MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-153J18
Chromosome	2 (Build37)
Map Location	156,419,455 - 156,600,122
singlet/doublet	doublet
Overlap gene	Dlgap4
Upstream gene	Myh7b, Trpc4ap, Edem2, Procr, Mmp24, Itgb4bp, 5530400B04Rik, 2410003P15Rik, Gdf5, Cep250, Ergic3, Fer1l4, Spag4, Cpne1, Rbm12, Nfs1, 2010100O12Rik, Rbm39, Phf20, Scand1, LOC632394, LOC628707, LOC669792, 2900097C17Rik, LOC668941, Epb4.1l1, 0610011L14Rik
Downstream gene	Myl9, LOC433546, Tgif2, LOC100043677, 1110008F13Rik, Sla2, LOC100043880, Ndrg3, LOC668943, Dsn1, 9830001H06Rik, Gm1332, Samhd1, Rbl1, LOC100043882, 4922505G16Rik, Rpn2, Ghrh, LOC100043678, Manbal, Src, Blcap, Nnat, Ctnnbl1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Myh7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668940 MGI:3710243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 6 Proteins

name	Trpc4ap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56407 MGI:1930751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edem2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108687 MGI:1915540
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Procr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19124 MGI:104596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmp24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17391 MGI:1341867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb4bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16418 MGI:1196288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5530400B04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71405 MGI:1918655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410003P15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56046 MGI:1929472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14563 MGI:95688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cep250 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16328 MGI:108084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ergic3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66366 MGI:1913616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fer1l4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74562 MGI:1921812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Spag4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245865 MGI:2444120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpne1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:266692 MGI:2386621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rbm12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75710 MGI:1922960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nfs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18041 MGI:1316706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010100O12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67067 MGI:1914317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170791 MGI:2157953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228829 MGI:2444148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scand1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19018 MGI:1343132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC632394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 665 ESTs, 1 Protein

name	LOC628707 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628707
definition	note : programmed cell death 10 pseudogene pseudo : _no_value

name	LOC669792 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	2900097C17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:347740 MGI:1914767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 322 ESTs

name	LOC668941 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 496 ESTs, 6 Proteins

name	Epb4.1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13821 MGI:103010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	0610011L14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68295 MGI:1915545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dlgap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228836 MGI:2138865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Myl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98932 MGI:2138915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 247 ESTs, 35 Proteins

name	LOC433546 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 155 ESTs, 10 Proteins

name	Tgif2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228839 MGI:1915299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043677 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs

name	1110008F13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67388 MGI:1914638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sla2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77799 MGI:1925049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043880 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Ndrg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29812 MGI:1352499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Dsn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66934 MGI:1914184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9830001H06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320706 MGI:2444575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 194 ESTs, 4 Proteins

name	Gm1332 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383766 MGI:2686178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	Samhd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56045 MGI:1927468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19650 MGI:103300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 101 ESTs, 5 Proteins

name	4922505G16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629499 MGI:3603828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20014 MGI:98085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ghrh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14601 MGI:95709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043678 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Manbal (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69161 MGI:1916411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Src (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20779 MGI:98397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Blcap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53619 MGI:1858907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nnat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18111 MGI:104716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ctnnbl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66642 MGI:1913892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myh7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250074 GeneID:668940 MGI:3710243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 6 Proteins product : myosin, heavy chain 7B, cardiac muscle, beta transcript_id : XM_001481334.1

name	Trpc4ap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790044 GeneID:56407 MGI:1930751
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily C, member 4 associated protein transcript_id : NM_019828.1

name	Edem2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704057 GeneID:108687 MGI:1915540
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ER degradation enhancer, mannosidase alpha-like 2 transcript_id : NM_145537.1

name	Procr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755175 GeneID:19124 MGI:104596
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein C receptor, endothelial transcript_id : NM_011171.1

name	Mmp24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115495468 GeneID:17391 MGI:1341867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 24 transcript_id : NM_010808.3

name	Itgb4bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891658 GeneID:16418 MGI:1196288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 4 binding protein transcript_id : NM_010579.2

name	5530400B04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110350661 GeneID:71405 MGI:1918655
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5530400B04 gene transcript_id : NM_027788.1

name	2410003P15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363077 GeneID:56046 MGI:1929472
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410003P15 gene transcript_id : NM_018888.2

name	Gdf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679980 GeneID:14563 MGI:95688
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth differentiation factor 5 transcript_id : NM_008109.1

name	Cep250 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86355511 GeneID:16328 MGI:108084
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrosomal protein 250 transcript_id : NM_008383.2

name	Ergic3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370040 GeneID:66366 MGI:1913616
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ERGIC and golgi 3 transcript_id : NM_025516.3

name	Fer1l4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250078 GeneID:74562 MGI:1921812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : fer-1-like 4 (C. elegans) transcript_id : XM_001481335.1

name	Spag4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351579 GeneID:245865 MGI:2444120
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 4 transcript_id : NM_139151.3

name	Cpne1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25141331 GeneID:266692 MGI:2386621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : copine I transcript_id : NM_170590.1

name	Cpne1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25141329 GeneID:266692 MGI:2386621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : copine I transcript_id : NM_170588.1

name	Rbm12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114155124 GeneID:75710 MGI:1922960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 12 transcript_id : NM_170598.2

name	Rbm12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114155119 GeneID:75710 MGI:1922960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 12 transcript_id : NM_029397.3

name	Nfs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754845 GeneID:18041 MGI:1316706
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nitrogen fixation gene 1 (S. cerevisiae) transcript_id : NM_010911.1

