914.2

name	P2rx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781757 GeneID:228139 MGI:1097160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 3 transcript_id : NM_145526.2

name	Ssrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366943 GeneID:20833 MGI:107912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : structure specific recognition protein 1 transcript_id : NM_182990.3

name	Tnks1bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486922 GeneID:228140 MGI:2446193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tankyrase 1 binding protein 1 transcript_id : NM_001081260.1

name	Agtrl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542120 GeneID:23796 MGI:1346086
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiotensin receptor-like 1 transcript_id : NM_011784.2

name	LOC625033 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367084 GeneID:625033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC625033 transcript_id : XM_898561.2

name	Lrrc55 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796638 GeneID:241528 MGI:2685197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 55 transcript_id : NM_001033346.2

name	Zc3h15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34368584 CCDS:CCDS16180.1 GeneID:69082 MGI:1919747
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA] codon_start : 1 note : immediate early response, erythropoietin 4; novel zinc finger protein product : erythropoietin 4 immediate early response protein_id : NP_081210.2

name	Itgav (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680486 CCDS:CCDS16181.1 GeneID:16410 MGI:96608
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : alphav-integrin; vitronectin receptor alpha polypeptide (VNRA) product : integrin alpha V protein_id : NP_032428.1

name	D430039N05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202059 CCDS:CCDS16182.1 GeneID:241520 MGI:2444579
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 product : hypothetical protein LOC241520 protein_id : NP_780723.1

name	Zswim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313666 CCDS:CCDS16183.1 GeneID:71861 MGI:1919111
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : zinc finger SWIM domain containing 2 product : zinc finger, SWIM domain containing 2 protein_id : NP_082240.1

name	Calcrl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055258 CCDS:CCDS16184.1 GeneID:54598 MGI:1926944
definition	GO_function : GO:0004948 - calcitonin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007507 - heart development [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0048661 - positive regulation of smooth muscle cell proliferation [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : calcitonin receptor-like receptor product : calcitonin receptor-like protein_id : NP_061252.1

name	Tfpi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859644 CCDS:CCDS16185.1 GeneID:21788 MGI:1095418
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0030414 - protease inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA] codon_start : 1 product : tissue factor pathway inhibitor protein_id : NP_035706.1

name	LOC672763 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249857 GeneID:672763
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475554.1

name	Ctnnd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745122 CCDS:CCDS16186.1 GeneID:12388 MGI:105100
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : p120-catenin; catenin src product : catenin (cadherin associated protein), delta 1 protein_id : NP_031641.2

name	2700094K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76781489 CCDS:CCDS16187.1 GeneID:72657 MGI:1919907
definition	GO_function : GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA] codon_start : 1 product : selenoprotein H protein_id : NP_001028338.1 transl_except : (pos:complement(84510538..84510540),aa:Sec)

name	2700094K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82546883 CCDS:CCDS16187.1 GeneID:72657 MGI:1919907
definition	GO_function : GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA] codon_start : 1 product : selenoprotein H protein_id : NP_001032356.1 transl_except : (pos:complement(84510538..84510540),aa:Sec)

name	Txndc14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313210 CCDS:CCDS16188.1 GeneID:66958 MGI:1914208
definition	GO_function : GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 product : thioredoxin-related transmembrane protein 2 protein_id : NP_080144.1

name	Med19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313194 CCDS:CCDS16189.1 GeneID:381379 MGI:1914234
definition	GO_component : GO:0000119 - mediator complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : lung cancer metastasis-related protein 1 homolog protein_id : NP_080161.1

name	Zdhhc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450253 CCDS:CCDS16190.1 GeneID:228136 MGI:1923573
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, DHHC domain containing 5 protein_id : NP_659136.1

name	Clp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527056 CCDS:CCDS16191.1 GeneID:98985 MGI:2138968
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : ATP/GTP-binding protein protein_id : NP_598601.1

name	Ypel4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52693937 CCDS:CCDS16192.1 GeneID:241525 MGI:3605071
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : yippee-like 4 protein_id : NP_001005342.1

