MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-180B24
Chromosome	2 (Build37)
Map Location	29,786,376 - 29,939,140
singlet/doublet	doublet
Overlap gene	Gle1l, Spna2, LOC665532, Wdr34, Set, Pkn3
Upstream gene	LOC100033452, 1700101E01Rik, LOC100039666, Ttf1, Setx, Ntng2, Crsp8, Rapgef1, LOC433415, OTTMUSG00000012686, Trub2, Coq4, Slc27a4, Urm1, LOC100041002, Ceecam1, Odf2
Downstream gene	Zdhhc12, Zer1, LOC100041114, Tbc1d13, Slc39a1-ps, Endog, D2Wsu81e, Ccbl1, 1700084E18Rik, Lrrc8a, Phyhd1, Dolk, Nup188, Sh3glb2, 5730472N09Rik, Dolpp1, Crat, Ppp2r4, Ier5l, Cstad, EG665645, 1700001O22Rik, 2610205E22Rik, Asb6, Prrx2, Ptges, Ppia-ps2_387.1, Tor1b, Tor1a, BC005624, Usp20, Fnbp1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100033452 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100033452
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	1700101E01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329375 MGI:2685669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	LOC100039666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ttf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22130 MGI:105044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Setx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269254 MGI:2443480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ntng2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171171 MGI:2159341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Crsp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68975 MGI:1916225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rapgef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107746 MGI:104580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC433415 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	OTTMUSG00000012686 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433416 MGI:3650473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trub2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227682 MGI:2442186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coq4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227683 MGI:1098826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc27a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26569 MGI:1347347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Urm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68205 MGI:1915455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Ceecam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99151 MGI:2139134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Odf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18286 MGI:1098824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gle1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74412 MGI:1921662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spna2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20740 MGI:98386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665532 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs

name	Wdr34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71820 MGI:1919070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Set (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56086 MGI:1860267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:263803 MGI:2388285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66220 MGI:1913470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zer1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227693 MGI:2442511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Tbc1d13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70296 MGI:2385326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a1-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194642 MGI:3615375
definition	gene_synonym : Slc39a1p note : solute carrier family 39 (zinc transporter), member 1, pseudogene pseudo : _no_value

name	Endog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13804 MGI:1261433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D2Wsu81e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227695 MGI:106544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccbl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70266 MGI:1917516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700084E18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67350 MGI:1914600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs

name	Lrrc8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241296 MGI:2652847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phyhd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227696 MGI:3612860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dolk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227697 MGI:2677836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup188 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227699 MGI:2446190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3glb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227700 MGI:2385131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730472N09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108958 MGI:1922035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dolpp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57170 MGI:1914093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12908 MGI:109501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110854 MGI:1346006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ier5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72500 MGI:1919750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cstad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78617 MGI:1925867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665645 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665645 MGI:3644459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	1700001O22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73598 MGI:1923631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610205E22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66617 MGI:1913867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72323 MGI:1919573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prrx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20204 MGI:98218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptges (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64292 MGI:1927593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppia-ps2_387.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606546
definition	note : peptidylprolyl isomerase A pseudogene 2_387.1 pseudo : _no_value

name	Tor1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30934 MGI:1353605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tor1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30931 MGI:1353568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC005624 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227707 MGI:2385132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74270 MGI:1921520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fnbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14269 MGI:109606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	1700101E01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366337 GeneID:329375 MGI:2685669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : RIKEN cDNA 1700101E01 gene, transcript variant 1 transcript_id : XM_986644.1

name	Ttf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111154069 GeneID:22130 MGI:105044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription termination factor 1 transcript_id : NM_009442.2

name	Setx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113722130 GeneID:269254 MGI:2443480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : senataxin transcript_id : NM_198033.2

name	Ntng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19424139 GeneID:171171 MGI:2159341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : netrin G2 transcript_id : NM_133500.1

name	Ntng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281647 GeneID:171171 MGI:2159341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : netrin G2 transcript_id : NM_133501.1

name	Crsp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386722 GeneID:68975 MGI:1916225
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 8 transcript_id : NM_026896.2

name	Rapgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875505 GeneID:107746 MGI:104580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF) 1 transcript_id : NM_001039087.1

name	Rapgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875507 GeneID:107746 MGI:104580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF) 1 transcript_id : NM_054050.2

name	Rapgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875503 GeneID:107746 MGI:104580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF) 1 transcript_id : NM_001039086.1