name	2010100O12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354890 GeneID:67067 MGI:1914317
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010100O12 gene transcript_id : NM_025946.3

name	Rbm39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118403313 GeneID:170791 MGI:2157953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 39 transcript_id : NM_133242.2

name	Phf20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487306 GeneID:228829 MGI:2444148
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 20 transcript_id : NM_172674.2

name	Scand1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384255 GeneID:19018 MGI:1343132
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SCAN domain-containing 1 transcript_id : NM_020255.2

name	LOC632394 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250219 GeneID:632394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 665 ESTs, 1 Protein product : similar to Rpl37a protein transcript_id : XM_001481161.1

name	2900097C17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250080 GeneID:347740 MGI:1914767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 322 ESTs product : RIKEN cDNA 2900097C17 gene transcript_id : XM_001480665.1

name	LOC668941 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250222 GeneID:668941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 496 ESTs, 6 Proteins product : similar to ribosomal protein L37a transcript_id : XM_001004924.2

name	Epb4.1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76056875 GeneID:13821 MGI:103010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythrocyte protein band 4.1-like 1 transcript_id : NM_001003815.2

name	Epb4.1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76056873 GeneID:13821 MGI:103010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythrocyte protein band 4.1-like 1 transcript_id : NM_013510.3

name	Epb4.1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76056874 GeneID:13821 MGI:103010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythrocyte protein band 4.1-like 1 transcript_id : NM_001006664.2

name	0610011L14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365065 GeneID:68295 MGI:1915545
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610011L14 gene transcript_id : NM_026661.3

name	Dlgap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109891943 GeneID:228836 MGI:2138865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : discs, large homolog-associated protein 4 (Drosophila) transcript_id : NM_146128.5

name	Dlgap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109891941 GeneID:228836 MGI:2138865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : discs, large homolog-associated protein 4 (Drosophila) transcript_id : NM_001042488.1

name	Dlgap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109891939 GeneID:228836 MGI:2138865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : discs, large homolog-associated protein 4 (Drosophila) transcript_id : NM_001042487.1

name	Myl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250223 GeneID:98932 MGI:2138915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 114 ESTs, 4 Proteins product : myosin, light polypeptide 9, regulatory, transcript variant 1 transcript_id : XM_485171.5

name	LOC433546 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367380 GeneID:433546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 155 ESTs, 10 Proteins product : similar to 60S ribosomal protein L9 transcript_id : XM_485172.3

name	Tgif2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129800 GeneID:228839 MGI:1915299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TGFB-induced factor 2 transcript_id : NM_173396.2

name	LOC100043677 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250082 GeneID:100043677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs product : hypothetical protein LOC100043677 transcript_id : XM_001480678.1

name	1110008F13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803233 GeneID:67388 MGI:1914638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110008F13 gene transcript_id : NM_026124.2

name	Sla2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373469 GeneID:77799 MGI:1925049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Src-like-adaptor 2 transcript_id : NM_029983.3

name	Ndrg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305306 GeneID:29812 MGI:1352499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-myc downstream regulated gene 3 transcript_id : NM_013865.1

name	Dsn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802518 GeneID:66934 MGI:1914184
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) transcript_id : NM_025853.2

name	9830001H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250084 GeneID:320706 MGI:2444575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 194 ESTs, 4 Proteins product : RIKEN cDNA 9830001H06 gene transcript_id : XM_283804.7

name	Gm1332 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250225 GeneID:383766 MGI:2686178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : gene model 1332, (NCBI) transcript_id : XM_357232.4

name	Samhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46909601 GeneID:56045 MGI:1927468
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SAM domain and HD domain, 1 transcript_id : NM_018851.2

name	Rbl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859601 GeneID:19650 MGI:103300
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoblastoma-like 1 (p107) transcript_id : NM_011249.1

name	LOC100043882 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250229 GeneID:100043882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 100 ESTs, 5 Proteins product : similar to small nuclear riboprotein Sm-D, transcript variant 2 transcript_id : XM_001481166.1

name	LOC100043882 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250227 GeneID:100043882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : similar to small nuclear riboprotein Sm-D, transcript variant 1 transcript_id : XM_001481165.1

name	4922505G16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357507 GeneID:629499 MGI:3603828
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4922505G16 gene transcript_id : NM_001039557.2

name	Rpn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802799 GeneID:20014 MGI:98085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribophorin II transcript_id : NM_019642.4

name	Ghrh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347516 GeneID:14601 MGI:95709
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth hormone releasing hormone transcript_id : NM_010285.2

name	LOC100043678 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250086 GeneID:100043678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100043678 transcript_id : XM_001480695.1

name	Manbal (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352862 GeneID:69161 MGI:1916411
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase, beta A, lysosomal-like transcript_id : NM_026968.2

name	Src (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253929 GeneID:20779 MGI:98397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rous sarcoma oncogene transcript_id : NM_009271.3

name	Src (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253930 GeneID:20779 MGI:98397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rous sarcoma oncogene transcript_id : NM_001025395.2

name	Blcap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84042528 GeneID:53619 MGI:1858907
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bladder cancer associated protein homolog (human) transcript_id : NM_016916.3

name	Nnat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123701814 GeneID:18111 MGI:104716
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronatin transcript_id : NM_010923.2

name	Nnat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123701831 GeneID:18111 MGI:104716
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronatin transcript_id : NM_180960.2

name	Ctnnbl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802102 GeneID:66642 MGI:1913892
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catenin, beta like 1 transcript_id : NM_025680.3