name	Serping1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753218 CCDS:CCDS16193.1 GeneID:12258 MGI:894696
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0006956 - complement activation [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : complement component 1 inhibitor; serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1 product : serine (or cysteine) proteinase inhibitor, clade G, member 1 protein_id : NP_033906.1

name	Ube2l6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910602 CCDS:CCDS16194.1 GeneID:56791 MGI:1914500
definition	GO_function : GO:0042296 - ISG15 conjugating enzyme activity [Evidence IDA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008639 - small protein conjugating enzyme activity [Evidence IDA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0032020 - ISG15-protein conjugation [Evidence IDA]; GO:0019941 - modification-dependent protein catabolism [Evidence IDA]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ubiquitin-conjugating enzyme 8 product : E2 ubiquitin conjugating enzyme protein_id : NP_064333.1

name	Smtnl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195656 CCDS:CCDS16195.1 GeneID:68678 MGI:1915928
definition	codon_start : 1 note : calponin homology-associated smooth muscle protein product : smoothelin-like 1 protein_id : NP_077192.1

name	Timm10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305575 GeneID:30059 MGI:1353429
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy product : translocase of inner mitochondrial membrane 13 homolog a protein_id : NP_038927.1

name	Slc43a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139949132 GeneID:72401 MGI:1931352
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA]; GO:0015175 - neutral amino acid transporter activity [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0015804 - neutral amino acid transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; prostate cancer overexpressed gene 1 product : solute carrier family 43, member 1 isoform 1 protein_id : NP_001074818.2

name	Slc43a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948179 GeneID:72401 MGI:1931352
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA]; GO:0015175 - neutral amino acid transporter activity [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0015804 - neutral amino acid transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; prostate cancer overexpressed gene 1 product : solute carrier family 43, member 1 isoform 3 protein_id : NP_001077278.1

name	Slc43a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948641 GeneID:72401 MGI:1931352
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA]; GO:0015175 - neutral amino acid transporter activity [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0015804 - neutral amino acid transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; prostate cancer overexpressed gene 1 product : solute carrier family 43, member 1 isoform 2 protein_id : NP_078773.1

name	Rtn4rl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40363807 CCDS:CCDS16197.1 GeneID:269295 MGI:2669796
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0031103 - axon regeneration [Evidence TAS] codon_start : 1 note : nogo-66 receptor-related protein 2; nogo receptor-like 3; nogo-66 receptor homolog 1 product : reticulon 4 receptor-like 2 protein_id : NP_954693.1

name	Slc43a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120587005 GeneID:58207 MGI:1931054
definition	codon_start : 1 note : selectively expressed in embryonic epithelia protein-1; embryonic epithelial gene 1 product : solute carrier family 43, member 3 protein_id : NP_067373.2

name	Prg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679457 CCDS:CCDS16198.1 GeneID:19074 MGI:103294
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : proteoglycan 2, bone marrow protein_id : NP_032946.1

name	Prg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394042 CCDS:CCDS16199.1 GeneID:53856 MGI:1858200
definition	GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : major basic protein 2 product : proteoglycan 3 protein_id : NP_058610.1

name	P2rx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781758 CCDS:CCDS16200.1 GeneID:228139 MGI:1097160
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004931 - ATP-gated cation channel activity [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : P2X purinoceptor 3 product : purinergic receptor P2X3 protein_id : NP_663501.2

name	Ssrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111154063 GeneID:20833 MGI:107912
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : structure specific recognition protein 1 protein_id : NP_892035.2

name	Tnks1bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486923 GeneID:228140 MGI:2446193
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : tankyrase 1 binding protein 1 protein_id : NP_001074729.1

name	Agtrl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753014 CCDS:CCDS16201.1 GeneID:23796 MGI:1346086
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : apelin receptor product : angiotensin II receptor-like 1 protein_id : NP_035914.1

name	LOC625033 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82886411 GeneID:625033
definition	codon_start : 1 product : hypothetical protein protein_id : XP_903654.1

name	Lrrc55 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701836 GeneID:241528 MGI:2685197
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 55 protein_id : NP_001028518.1

name	LOC100040818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040818
definition	number : 1 pseudo : _no_value

name	LOC100040818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040818
definition	number : 2 pseudo : _no_value