name	LOC433415 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94366325 GeneID:433415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to NG5 protein transcript_id : XM_484985.3

name	OTTMUSG00000012686 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360716 GeneID:433416 MGI:3650473
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000012686 transcript_id : NM_001034887.2

name	Trub2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803129 GeneID:227682 MGI:2442186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TruB pseudouridine (psi) synthase homolog 2 (E. coli) transcript_id : NM_145520.3

name	Coq4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365161 GeneID:227683 MGI:1098826
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coenzyme Q4 homolog (yeast) transcript_id : NM_178693.3

name	Slc27a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374126 GeneID:26569 MGI:1347347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 27 (fatty acid transporter), member 4 transcript_id : NM_011989.2

name	Urm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365925 GeneID:68205 MGI:1915455
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin related modifier 1 homolog (S. cerevisiae) transcript_id : NM_026615.3

name	LOC100041002 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249261 GeneID:100041002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100041002 transcript_id : XM_001477254.1

name	Ceecam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131058 GeneID:99151 MGI:2139134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cerebral endothelial cell adhesion molecule 1 transcript_id : NM_207298.2

name	Odf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129797 GeneID:18286 MGI:1098824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : outer dense fiber of sperm tails 2 transcript_id : NM_013615.2

name	Gle1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130556 GeneID:74412 MGI:1921662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GLE1 RNA export mediator-like (yeast transcript_id : NM_028923.2

name	Spna2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115496849 GeneID:20740 MGI:98386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spectrin alpha 2 transcript_id : NM_001076554.1

name	LOC665532 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94366329 GeneID:665532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs product : hypothetical LOC665532 transcript_id : XM_977598.1

name	Wdr34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948826 GeneID:71820 MGI:1919070
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 34 transcript_id : NM_001008498.2

name	Set (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130684 GeneID:56086 MGI:1860267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET translocation transcript_id : NM_023871.3

name	Pkn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418928 GeneID:263803 MGI:2388285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase N3 transcript_id : NM_153805.1

name	Zdhhc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649750 GeneID:66220 MGI:1913470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 12 transcript_id : NM_001037762.1

name	Zdhhc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649754 GeneID:66220 MGI:1913470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 12 transcript_id : NM_025428.2

name	Zer1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542270 GeneID:227693 MGI:2442511
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zer-1 homolog (C. elegans) transcript_id : NM_178694.3

name	LOC100041114 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249267 GeneID:100041114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100041114 transcript_id : XM_001477522.1

name	Tbc1d13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368502 GeneID:70296 MGI:2385326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 13 transcript_id : NM_146252.2

name	Endog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679646 GeneID:13804 MGI:1261433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endonuclease G transcript_id : NM_007931.1

name	D2Wsu81e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801856 GeneID:227695 MGI:106544
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 2, Wayne State University 81, expressed transcript_id : NM_172660.2

name	Ccbl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982062 GeneID:70266 MGI:1917516
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine conjugate-beta lyase 1 transcript_id : NM_172404.2

name	1700084E18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366331 GeneID:67350 MGI:1914600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs product : RIKEN cDNA 1700084E18 gene transcript_id : XM_977942.1

name	Lrrc8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62388880 GeneID:241296 MGI:2652847
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 8A transcript_id : NM_177725.3

name	Phyhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62388881 GeneID:227696 MGI:3612860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phytanoyl-CoA dioxygenase domain containing 1 transcript_id : NM_172267.2

name	Dolk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930710 GeneID:227697 MGI:2677836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dolichol kinase transcript_id : NM_177648.3

name	Nup188 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38678525 GeneID:227699 MGI:2446190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 188 transcript_id : NM_198304.2

name	Sh3glb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314837 GeneID:227700 MGI:2385131
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-domain GRB2-like endophilin B2 transcript_id : NM_139302.1

name	5730472N09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982182 GeneID:108958 MGI:1922035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730472N09 gene transcript_id : NM_175392.3

name	Dolpp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384824 GeneID:57170 MGI:1914093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dolichyl pyrophosphate phosphatase 1 transcript_id : NM_020329.2

name	Crat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198337 GeneID:12908 MGI:109501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carnitine acetyltransferase transcript_id : NM_007760.3

name	Ppp2r4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350306 GeneID:110854 MGI:1346006
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2A, regulatory subunit B (PR 53) transcript_id : NM_138748.3