name	Myh7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250075 GeneID:668940 MGI:3710243
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : RIKEN cDNA 0610038P03 gene protein_id : XP_001481384.1 transl_except : (pos:155437395..155437397,aa:OTHER) transl_except : (pos:155437404..155437406,aa:OTHER) transl_except : (pos:155437455..155437457,aa:OTHER) transl_except : (pos:155437458..155437460,aa:OTHER) transl_except : (pos:155439173..155439175,aa:OTHER) transl_except : (pos:155439203..155439205,aa:OTHER) transl_except : (pos:155439242..155439244,aa:OTHER) transl_except : (pos:155439245..155439247,aa:OTHER) transl_except : (pos:155439305..155439307,aa:OTHER) transl_except : (pos:155440225..155440227,aa:OTHER) transl_except : (pos:155443451..155443453,aa:OTHER) transl_except : (pos:155444491..155444493,aa:OTHER) transl_except : (pos:155445844..155445846,aa:OTHER) transl_except : (pos:155446208..155446210,aa:OTHER) transl_except : (pos:155446538..155446540,aa:OTHER) transl_except : (pos:155448402..155448404,aa:OTHER) transl_except : (pos:155448958..155448960,aa:OTHER) transl_except : (pos:155451387..155451389,aa:OTHER) transl_except : (pos:155451609..155451611,aa:OTHER) transl_except : (pos:155451654..155451656,aa:OTHER) transl_except : (pos:155451714..155451716,aa:OTHER) transl_except : (pos:155452138..155452140,aa:OTHER) transl_except : (pos:155452156..155452158,aa:OTHER) transl_except : (pos:155453351..155453353,aa:OTHER) transl_except : (pos:155453384..155453386,aa:OTHER) transl_except : (pos:155453393..155453395,aa:OTHER) transl_except : (pos:155453423..155453425,aa:OTHER) transl_except : (pos:155453504..155453506,aa:OTHER) transl_except : (pos:155454230..155454232,aa:OTHER) transl_except : (pos:155454239..155454241,aa:OTHER) transl_except : (pos:155454281..155454283,aa:OTHER) transl_except : (pos:155454356..155454358,aa:OTHER) transl_except : (pos:155454566..155454568,aa:OTHER) transl_except : (pos:155454572..155454574,aa:OTHER) transl_except : (pos:155454587..155454589,aa:OTHER) transl_except : (pos:155454629..155454631,aa:OTHER) transl_except : (pos:155454869..155454871,aa:OTHER) transl_except : (pos:155454878..155454880,aa:OTHER) transl_except : (pos:155455127..155455129,aa:OTHER) transl_except : (pos:155455238..155455240,aa:OTHER) transl_except : (pos:155455298..155455300,aa:OTHER) transl_except : (pos:155456034..155456036,aa:OTHER) transl_except : (pos:155456247..155456249,aa:OTHER) transl_except : (pos:155456259..155456261,aa:OTHER) transl_except : (pos:155456788..155456790,aa:OTHER) transl_except : (pos:155456860..155456862,aa:OTHER) transl_except : (pos:155457562..155457564,aa:OTHER) transl_except : (pos:155458376..155458378,aa:OTHER) transl_except : (pos:155458415..155458417,aa:OTHER) transl_except : (pos:155458591..155458593,aa:OTHER) transl_except : (pos:155458606..155458608,aa:OTHER) transl_except : (pos:155458645..155458647,aa:OTHER)

name	Trpc4ap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790045 CCDS:CCDS16952.1 GeneID:56407 MGI:1930751
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005788 - endoplasmic reticulum lumen [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0042288 - MHC class I protein binding [Evidence ISS]; GO:0042605 - peptide antigen binding [Evidence ISS]; GO:0015433 - peptide antigen-transporting ATPase activity [Evidence ISS]; GO:0015197 - peptide transporter activity [Evidence ISS]; GO:0042301 - phosphate binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0046979 - TAP2 binding [Evidence ISS]; GO:0046980 - tapasin binding [Evidence ISS] GO_process : GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence ISS]; GO:0046967 - cytosol to ER transport [Evidence ISS]; GO:0006886 - intracellular protein transport [Evidence ISS]; GO:0015833 - peptide transport [Evidence ISS]; GO:0006461 - protein complex assembly [Evidence ISS] codon_start : 1 exception : mismatches in translation note : Trp4-associated protein TAP1; transient receptor protein 4, associated protein product : transient receptor potential cation channel, subfamily C, member 4 associated protein protein_id : NP_062802.1

name	Edem2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704058 CCDS:CCDS16953.1 GeneID:108687 MGI:1915540
definition	codon_start : 1 exception : mismatches in translation product : putative alpha-mannosidase protein_id : NP_663512.1

name	Procr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755176 CCDS:CCDS16954.1 GeneID:19124 MGI:104596
definition	GO_component : GO:0005813 - centrosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008022 - protein C-terminus binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0050819 - negative regulation of coagulation [Evidence TAS] codon_start : 1 exception : mismatches in translation product : protein C receptor, endothelial protein_id : NP_035301.1

name	Mmp24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115495469 CCDS:CCDS16955.1 GeneID:17391 MGI:1341867
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : membrane type 5-MMP product : matrix metalloproteinase 24 protein_id : NP_034938.3

name	Itgb4bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27501448 CCDS:CCDS16956.1 GeneID:16418 MGI:1196288
definition	GO_component : GO:0005882 - intermediate filament [Evidence IDA]; GO:0005638 - lamin filament [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0043022 - ribosome binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0042256 - mature ribosome assembly [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : integrin beta 4 binding protein protein_id : NP_034709.1

name	5530400B04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110350662 GeneID:71405 MGI:1918655
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC71405 protein_id : NP_082064.1