name	LOC100040818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040818
definition	number : 3 pseudo : _no_value

name	LOC100040818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040818
definition	number : 4 pseudo : _no_value

name	LOC668077 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668077
definition	number : 1 pseudo : _no_value

name	LOC668077 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668077
definition	number : 2 pseudo : _no_value

name	LOC668077 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668077
definition	number : 3 pseudo : _no_value

name	LOC383725 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383725
definition	number : 1 pseudo : _no_value

name	LOC383725 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383725
definition	number : 2 pseudo : _no_value

name	LOC383725 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383725
definition	number : 3 pseudo : _no_value

name	Dnmt3l-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	note : Dnmt3l-ps1 pseudogene pseudo : _no_value

name	LOC545429 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249871 GeneID:545429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 599 ESTs, 9 Proteins product : similar to ribosomal protein S4, X-linked pseudo : _no_value transcript_id : XR_032825.1

name	LOC668096 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249872 GeneID:668096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 97 ESTs, 4 Proteins product : hypothetical LOC668096 pseudo : _no_value transcript_id : XR_002134.2

name	LOC668100 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249873 GeneID:668100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 ESTs, 4 Proteins product : hypothetical LOC668100 pseudo : _no_value transcript_id : XR_002136.2

name	LOC545432 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249874 GeneID:545432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 ESTs, 4 Proteins product : similar to CG12750-PA transcript_id : XR_001626.2

name	LOC668107 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249875 GeneID:668107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 ESTs, 4 Proteins product : hypothetical LOC668107 pseudo : _no_value transcript_id : XR_002138.2

name	LOC668113 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249876 GeneID:668113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 4 Proteins product : hypothetical LOC668113 pseudo : _no_value transcript_id : XR_002140.2

name	LOC668115 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249877 GeneID:668115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 4 Proteins product : hypothetical LOC668115 pseudo : _no_value transcript_id : XR_002141.2

name	LOC668119 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249878 GeneID:668119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 96 ESTs, 4 Proteins product : hypothetical LOC668119 pseudo : _no_value transcript_id : XR_002143.2