name	Ier5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508419 GeneID:72500 MGI:1919750
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immediate early response 5-like transcript_id : NM_030244.3

name	Cstad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292434 GeneID:78617 MGI:1925867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CSA-conditional, T cell activation-dependent protein transcript_id : NM_030137.2

name	EG665645 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366335 GeneID:665645 MGI:3644459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG665645 transcript_id : XM_978420.1

name	1700001O22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574089 GeneID:73598 MGI:1923631
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700001O22 gene transcript_id : NM_198000.1

name	2610205E22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130053 GeneID:66617 MGI:1913867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610205E22 gene transcript_id : NM_170592.2

name	Asb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311559 GeneID:72323 MGI:1919573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 6 transcript_id : NM_133346.2

name	Prrx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677840 GeneID:20204 MGI:98218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired related homeobox 2 transcript_id : NM_009116.1

name	Ptges (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46852157 GeneID:64292 MGI:1927593
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin E synthase transcript_id : NM_022415.2

name	Tor1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861255 GeneID:30934 MGI:1353605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin family 1, member B transcript_id : NM_133673.3

name	Tor1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450254 GeneID:30931 MGI:1353568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin family 1, member A (torsin A) transcript_id : NM_144884.1

name	BC005624 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450248 GeneID:227707 MGI:2385132
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC005624 transcript_id : NM_144885.1

name	Usp20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359890 GeneID:74270 MGI:1921520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 20 transcript_id : NM_028846.3

name	Fnbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662769 GeneID:14269 MGI:109606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin binding protein 1 transcript_id : NM_001038700.1

name	Fnbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662772 GeneID:14269 MGI:109606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin binding protein 1 transcript_id : NM_019406.2

name	1700101E01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366338 GeneID:329375 MGI:2685669
definition	codon_start : 1 product : similar to FLJ46082 protein isoform 1 protein_id : XP_991738.1

name	Ttf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111154070 GeneID:22130 MGI:105044
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003716 - RNA polymerase I transcription termination factor activity [Evidence IDA] GO_process : GO:0006338 - chromatin remodeling [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006361 - transcription initiation from RNA polymerase I promoter [Evidence IDA] codon_start : 1 product : transcription termination factor 1 protein_id : NP_033468.2

name	Setx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113722131 GeneID:269254 MGI:2443480
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : amyotrophic lateral sclerosis 4 homolog product : senataxin protein_id : NP_932150.2

name	Ntng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19424140 CCDS:CCDS15851.1 GeneID:171171 MGI:2159341
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant a; laminet 2 product : netrin G2 isoform a protein_id : NP_598007.1

name	Ntng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281648 CCDS:CCDS15852.1 GeneID:171171 MGI:2159341
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant b; laminet 2 product : netrin G2 isoform b protein_id : NP_598008.1

name	Crsp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76253678 CCDS:CCDS15853.1 GeneID:68975 MGI:1916225
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0003713 - transcription coactivator activity [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence ISS] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcriptional co-activator CRSP8 homolog protein_id : NP_081172.2

name	Rapgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875506 GeneID:107746 MGI:104580
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence TAS] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0048008 - platelet-derived growth factor receptor signaling pathway [Evidence IMP]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; guanine nucleotide releasing factor 2 product : Rap guanine nucleotide exchange factor (GEF) 1 isoform 1 protein_id : NP_001034176.1

name	Rapgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905083 CCDS:CCDS15854.1 GeneID:107746 MGI:104580
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence TAS] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0048008 - platelet-derived growth factor receptor signaling pathway [Evidence IMP]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; guanine nucleotide releasing factor 2 product : Rap guanine nucleotide exchange factor (GEF) 1 isoform 3 protein_id : NP_473391.1

name	Rapgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875504 GeneID:107746 MGI:104580
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence TAS] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0048008 - platelet-derived growth factor receptor signaling pathway [Evidence IMP]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; guanine nucleotide releasing factor 2 product : Rap guanine nucleotide exchange factor (GEF) 1 isoform 2 protein_id : NP_001034175.1

name	LOC433415 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94366326 GeneID:433415
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484985.3

name	OTTMUSG00000012686 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702238 GeneID:433416 MGI:3650473
definition	codon_start : 1 product : hypothetical protein LOC433416 protein_id : NP_001030059.1

name	Trub2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560759 CCDS:CCDS15856.1 GeneID:227682 MGI:2442186
definition	codon_start : 1 exception : mismatches in translation product : TruB pseudouridine (psi) synthase homolog 2 protein_id : NP_663495.2