name	2410003P15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256564 CCDS:CCDS16957.1 GeneID:56046 MGI:1929472
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : basic FGF repressed, Zic binding protein product : basic FGF repressed, zinc binding protein protein_id : NP_061376.1

name	Gdf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679981 CCDS:CCDS16958.1 GeneID:14563 MGI:95688
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0040007 - growth [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : cartilage-derived morphogenetic protein-1; brachypodism product : growth differentiation factor 5 protein_id : NP_032135.1

name	Cep250 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86355512 GeneID:16328 MGI:108084
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : intranuclear matrix protein product : centrosomal protein 2 protein_id : NP_032409.2

name	Ergic3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384938 CCDS:CCDS16959.1 GeneID:66366 MGI:1913616
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : serologically defined breast cancer antigen 84 protein_id : NP_079792.1

name	Fer1l4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250079 GeneID:74562 MGI:1921812
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : similar to novel C2, FerI (NUC094) and FerB (NUC096) domain containing protein protein_id : XP_001481385.1 transl_except : (pos:complement(155873383..155873385),aa:OTHER) transl_except : (pos:complement(155873044..155873046),aa:OTHER) transl_except : (pos:complement(155872981..155872983),aa:OTHER) transl_except : (pos:complement(155872697..155872699),aa:OTHER) transl_except : (pos:complement(155871937..155871939),aa:OTHER) transl_except : (pos:complement(155871910..155871912),aa:OTHER) transl_except : (pos:complement(155871838..155871840),aa:OTHER) transl_except : (pos:complement(155871832..155871834),aa:OTHER) transl_except : (pos:complement(155871378..155871380),aa:OTHER) transl_except : (pos:complement(155870800..155870802),aa:OTHER) transl_except : (pos:complement(155870189..155870191),aa:OTHER) transl_except : (pos:complement(155862199..155862201),aa:OTHER) transl_except : (pos:complement(155861732..155861734),aa:OTHER) transl_except : (pos:complement(155861693..155861695),aa:OTHER) transl_except : (pos:complement(155861648..155861650),aa:OTHER) transl_except : (pos:complement(155861299..155861301),aa:OTHER) transl_except : (pos:complement(155861293..155861295),aa:OTHER) transl_except : (pos:complement(155861248..155861250),aa:OTHER) transl_except : (pos:complement(155860802..155860804),aa:OTHER) transl_except : (pos:complement(155860769..155860771),aa:OTHER) transl_except : (pos:complement(155860664..155860666),aa:OTHER) transl_except : (pos:complement(155860655..155860657),aa:OTHER) transl_except : (pos:complement(155858889..155858891),aa:OTHER) transl_except : (pos:complement(155857483..155857485),aa:OTHER) transl_except : (pos:complement(155857471..155857473),aa:OTHER) transl_except : (pos:complement(155857137..155857139),aa:OTHER) transl_except : (pos:complement(155857039..155857041),aa:OTHER) transl_except : (pos:complement(155857024..155857026),aa:OTHER) transl_except : (pos:complement(155856997..155856999),aa:OTHER) transl_except : (pos:complement(155855557..155855559),aa:OTHER) transl_except : (pos:complement(155855427..155855429),aa:OTHER) transl_except : (pos:complement(155855002..155855004),aa:OTHER) transl_except : (pos:complement(155854918..155854920),aa:OTHER) transl_except : (pos:complement(155854903..155854905),aa:OTHER) transl_except : (pos:complement(155854900..155854902),aa:OTHER) transl_except : (pos:complement(155850526..155850528),aa:OTHER) transl_except : (pos:complement(155850496..155850498),aa:OTHER) transl_except : (pos:complement(155850369),aa:OTHER) transl_except : (pos:complement(155849834..155849835),aa:OTHER) transl_except : (pos:complement(155849705..155849707),aa:OTHER) transl_except : (pos:complement(155848973..155848975),aa:OTHER) transl_except : (pos:complement(155848931..155848933),aa:OTHER) transl_except : (pos:complement(155846520..155846522),aa:OTHER) transl_except : (pos:complement(155846481..155846483),aa:OTHER) transl_except : (pos:complement(155846312..155846314),aa:OTHER) transl_except : (pos:complement(155846261..155846263),aa:OTHER) transl_except : (pos:complement(155846192..155846194),aa:OTHER) transl_except : (pos:complement(155845670..155845672),aa:OTHER) transl_except : (pos:complement(155845643..155845645),aa:OTHER)

name	Spag4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841026 GeneID:245865 MGI:2444120
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : sperm antigen 4 protein_id : NP_631890.2

name	Cpne1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25141330 CCDS:CCDS16960.1 GeneID:266692 MGI:2386621
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0001786 - phosphatidylserine binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : copine I protein_id : NP_733467.1

name	Cpne1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25141332 CCDS:CCDS16960.1 GeneID:266692 MGI:2386621
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0001786 - phosphatidylserine binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : copine I protein_id : NP_733469.1

name	Rbm12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114155120 CCDS:CCDS16961.1 GeneID:75710 MGI:1922960
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein 12 protein_id : NP_083673.3

name	Rbm12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114155125 CCDS:CCDS16961.1 GeneID:75710 MGI:1922960
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein 12 protein_id : NP_733486.2

name	Nfs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754846 CCDS:CCDS16962.1 GeneID:18041 MGI:1316706
definition	GO_component : GO:0005759 - mitochondrial matrix [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0031071 - cysteine desulfurase activity [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nifS-like (sic) product : nitrogen fixation gene, yeast homolog 1 protein_id : NP_035041.1