clone name	MSMg01-049H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545B08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-205J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351M03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-432M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079K10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-403L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172N04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488P03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-309O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-235K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211H16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-428B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010M20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-097A09.b	B6Ng01-097A09.g
ACC	DH907506	DH907507
length	1,275	1,175
definition	DH907506\|Mus musculus domesticus DNA, BAC clone: B6Ng01-097A09, 5' end.	DH907507\|Mus musculus domesticus DNA, BAC clone: B6Ng01-097A09, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcagggaaagcaatacttggaagacaattgttcagcaagaaaacat ggctttatggcaccaggaaagcagagcgtggcatgtgcaaccaatatcct ttctaagctttgcagtcagcatactggaatgaattacagtcttgtctgtt atatcttaacaccagattgaatctttcccctaatgatctctgtatacaga gtcagatacagataataaaataatcacagacaaacatctactgtttatat atttgataatcaaggaacacatggttcttttattgaatactaattccgtt gtatacatttgtgatagcctgttccataatacaactgggtgggcccaggc aatgatacactaggctataatcatgttatctggatgcctgtattcactgg gccagtgtttttcctttcccatgagaaccttatgctctcataaagcatca aataactcatctctcctgactgaaaagcaagtcatctacaatgcaggttt caagaaaatggggacacaaagcttgttgcctcctagaaagaaacgctctc atgctttgtgctgatgctggctctgtggctgccctgtcctccatgaatta ctaatgtcttcataaatctttctaaagcactgtgcctgaacaccctgaaa cagatcgtgtaatctcagtgtctaaaaagaacatctccccagaacgatgt gtgcagtatattctccactacagttatcttctcttccagtctccacattc gaggcgagcatgtttccaagctctcctctacctcaggggaagtttgctca aagcctttctgtgcttttaaatgtcacctcggcttccagaatcctccctt taaaaattcattcctccaacatactcctccttactctcacatttcattat ccacttatcctacagataaatctataaggcatgaggtttggagtagtgct ttgtatatgtttttttttttaaaaaccttaaaaaatcactattagtaaga ttcaaattccctcaaaccatgtgcaagcagagcgcccaacagtttcagta ttttgtgcttgaaaagaaataggattaaggaagaagttttgttctcactt ctaaagaagtaattttgttttgttgtcccattaggcacctctcagctgta aagttaggaaaaactctcgcatgtggtttaaccttgaagcaaaaggttgg atgtgcaggaaactcatggaataataataccctaataccaataaaaagtg aaccgttacctctcagaaaattaat	gaattctcacctgaggaataccgaatggctgagaagcacctgaaaaaatg ttcaacatccttagtcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctaagatgaaaaattcaggtgacagc agatgctcgcgaggatgtagagaaagaggaacactcctccattgttggtg ggattgcaagctagtacaacactctggaaatcagtctggcggttcctcag aaaattgtacattgtactacggaggatcccgcaatacctctcttgggcat atatccagaagatgtcccaactggtaagaaggacacatgctccactatgt tcatagcagccttatttataatagccagaaactggaaagaacccagatgc ccctcaacagaggaatggaacagaaaatgtggtaaatttacacaatggag tactactcctctattaaaaagaatgaatttatgaaattcctaggcaaatg gatggacctggagggcatcatcctgagtgaggtaacaaaggaacttgcac aatatgtactcactgataagtggatattagcccagaaacttaggatacac aagatataagatacaatttgctaaatgcatgaaactcaagaagaacgaag accaaagtgtggacactttgccccttcttagaaatgggaacaaaacaccc ttggaaggagttacaaagacaaaatttggagctgtgacgaaaggatggac catctagtgattgccatatccagggatccatcccataatcagcttccaaa tgctgacaccattgcataccctagcaagattttgctgaaaggacccagat atagctgtctcttgtgagactatgccggggcctagcaaacacagaagtgg atgttctcagtcagctattggatgggtaacatgggccccaatggaggagc tagagaaagtacccaaggagctaaagggaactgcaaccctataggtggaa caacatatgagctaaccagtaccccggagtcttgtctctagctgcttttg tatcaaaaaatggcctagtcgtcatcacaaggatgagaggccctttggac tgcaaacttttttatgttcccagtacagggaccgccaaggccaaagggga ggttgtggtggtgggttgtgggtct