name	Coq4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520093 CCDS:CCDS15857.1 GeneID:227683 MGI:1098826
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : coenzyme Q4 homolog protein_id : NP_848808.1

name	Slc27a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45597453 CCDS:CCDS15858.1 GeneID:26569 MGI:1347347
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0001676 - long-chain fatty acid metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fatty acid transport protein 4 product : solute carrier family 27 (fatty acid transporter), member 4 protein_id : NP_036119.1

name	Urm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311875 CCDS:CCDS15859.1 GeneID:68205 MGI:1915455
definition	codon_start : 1 product : ubiquitin related modifier 1 homolog protein_id : NP_080891.1

name	LOC100041002 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249262 GeneID:100041002
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477304.1

name	Ceecam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46411176 CCDS:CCDS15860.1 GeneID:99151 MGI:2139134
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007155 - cell adhesion [Evidence ISS] codon_start : 1 product : cerebral endothelial cell adhesion molecule 1 protein_id : NP_997181.1

name	Odf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305339 CCDS:CCDS15861.1 GeneID:18286 MGI:1098824
definition	GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence TAS] codon_start : 1 note : cenexin product : outer dense fiber of sperm tails 2 protein_id : NP_038643.1

name	Gle1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037369 CCDS:CCDS15862.1 GeneID:74412 MGI:1921662
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0016973 - poly(A)+ mRNA export from nucleus [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : GLE1 RNA export mediator-like (yeast protein_id : NP_083199.1

name	LOC665532 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94366330 GeneID:665532
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982692.1

name	Spna2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115496850 GeneID:20740 MGI:98386
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA] codon_start : 1 note : alpha-spectrin 2, brain; alpha-fodrin product : spectrin alpha 2 protein_id : NP_001070022.1

name	Wdr34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948827 CCDS:CCDS15865.1 GeneID:71820 MGI:1919070
definition	codon_start : 1 product : WD repeat domain 34 protein_id : NP_001008498.2

name	Set (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13591862 CCDS:CCDS15866.1 GeneID:56086 MGI:1860267
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] codon_start : 1 product : SET translocation protein_id : NP_076360.1

name	Pkn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418929 CCDS:CCDS15867.1 GeneID:263803 MGI:2388285
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein kinase N3 protein_id : NP_722500.1

name	Zdhhc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649751 CCDS:CCDS15868.1 GeneID:66220 MGI:1913470
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; zinc finger DHHC domain containing 12 product : zinc finger, DHHC domain containing 12 isoform b protein_id : NP_001032851.1

name	Zdhhc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649755 CCDS:CCDS15869.1 GeneID:66220 MGI:1913470
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; zinc finger DHHC domain containing 12 product : zinc finger, DHHC domain containing 12 isoform a protein_id : NP_079704.2

name	Zer1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542271 CCDS:CCDS15870.1 GeneID:227693 MGI:2442511
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : zyg-11 homolog B (C. elegans)-like protein_id : NP_848809.2

name	LOC100041114 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249268 GeneID:100041114
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477572.1

name	Tbc1d13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122839 CCDS:CCDS15871.1 GeneID:70296 MGI:2385326
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : TBC1 domain family member 13 product : TBC1 domain family, member 13 protein_id : NP_666364.1

name	Endog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679647 CCDS:CCDS15872.1 GeneID:13804 MGI:1261433
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : endonuclease G protein_id : NP_031957.1

name	D2Wsu81e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369948 CCDS:CCDS15873.1 GeneID:227695 MGI:106544
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC227695 protein_id : NP_766248.1

name	Ccbl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982063 CCDS:CCDS15874.1 GeneID:70266 MGI:1917516
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0047804 - cysteine-S-conjugate beta-lyase activity [Evidence IEA]; GO:0047316 - glutamine-phenylpyruvate transaminase activity [Evidence IEA]; GO:0016212 - kynurenine-oxoglutarate transaminase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] codon_start : 1 note : kynurenine aminotransferase I; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase) product : cysteine conjugate-beta lyase 1 protein_id : NP_765992.2

name	1700084E18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366332 GeneID:67350 MGI:1914600
definition	codon_start : 1 product : hypothetical protein LOC67350 protein_id : XP_983036.1

name	Lrrc8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244192 CCDS:CCDS15875.1 GeneID:241296 MGI:2652847
definition	codon_start : 1 product : leucine-rich repeat-containing 8 protein_id : NP_808393.1