name	2010100O12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385436 GeneID:67067 MGI:1914317
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : reactive oxygen species modulator 1 protein_id : NP_080222.1

name	Rbm39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118403314 CCDS:CCDS16964.1 GeneID:170791 MGI:2157953
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence TAS] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence TAS] codon_start : 1 note : coactivator of activating protein-1 and estrogen receptors; RNA-binding region (RNP1, RRM) containing 2 product : RNA binding motif protein 39 protein_id : NP_573505.2

name	Phf20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487307 GeneID:228829 MGI:2444148
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : PHD finger protein 20 protein_id : NP_766262.2

name	Scand1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9937980 GeneID:19018 MGI:1343132
definition	GO_function : GO:0003713 - transcription coactivator activity [Evidence IPI] codon_start : 1 exception : mismatches in translation note : leucine-rich-domain inter-acting protein 1; paroxisome proliferative activated receptor, gamma, coactivator 2; peroxisome proliferative activated receptor, gamma, coactivator 2 product : paroxisome proliferative activated receptor, gamma, coactivator 1 protein_id : NP_064651.1

name	LOC632394 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250220 GeneID:632394
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481211.1

name	2900097C17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250081 GeneID:347740 MGI:1914767
definition	codon_start : 1 product : hypothetical protein LOC347740 protein_id : XP_001480715.1

name	LOC668941 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367375 GeneID:668941
definition	codon_start : 1 product : similar to ribosomal protein L37a protein_id : XP_001004924.1

name	Epb4.1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873607 CCDS:CCDS16966.1 GeneID:13821 MGI:103010
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0030866 - cortical actin cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 3 product : erythrocyte protein band 4.1-like 1 isoform a protein_id : NP_001006665.1

name	Epb4.1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305029 CCDS:CCDS16966.1 GeneID:13821 MGI:103010
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0030866 - cortical actin cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : erythrocyte protein band 4.1-like 1 isoform a protein_id : NP_038538.1

name	Epb4.1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873604 GeneID:13821 MGI:103010
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0030866 - cortical actin cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : erythrocyte protein band 4.1-like 1 isoform b protein_id : NP_001003815.1

name	0610011L14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560139 CCDS:CCDS16967.1 GeneID:68295 MGI:1915545
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68295 protein_id : NP_080937.2

name	Dlgap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62530192 CCDS:CCDS16968.1 GeneID:228836 MGI:2138865
definition	GO_component : GO:0045202 - synapse [Evidence IDA] GO_process : GO:0007267 - cell-cell signaling [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; SAP90/PSD-95 associated protein 4; WW domain-binding protein 16; PSD-95/SAP90 binding protein 4; SAP90/PSD-95-associated protein 4 product : discs, large homolog-associated protein 4 isoform a protein_id : NP_666240.4

name	Dlgap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109891940 GeneID:228836 MGI:2138865
definition	GO_component : GO:0045202 - synapse [Evidence IDA] GO_process : GO:0007267 - cell-cell signaling [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; SAP90/PSD-95 associated protein 4; WW domain-binding protein 16; PSD-95/SAP90 binding protein 4; SAP90/PSD-95-associated protein 4 product : discs, large homolog-associated protein 4 isoform b protein_id : NP_001035952.1

name	Dlgap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109891942 GeneID:228836 MGI:2138865
definition	GO_component : GO:0045202 - synapse [Evidence IDA] GO_process : GO:0007267 - cell-cell signaling [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; SAP90/PSD-95 associated protein 4; WW domain-binding protein 16; PSD-95/SAP90 binding protein 4; SAP90/PSD-95-associated protein 4 product : discs, large homolog-associated protein 4 isoform c protein_id : NP_001035953.1

name	Myl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250224 GeneID:98932 MGI:2138915
definition	codon_start : 1 product : myosin regulatory light polypeptide 9 isoform 1 protein_id : XP_485171.5

name	LOC433546 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51706913 GeneID:433546
definition	codon_start : 1 product : similar to 60S ribosomal protein L9 protein_id : XP_485172.1

name	Tgif2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734180 CCDS:CCDS16969.1 GeneID:228839 MGI:1915299
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TALE family homeobox product : TGFB-induced factor 2 protein_id : NP_775572.1

name	LOC100043677 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250083 GeneID:100043677
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480728.1

name	1110008F13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385630 CCDS:CCDS16970.1 GeneID:67388 MGI:1914638
definition	codon_start : 1 note : novel transcript product : RAB5-interacting protein protein_id : NP_080400.1

name	Sla2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249228 GeneID:77799 MGI:1925049
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0010008 - endosome membrane [Evidence ISS]; GO:0005770 - late endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0047485 - protein N-terminus binding [Evidence ISS]; GO:0005070 - SH3/SH2 adaptor activity [Evidence ISS] GO_process : GO:0050851 - antigen receptor-mediated signaling pathway [Evidence ISS]; GO:0019724 - B cell mediated immunity [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0030522 - intracellular receptor-mediated signaling pathway [Evidence ISS]; GO:0050869 - negative regulation of B cell activation [Evidence ISS]; GO:0050849 - negative regulation of calcium-mediated signaling [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0050776 - regulation of immune response [Evidence ISS]; GO:0042110 - T cell activation [Evidence ISS] [Evidence IDA] codon_start : 1 product : modulator of antigen receptor signaling MARS protein_id : NP_084259.1

name	Ndrg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305307 CCDS:CCDS16971.1 GeneID:29812 MGI:1352499
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030154 - cell differentiation [Evidence IEA] [Evidence ISS]; GO:0030308 - negative regulation of cell growth [Evidence ISS]; GO:0007283 - spermatogenesis [Evidence ISS] codon_start : 1 note : N-myc downstream regulated 3 product : N-myc downstream regulated gene 3 protein_id : NP_038893.1