quality values	Open. Hide. 61 61 24 37 61 38 22 52 61 61 47 61 61 47 50 55 61 61 61 61 61 61 61 61 61 61 13 16 16 12 10 12 12 7 8 9 14 10 18 36 61 55 55 61 61 61 61 61 61 59 59 55 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 52 34 33 21 18 28 18 26 25 31 41 55 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 57 57 53 47 47 53 53 57 57 53 57 57 53 53 57 57 57 57 52 53 53 57 57 53 57 57 57 57 57 52 52 57 57 53 53 57 57 57 57 52 57 57 57 53 57 57 50 53 50 53 57 57 53 57 57 57 42 53 32 47 43 32 57 53 53 57 50 53 45 38 53 53 53 45 52 53 57 52 53 50 57 57 57 57 50 45 57 52 53 42 52 53 53 50 57 47 53 34 37 57 57 45 45 53 31 41 38 57 50 50 45 37 53 40 48 41 47 34 53 57 52 57 52 35 43 53 50 53 45 53 57 39 53 47 53 38 47 53 44 53 44 53 53 37 24 44 50 57 40 53 50 24 50 33 53 53 42 31 50 28 53 33 36 53 28 52 38 38 53 53 38 46 38 44 18 34 37 52 53 40 40 33 42 40 42 37 28 38 44 40 40 30 13 57 57 38 42 48 31 29 57 38 33 31 48 41 27 57 33 30 33 35 24 57 32 39 37 41 33 35 40 40 57 57 44 41 57 38 30 33 34 40 33 35 53 40 44 21 32 36 34 46 32 43 29 28 51 14 19 30 44 31 29 47 44 29 46 32 35 51 51 46 29 20 33 25 18 29 48 32 31 29 29 36 17 29 29 28 29 29 29 30 29 32 31 28 48 23 25 19 32 35 38 29 29 18 32 18 18 46 32 30 24 27 33 14 21 29 29 24 28 24 29 28 29 35 33 28 33 35 25 14 28 18 31 46 26 28 38 28 30 38 35 20 23 20 6 17 28 35 35 33 29 14 51 32 25 29 29 20 29 31 22 27 29 23 29 51 23 26 17 22 26 23 20 30 34 51 51 46 51 51 51 51 51 51 29 23 51 46 51 14 27 25 24 39 28 51 51 51 36 29 23 30 19 21 28 28 23 25 29 20 25 33 6 14 36 22 24 34 23 51 17 7 9 38 51 12 12 24 20 51 19 19 28 19 16 11 5 13 19 16 22 20 31 5 6 6 6 15 7 12 51 31 28 9 4 8 9 19 42 24 25 23 8 6 9 12 33 34 6 5 10 24 26 30 10 14 21 44 34 33 13 26 39 13 19 6 7 9 31 19 21 13 6 18 11 18 7 5 13 33 5 21 36 33 7 13 7 24 6 5 5 5 6 4 4 12 11 23 30 6 5 14 13 10 6 26 6 5 4 9 6 6 7 37 33 23 17 6 5 4 4 4 6 11 6 5 5 6 6 18 4 10 6 10 11 4 8 5 3 2 8 23 19 11 4 4 4 11 5 12 19 9 14 20 10 6 6 9 4 7 14 6 5 5 10 14 9 24 5 4 17 3 25 12 6 24 9 7 4 3 3 12 10 4 16 9 27 7 10 3 3 6 15 3 4 4 4 1 4 4 1 2 1 1 3 19 13 3 3 9 6 12 5 3 4 4 3 11 5 6 12 5 6 5 5 11 6 3 8 18 5 17 8 15 6 12 4 8 24 8 4 3 4 5 6 5 8 14 20 15 9 10 6 5 4 6 6 13 16 5 5 7 13 24 7 4 6 5 8 7	Open. Hide. 61 61 43 39 61 61 52 49 11 61 11 18 12 10 8 12 19 26 24 37 43 59 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 59 61 59 59 61 24 38 23 20 27 23 35 27 55 44 37 59 59 61 61 61 61 61 61 59 61 55 59 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 61 61 59 61 61 61 61 61 59 61 59 59 61 61 61 59 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 52 61 61 61 61 61 61 61 61 61 55 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 34 34 37 26 28 37 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 57 57 57 57 57 57 40 57 57 57 53 53 57 57 57 53 57 57 57 45 53 57 57 57 53 57 57 53 47 53 57 57 57 53 57 57 53 47 47 47 32 53 57 50 53 47 57 47 57 53 52 50 53 57 43 57 53 53 53 50 53 57 57 57 53 53 57 52 57 53 52 57 45 37 57 57 57 57 57 53 57 53 53 47 32 57 57 32 57 34 32 45 57 57 38 38 26 53 29 47 57 45 52 52 43 57 50 50 45 45 46 46 43 43 50 50 46 27 35 35 41 45 42 33 37 38 53 57 50 43 57 57 47 45 53 50 27 41 57 50 47 36 52 57 39 46 37 52 32 38 39 19 53 40 35 50 53 32 53 24 35 38 33 50 37 38 57 57 50 30 57 52 53 37 38 28 42 53 44 44 47 37 33 29 53 57 32 32 57 32 26 53 47 32 33 52 36 42 40 37 28 39 33 52 32 35 37 40 27 37 34 41 43 41 32 57 35 37 53 57 31 29 25 53 24 48 33 57 35 29 48 40 35 36 40 34 34 40 48 44 32 47 29 48 38 30 41 35 30 29 32 27 27 31 48 30 48 46 34 29 24 30 27 28 51 45 30 30 21 31 28 30 21 31 22 51 51 43 25 27 29 23 29 51 17 10 14 28 16 39 31 25 13 29 24 33 35 28 28 28 38 34 31 39 29 29 28 33 32 23 25 31 18 29 23 38 28 29 32 28 29 29 51 51 30 17 34 26 29 14 29 32 46 30 27 21 29 20 31 39 41 31 28 28 25 14 17 28 17 31 34 31 33 20 25 31 35 26 28 31 34 23 28 25 24 23 21 17 39 46 30 22 28 24 29 14 23 20 51 15 51 51 51 46 20 24 27 33 28 34 24 19 29 13 27 29 31 20 29 21 29 51 31 16 25 27 31 41 28 13 14 31 10 24 17 28 26 22 38 16 23 51 30 23 19 22 27 28 25 18 20 33 51 28 31 26 31 10 21 5 10 19 20 16 7 13 6 17 19 28 10 4 10 31 33 19 25 29 21 25 13 16 22 34 23 28 28 35 39 23 15 6 22 8 24 28 8 10 26 6 9 10 11 10 14 21 31 20 22 11 4 4 6 5 15 5 5 5 16 19 17 28 10 7 16 15 26 19 9 14 9 11 7 10 5 13 4 16 16 11 12 9 14 7 7 23 7 29 10 12 6 5 18 9 18 5 29 7 9 26 12 11 9 7 5 14 10 15 15 16 18 14 20 11 14 9 6 5 5 6 9 5 5 11 12 10 5 4 4 6 8 12 9 26 11 8 5 4 4 11 9 6 5 17 8 3 4 13 24 18 13 29 25 10 6 5 3 4 4 9 4 3 3 4 11 8 3 14 11 6 7 13 4 5 11 5 16 4 3 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_84113722_84115010
seq2: B6Ng01-097A09.b_44_1318 (reverse)