name	Phyhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986561 CCDS:CCDS15876.1 GeneID:227696 MGI:3612860
definition	codon_start : 1 product : phytanoyl-CoA dioxygenase domain containing 1 protein_id : NP_758471.1

name	Dolk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244058 CCDS:CCDS15877.1 GeneID:227697 MGI:2677836
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004605 - phosphatidate cytidylyltransferase activity [Evidence IEA] GO_process : GO:0008654 - phospholipid biosynthesis [Evidence IEA] codon_start : 1 product : transmembrane protein 15 protein_id : NP_808316.1

name	Nup188 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38678526 CCDS:CCDS15878.1 GeneID:227699 MGI:2446190
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA] codon_start : 1 product : nucleoporin 188 protein_id : NP_938046.2

name	Sh3glb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314838 CCDS:CCDS15879.1 GeneID:227700 MGI:2385131
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : SH3-containing protein SH3GLB2 product : SH3-domain GRB2-like endophilin B2 protein_id : NP_647463.1

name	5730472N09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425102 CCDS:CCDS15880.1 GeneID:108958 MGI:1922035
definition	codon_start : 1 note : mFLJ00199 protein product : hypothetical protein LOC108958 protein_id : NP_780601.1

name	Dolpp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9966770 CCDS:CCDS15881.1 GeneID:57170 MGI:1914093
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047874 - dolichyldiphosphatase activity [Evidence IDA] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006487 - protein amino acid N-linked glycosylation [Evidence IDA] codon_start : 1 function : expression of this gene product inhibits the growth of E. coli product : dolichyl pyrophosphate phosphatase 1 protein_id : NP_065062.1

name	Crat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662408 CCDS:CCDS15882.1 GeneID:12908 MGI:109501
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004092 - carnitine O-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : carnitine acetyltransferase protein_id : NP_031786.2

name	Ppp2r4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981677 CCDS:CCDS15883.1 GeneID:110854 MGI:1346006
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence ISS]; GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0008601 - protein phosphatase type 2A regulator activity [Evidence ISS] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence ISS] codon_start : 1 exception : mismatches in translation product : protein phosphatase 2A, regulatory subunit B (PR 53) protein_id : NP_620087.2

name	Ier5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508420 GeneID:72500 MGI:1919750
definition	codon_start : 1 product : immediate early response 5-like protein_id : NP_084520.3

name	Cstad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469017 CCDS:CCDS15884.1 GeneID:78617 MGI:1925867
definition	GO_component : GO:0005741 - mitochondrial outer membrane [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007006 - mitochondrial membrane organization and biogenesis [Evidence IDA] codon_start : 1 note : CSA-conditional T cell activation-dependent protein product : CSA-conditional, T cell activation-dependent protein protein_id : NP_084413.1

name	EG665645 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366336 GeneID:665645 MGI:3644459
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983514.1

name	1700001O22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574090 CCDS:CCDS15885.1 GeneID:73598 MGI:1923631
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73598 protein_id : NP_932117.1

name	2610205E22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24528555 CCDS:CCDS15886.1 GeneID:66617 MGI:1913867
definition	codon_start : 1 product : hypothetical protein LOC66617 protein_id : NP_733480.1

name	Asb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111154 GeneID:72323 MGI:1919573
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : ankyrin repeat and SOCS box-containing protein 6 protein_id : NP_579924.1

name	Prrx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677841 CCDS:CCDS15888.1 GeneID:20204 MGI:98218
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : surface antigen, homeo box of paired rule product : paired related homeobox 2 protein_id : NP_033142.1

name	Ptges (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967941 CCDS:CCDS15889.1 GeneID:64292 MGI:1927593
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0005641 - nuclear envelope lumen [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0004667 - prostaglandin-D synthase activity [Evidence TAS]; GO:0050220 - prostaglandin-E synthase activity [Evidence IEA] GO_process : GO:0006693 - prostaglandin metabolism [Evidence IDA] codon_start : 1 product : prostaglandin E synthase protein_id : NP_071860.1

name	Tor1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559990 CCDS:CCDS15890.1 GeneID:30934 MGI:1353605
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : torsin family 1, member B protein_id : NP_598434.2

name	Tor1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450255 CCDS:CCDS15891.1 GeneID:30931 MGI:1353568
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : dystonia 1 product : torsin A protein_id : NP_659133.1