name	Dsn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385332 CCDS:CCDS16972.1 GeneID:66934 MGI:1914184
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : DSN1, MIND kinetochore complex component, homolog protein_id : NP_080129.1

name	9830001H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250085 GeneID:320706 MGI:2444575
definition	codon_start : 1 product : hypothetical protein LOC320706 protein_id : XP_283804.7

name	Gm1332 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250226 GeneID:383766 MGI:2686178
definition	codon_start : 1 product : similar to orthologue of human chromosome 20 open reading frame 118 (C20orf118) protein_id : XP_357232.4

name	Samhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909602 CCDS:CCDS16973.1 GeneID:56045 MGI:1927468
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence ISS] [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : IFN-gamma induced; SAM domain and HD domain 1 product : SAM domain- and HD domain-containing protein 1 protein_id : NP_061339.2

name	Rbl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859602 CCDS:CCDS16974.1 GeneID:19650 MGI:103300
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : retinoblastoma-like protein 1 protein_id : NP_035379.1

name	LOC100043882 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250230 GeneID:100043882
definition	codon_start : 1 product : similar to small nuclear riboprotein Sm-D isoform 2 protein_id : XP_001481216.1

name	LOC100043882 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250228 GeneID:100043882
definition	codon_start : 1 product : similar to small nuclear riboprotein Sm-D isoform 1 protein_id : XP_001481215.1

name	4922505G16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88319952 GeneID:629499 MGI:3603828
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC629499 protein_id : NP_001034646.1

name	Rpn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34996495 CCDS:CCDS16975.1 GeneID:20014 MGI:98085
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008250 - oligosaccharyl transferase complex [Evidence ISS] [Evidence IEA] GO_function : GO:0004579 - dolichyl-diphosphooligosaccharide-protein glycotransferase activity [Evidence ISS] [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0018279 - protein amino acid N-linked glycosylation via asparagine [Evidence ISS] [Evidence IEA] codon_start : 1 product : ribophorin II protein_id : NP_062616.2

name	Ghrh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753984 CCDS:CCDS16976.1 GeneID:14601 MGI:95709
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 product : growth hormone releasing hormone protein_id : NP_034415.1

name	LOC100043678 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250087 GeneID:100043678
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480745.1

name	Manbal (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60687512 GeneID:69161 MGI:1916411
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mannosidase, beta A, lysosomal-like protein_id : NP_081244.1

name	Src (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794811 GeneID:20779 MGI:98397
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IMP]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030900 - forebrain development [Evidence IGI]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Rous sarcoma oncogene isoform 1 protein_id : NP_033297.2

name	Src (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794809 CCDS:CCDS16978.1 GeneID:20779 MGI:98397
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IMP]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030900 - forebrain development [Evidence IGI]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : Rous sarcoma oncogene isoform 2 protein_id : NP_001020566.1

name	Blcap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84042529 CCDS:CCDS16979.1 GeneID:53619 MGI:1858907
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : bladder cancer related protein; Blcapbladder cancer associated protein homolog product : bladder cancer associated protein protein_id : NP_058612.3

name	Nnat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754864 GeneID:18111 MGI:104716
definition	GO_process : GO:0007275 - development [Evidence IEA] codon_start : 1 note : isoform alpha is encoded by transcript variant 1 product : neuronatin isoform alpha protein_id : NP_035053.1

name	Nnat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32140197 GeneID:18111 MGI:104716
definition	GO_process : GO:0007275 - development [Evidence IEA] codon_start : 1 note : isoform beta is encoded by transcript variant 2 product : neuronatin isoform beta protein_id : NP_851291.1

name	Ctnnbl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981221 CCDS:CCDS16982.1 GeneID:66642 MGI:1913892
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS] codon_start : 1 exception : mismatches in translation product : nuclear protein NAP protein_id : NP_079956.2

name	LOC100043880 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043880
definition	number : 1 pseudo : _no_value

name	LOC668943 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668943
definition	number : 2 pseudo : _no_value

name	LOC668943 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668943
definition	number : 1 pseudo : _no_value

name	LOC669792 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250221 GeneID:669792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_035026.1