seq1  ATTAATTTTCTGATAGTTACAGGTTCAACATTATTTATTTAGTTATTTAG  50
      ||||||||||||| || ||  ||||   || | ||||||  | ||||  |
seq2  ATTAATTTTCTGAGAGGTAACGGTT---CACTTTTTATT--GGTATTAGG  45

seq1  TTATTTATTTATTTCCAATGAGATTTCTATCACTATCAAAACATTTTGCT  100
       ||||   |||||  | ||||| ||||   ||| |||  ||| |||||||
seq2  GTATT--ATTATT--CCATGAG-TTTCCTGCAC-ATC-CAACCTTTTGCT  88

seq1  TCAGAAGTTAAACCACATGC-AGAGTTATTCCTAACCTGTACAGCTGAGA  149
      ||| | |||||||||||||| |||||| ||||||| || |||||||||||
seq2  TCA-AGGTTAAACCACATGCGAGAGTTTTTCCTAA-CTTTACAGCTGAGA  136

seq1  GTTGCCTTATGTGAC-ACAAAACAATATTACCTTCTTTAG-AGTGAGAAC  197
      | ||||| ||| ||| ||||||||| |||| ||||||||| |||||||||
seq2  GGTGCCTAATGGGACAACAAAACAAAATTA-CTTCTTTAGAAGTGAGAAC  185

seq1  AAAACTTCTCCCTTAATCCTATTTCTTTTCAAGCAC-AAATACTGAAACT  246
      ||||||||| |||||||||||||||||||||||||| |||||||||||| 
seq2  AAAACTTCTTCCTTAATCCTATTTCTTTTCAAGCACAAAATACTGAAAC-  234

seq1  TGTTGGGCGCTCCTGCTTGCACCATGGTTTGAGGG-ATTTGAATCTTACT  295
      ||||||||||| ||||||||| ||||||||||||| ||||||||||||||
seq2  TGTTGGGCGCT-CTGCTTGCA-CATGGTTTGAGGGAATTTGAATCTTACT  282

seq1  AATAGTGATTTTTTTAAGGTTTTTAAAAAAAAAAACATATACAAAGCACT  345
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  AATAGTGA-TTTTTTAAGGTTTTTAAAAAAAAAAACATATACAAAGCACT  331

seq1  ACTCCAAACCTCATGCCTTATAGATTTATCTGTAGGATAAGTGGATAATG  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCCAAACCTCATGCCTTATAGATTTATCTGTAGGATAAGTGGATAATG  381

seq1  AAATGTGAGAGTAAGGAGGAGTATGTTGGAGGAATGAATTTTTAAAGGGA  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTGAGAGTAAGGAGGAGTATGTTGGAGGAATGAATTTTTAAAGGGA  431