clone name	MSMg01-473N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544K06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-370M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430P23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-374G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-273J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482A21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-337N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153G06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-390B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144B05
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-153J18.b	B6Ng01-153J18.g
ACC	DH948875	DH948876
length	815	422
definition	DH948875\|Mus musculus domesticus DNA, BAC clone: B6Ng01-153J18, 5' end.	DH948876\|Mus musculus domesticus DNA, BAC clone: B6Ng01-153J18, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(156,599,311 - 156,600,122)	(156,419,455 - 156,419,882)
sequence	gaattcaattcttttaaaaattctatttattcgtgatgagagttggtgtg gaagtcagtggactgttgcaggcctgcctggccacatacgaacagcaagt gccattaccaaggagcctctctcacgccccagctcaggatttcagtgggg cagctggagagagtgctgccattttcttagttgggcagcgtgggcgtagg cggagcagatttgggagagatccattttgtcttggatttattcatttttg gaaactttcttttgagataatttcaagcatactaaggttctaagactcgt atagaaaactgacttccttgagagtctccagttgacctttggctcctcac tcttccctgtgggaatatgcacattgcccaacacttgatagtgaataaga ttttagtatatcctaaaaggaggactcttttacatattgatagtatatta tcaaaatcataagatttaacattgatttaggcttttaatttatgacctat attccaattgtgccagatgtctcagtaatatcctgtatggaaatttgttc tggtccaggttgtgtgtgatgggtgaggtgcaggtgccatgggcatcatt ctatggagcttgaagatgatgtcatgtagctggagggtgatgtcatggag ctggagaatgttgccatggagctggaagatgtttgtcatggagctggttg tggtggattgaatatgctttgctcagggagtagcactatttaggaggtgt ggtcttgttggagtaggtgtggccttgttagaggaagtgtgtcactgtgg gggtgggttttgaga	ttagcaggcaaaggaaatctttatccatagagaaaccactgttgtgatgc ctaccacatcgctgctctgttatgaaatgttaatactacttgggctgtgg agtagtgtgtgtctgtgtatttgtgtatgttatgtgtgtgtgtgtgtcct agattggcaggttgttcttcagagccagattcctgagagagagcagatca aaaggatgagaagataaagaaggtaggagcgatggagtcaggaggccgtg cacacgctaagtcccgtgccaagagtgtttctggtttaagacaggggcca atgtccttctcctcagggaaagcctcaggtcagcctagctcctgacatgt ttgtgcgtgcacgtgcgcgtgcgtgcgtgcgtgcgtgcgtgcgtgtgtgt gtgtgtgtgtgtgtgtgtgtgt
quality values	Open. Hide. 57 42 34 39 61 30 39 52 61 50 43 61 61 61 47 50 61 61 61 55 47 61 61 61 61 61 16 11 11 12 13 10 5 5 13 20 21 34 43 55 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 61 61 61 34 39 33 20 13 28 24 26 26 28 32 55 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 59 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 52 61 61 59 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 43 55 59 59 59 61 61 61 61 59 59 59 61 61 61 61 61 61 59 59 55 59 61 61 61 61 59 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 41 59 59 59 59 59 59 59 59 59 59 59 61 59 61 59 59 61 61 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 49 61 61 61 61 61 61 61 61 49 61 61 49 55 61 61 61 61 61 61 61 43 34 22 55 37 52 61 55 61 61 55 61 61 61 61 55 55 55 52 55 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 47 32 55 61 55 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 43 61 43 61 55 55 38 61 55 61 55 55 55 61 61 55 55 50 50 61 55 55 55 55 55 55 37 53 61 61 61 61 61 61 53 53 35 50 21 61 25 48 53 31 47 40 61 52 61 61 61 50 50 61 61 61 53 52 35 61 37 32 50 37 31 45 50 50 39 53 47 53 61 53 53 52 33 61 61 34 53 61 31 43 28 61 47 61 61 32 61 53 53 61 52 61 61 45 30 30 14 11 18 14 38 10 47 19 35 34 53 45 53 61 34 61 39 35 61 50 39 40 45 47 43 38 26 10 53 52 53 14 53 45 45 53 20 25 43 53 32 10 46 16 53 38 50 31 33 36 47 23 30 14 20 21 10 32 24 42 47 36 24 50 12 34 8 16 25 8 26 21 33 43 50 37 14 45 24 36 53 45 17 53 16 30 12 12 13 10 38 50 53 35 45 31 9 28 13 16 9 10 21 42 24 50 21 45 41 31 22 15 31 6 20 21 30 16 28 30 30 8 35 8 8 5 4 5 8 22 16 8 15 12 32 16 25 16 9	Open. Hide. 14 7 7 7 9 6 9 10 10 18 23 22 24 59 59 59 52 59 61 61 61 61 61 59 61 59 59 61 59 61 61 61 61 61 61 61 61 61 59 59 61 28 28 30 22 26 22 25 27 26 50 35 55 55 55 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 59 59 59 59 61 59 55 61 39 45 52 52 52 45 59 49 61 36 39 44 30 30 59 59 49 41 44 52 59 59 30 59 36 59 39 59 52 52 59 52 61 61 59 59 52 59 59 49 59 59 59 59 61 52 59 59 39 59 52 52 59 52 43 59 59 36 59 52 59 52 61 61 49 59 49 59 59 59 55 59 49 59 59 49 45 59 59 44 59 49 59 52 59 59 61 59 61 52 61 59 59 59 59 59 59 59 59 59 59 37 40 59 36 39 30 31 29 49 49 59 61 61 59 59 59 61 61 61 61 61 61 59 59 59 61 59 59 59 61 59 59 59 59 59 59 59 52 43 39 36 36 37 45 43 35 36 45 45 59 59 59 52 59 49 45 43 61 59 59 59 49 49 61 59 61 59 49 59 59 59 59 30 35 50 43 49 39 43 40 39 36 49 52 49 13 27 25 11 20 28 29 36 43 52 52 52 37 52 52 43 36 52 36 41 36 36 25 21 27 23 13 32 23 16 12 17 11 11 21 21 27 19 10 21 22 24 28 30 41 17 26 25 30 23 21 27 49 31 35 24 35 14 27 24 24 22 22 13 22 12 16 22 9 11 11 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_156599311_156600122
seq2: B6Ng01-153J18.b_43_857 (reverse)

seq1  TCTCAAAACCCACCCCCACAGTGACACACTTCCTCTAACAAGGCCACACC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCAAAACCCACCCCCACAGTGACACACTTCCTCTAACAAGGCCACACC  50

seq1  TACTCCAACAAGACCACACCTCCT-AATAGTGCTACTCCCTGAGC-AAGC  98
      |||||||||||||||||||||||| |||||||||||||||||||| ||||
seq2  TACTCCAACAAGACCACACCTCCTAAATAGTGCTACTCCCTGAGCAAAGC  100

seq1  ATATTCAATCCACCACAACCAGCTCCATGAC-AACATCTTCCAGCTCCAT  147
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  ATATTCAATCCACCACAACCAGCTCCATGACAAACATCTTCCAGCTCCAT  150

seq1  GGCAACATTCTCCAGCTCCATGACATCACCCTCCAGCTACATGACATCAT  197
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAACATTCTCCAGCTCCATGACATCACCCTCCAGCTACATGACATCAT  200

seq1  CTTCAAGCTCCATAGAATGATGCCCATGGCACCTGCACCTCACCCATCAC  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCAAGCTCCATAGAATGATGCCCATGGCACCTGCACCTCACCCATCAC  250

seq1  ACACAACCTGGACCAGAACAAATTTCCATACAGGATATTACTGAGACATC  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAACCTGGACCAGAACAAATTTCCATACAGGATATTACTGAGACATC  300

seq1  TGGCACAATTGGAATATAGGTCATAAATTAAAAGCCTAAATCAATGTTAA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCACAATTGGAATATAGGTCATAAATTAAAAGCCTAAATCAATGTTAA  350

seq1  ATCTTATGATTTTGATAATATACTATCAATATGTAAAAGAGTCCTCCTTT  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTATGATTTTGATAATATACTATCAATATGTAAAAGAGTCCTCCTTT  400

seq1  TAGGATATACTAAAATCTTATTCACTATCAAGTGTTGGGCAATGTGCATA  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGATATACTAAAATCTTATTCACTATCAAGTGTTGGGCAATGTGCATA  450

seq1  TTCCCACAGGGAAGAGTGAGGAGCCAAAGGTCAACTGGAGACTCTCAAGG  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCACAGGGAAGAGTGAGGAGCCAAAGGTCAACTGGAGACTCTCAAGG  500

seq1  AAGTCAGTTTTCTATACGAGTCTTAGAACCTTAGTATGCTTGAAATTATC  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCAGTTTTCTATACGAGTCTTAGAACCTTAGTATGCTTGAAATTATC  550

seq1  TCAAAAGAAAGTTTCCAAAAATGAATAAATCCAAGACAAAATGGATCTCT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAAGAAAGTTTCCAAAAATGAATAAATCCAAGACAAAATGGATCTCT  600

seq1  CCCAAATCTGCTCCGCCTACGCCCACGCTGCCCAACTAAGAAAATGGCAG  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAAATCTGCTCCGCCTACGCCCACGCTGCCCAACTAAGAAAATGGCAG  650

seq1  CACTCTCTCCAGCTGCCCCACTGAAATCCTGAGCTGGGGCGTGAGAGAGG  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCTCTCCAGCTGCCCCACTGAAATCCTGAGCTGGGGCGTGAGAGAGG  700

seq1  CTCCTTGGTAATGGCACTTGCTGTTCGTATGTGGCCAGGCAGGCCTGCAA  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTTGGTAATGGCACTTGCTGTTCGTATGTGGCCAGGCAGGCCTGCAA  750

seq1  CAGTCCACTGACTTCCACACCAACTCTCATCACGAATAAATAGAATTTTT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCCACTGACTTCCACACCAACTCTCATCACGAATAAATAGAATTTTT  800

seq1  AAAAGAATTGAATTC  812
      |||||||||||||||
seq2  AAAAGAATTGAATTC  815

seq1: chr2_156419455_156419882
seq2: B6Ng01-153J18.g_70_497

seq1  GAATTCTTAGCAGGCAAAGGAAATCTTTATCCATAGAGAAACCACTGTTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTAGCAGGCAAAGGAAATCTTTATCCATAGAGAAACCACTGTTG  50

seq1  TGATGCCTACCACATCGCTGCTCTGTTATGAAATGTTAATACTACTTGGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATGCCTACCACATCGCTGCTCTGTTATGAAATGTTAATACTACTTGGG  100

seq1  CTGTGGAGTAGTGTGTGTCTGTGTATTTGTGTATGTTATGTGTGTGTGTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGGAGTAGTGTGTGTCTGTGTATTTGTGTATGTTATGTGTGTGTGTG  150

seq1  TGTCCTAGATTGGCAGGTTGTTCTTCAGAGCCAGATTCCTGAGAGAGAGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCTAGATTGGCAGGTTGTTCTTCAGAGCCAGATTCCTGAGAGAGAGC  200

seq1  AGATCAAAAGGATGAGAAGATAAAGAAGGTAGGAGCGATGGAGTCAGGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATCAAAAGGATGAGAAGATAAAGAAGGTAGGAGCGATGGAGTCAGGAG  250

seq1  GCCGTGCACACGCTAAGTCCCGTGCCAAGAGTGTTTCTGGTTTAAGACAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCGTGCACACGCTAAGTCCCGTGCCAAGAGTGTTTCTGGTTTAAGACAG  300

seq1  GGGCCAATGTCCTTCTCCTCAGGGAAAGCCTCAGGTCAGCCTAGCTCCTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCAATGTCCTTCTCCTCAGGGAAAGCCTCAGGTCAGCCTAGCTCCTG  350

seq1  ACATGTTTGTGCGTGCACGTGCGCGTGCGTGCGTGCGTGCGTGCGTGCGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATGTTTGTGCGTGCACGTGCGCGTGCGTGCGTGCGTGCGTGCGTGCGT  400

seq1  GTGTGTGTGTGTGTGTGTGTGTGTGTGT  428
      ||||||||||||||||||||||||||||
seq2  GTGTGTGTGTGTGTGTGTGTGTGTGTGT  428

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information