seq1  GGATTCTGGAAGCCGAGGTGACATTTAAAAGCACAGAAAGGCTTTGAGCA  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATTCTGGAAGCCGAGGTGACATTTAAAAGCACAGAAAGGCTTTGAGCA  481

seq1  AACTTCCCCTGAGGTAGAGGAGAGCTTGGAAACATGCTCGCCTCGAATGT  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTCCCCTGAGGTAGAGGAGAGCTTGGAAACATGCTCGCCTCGAATGT  531

seq1  GGAGACTGGAAGAGAAGATAACTGTAGTGGAGAATATACTGCACACATCG  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGACTGGAAGAGAAGATAACTGTAGTGGAGAATATACTGCACACATCG  581

seq1  TTCTGGGGAGATGTTCTTTTTAGACACTGAGATTACACGATCTGTTTCAG  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGGGGAGATGTTCTTTTTAGACACTGAGATTACACGATCTGTTTCAG  631

seq1  GGTGTTCAGGCACAGTGCTTTAGAAAGATTTATGAAGACATTAGTAATTC  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTTCAGGCACAGTGCTTTAGAAAGATTTATGAAGACATTAGTAATTC  681

seq1  ATGGAGGACAGGGCAGCCACAGAGCCAGCATCAGCACAAAGCATGAGAGC  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGAGGACAGGGCAGCCACAGAGCCAGCATCAGCACAAAGCATGAGAGC  731

seq1  GTTTCTTTCTAGGAGGCAACAAGCTTTGTGTCCCCATTTTCTTGAAACCT  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCTTTCTAGGAGGCAACAAGCTTTGTGTCCCCATTTTCTTGAAACCT  781

seq1  GCATTGTAGATGACTTGCTTTTCAGTCAGGAGAGATGAGTTATTTGATGC  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATTGTAGATGACTTGCTTTTCAGTCAGGAGAGATGAGTTATTTGATGC  831

seq1  TTTATGAGAGCATAAGGTTCTCATGGGAAAGGAAAAACACTGGCCCAGTG  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATGAGAGCATAAGGTTCTCATGGGAAAGGAAAAACACTGGCCCAGTG  881

seq1  AATACAGGCATCCAGATAACATGATTATAGCCTAGTGTATCATTGCCTGG  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATACAGGCATCCAGATAACATGATTATAGCCTAGTGTATCATTGCCTGG  931

seq1  GCCCACCCAGTTGTATTATGGAACAGGCTATCACAAATGTATACAACGGA  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCACCCAGTTGTATTATGGAACAGGCTATCACAAATGTATACAACGGA  981

seq1  ATTAGTATTCAATAAAAGAACCATGTGTTCCTTGATTATCAAATATATAA  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAGTATTCAATAAAAGAACCATGTGTTCCTTGATTATCAAATATATAA  1031

seq1  ACAGTAGATGTTTGTCTGTGATTATTTTATTATCTGTATCTGACTCTGTA  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTAGATGTTTGTCTGTGATTATTTTATTATCTGTATCTGACTCTGTA  1081

seq1  TACAGAGATCATTAGGGGAAAGATTCAATCTGGTGTTAAGATATAACAGA  1145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGAGATCATTAGGGGAAAGATTCAATCTGGTGTTAAGATATAACAGA  1131

seq1  CAAGACTGTAATTCATTCCAGTATGCTGACTGCAAAGCTTAGAAAGGATA  1195
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGACTGTAATTCATTCCAGTATGCTGACTGCAAAGCTTAGAAAGGATA  1181

seq1  TTGGTTGCACATGCCACGCTCTGCTTTCCTGGTGCCATAAAGCCATGTTT  1245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTTGCACATGCCACGCTCTGCTTTCCTGGTGCCATAAAGCCATGTTT  1231

seq1  TCTTGCTGAACAATTGTCTTCCAAGTATTGCTTTCCCTGAATTC  1289
      ||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGCTGAACAATTGTCTTCCAAGTATTGCTTTCCCTGAATTC  1275

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information