name	BC005624 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450249 CCDS:CCDS15892.1 GeneID:227707 MGI:2385132
definition	codon_start : 1 product : cDNA sequence BC005624 protein_id : NP_659134.1

name	Usp20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794162 CCDS:CCDS15893.1 GeneID:74270 MGI:1921520
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ubiquitin specific protease 20 protein_id : NP_083122.1

name	Fnbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662770 GeneID:14269 MGI:109606
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; formin binding protein 17 product : formin binding protein 1 isoform a protein_id : NP_001033789.1

name	Fnbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956088 CCDS:CCDS15894.1 GeneID:14269 MGI:109606
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; formin binding protein 17 product : formin binding protein 1 isoform b protein_id : NP_062279.1

name	LOC100039666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039666
definition	number : 1 pseudo : _no_value

clone name	MSMg01-392A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-266H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-358B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-180B24.b	B6Ng01-180B24.g
ACC	GA006647	GA006648
length	1,131	923
definition	B6Ng01-180B24.b	B6Ng01-180B24.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(29,938,024 - 29,939,140)	(29,786,376 - 29,787,292)
sequence	gaattcactgtttcagctagacttggctggccagcgagtctggagaaccc atgtctctgtacggccagccatgaacttagagacacaccaagccacacat ggtttttacacagatcctggggatttgaactcaggtcctcatgcttccac agtaaacactttacccactgagccatcaccccaacccaaaatgtcagtcc taaagatcccctgttagaggtcaggggtcagtaggaacctgggcaaagag ccgcccctgaggcaccagactgagagaaagctggtgacaggcattgtcca ggaagtcctcaagcttcagaaacgccacaccacacaactgtcgccagtcc cgccagtgaaccccaatctccagctcgcgagcctatgtggaaaagatcag gctcagccctcacctgagtgcccccccccgtaccccacagctaaccctaa ccacacaaaggccagcctactcggtccaaggagatgataaaactctggtc ccaggatttctcagccaccagtccccatcctgtctggcccacaacacgat tgtcaaccttcaacacagccagtacctcacctgtagtgccagggcttgga tttagggcatggccagagcagggggcctcaccacctcccatggtttctcc ctactcactggccagttcgcctccaccacgctgctgccgggaccttgttc ggagccagctttcagaagggctacctgccaggacagccatgggagaccgt ccaggcacagctaccagcagatctttgcagcccaggaggcgaacctgcag tgtccctggttgggagtcaagagagccctctgtcagcagccaccaccaat ggaaccccagagggacaccacctgctctaggagggtcagagctaggagca gccgatctaaaccctacctaccacacttagttacccacccagcatcctta gcagcccgggctagctcctcctttcctggagtgccctatgcagtgggcaa gaacaccagtcagggaatgtagaacaggacttctcccaagctttgtaagt cacaagatgagggaacctgctaccttggagctcagggtctggtggcacca tgggtcttcaagttgtcacaaggggcaggca	gaattctctaatcctcacagccgtgcatttgccacattaggtaccagatt ttgaaatccctggaactttacatacagagtctgcttcctttcctcaggga atgtttggacggactgttccatgcagactccttccagccctcctctttcc aggcatctctctcttggggttttttgagctaaagttgcaggaatccttct ccactgaatgcctacattgccttttctttcctttttatttatttattttt tattttatttttttaataaaaatagaactttatttgtatcaagaaatagt gaaaacaggtaaattagtatctgaggtaaattagtcagggctcatggaga tgagatgttcacggctcccttgctcctgtggaatctgtagctacgaatgt catgaaaataaatacattgtttgcgtccctcattacatagcaactggcat agtcccagctacagcaggtgtgttcacaatgaactgtttggacacagacc taacagtggcaagtgtgcttgtaaccatgtggtctggtttcacagttctg ggaactgcaactcccagcctcttactccaggaacaatacccaacggtgtc atccttgcgcaggggccatggtgatctgtattgttccagctgtagtggat gctctgctgaaggggagtcagcttttctcctcctggtgggtcctgcagga agcagtgtttctccttggtgcccggggaaacctccccatgtctgttttcc tataggccacttgtttcctcacgaccatccggcctgacaatcagaattcc tatctcatttgcttgtcagtttccctttgatctctgggaattcctttatt tttagaaatttttgtgggtttacgggaaataagtttggaccacctatgtc cgactccctttgatttcccctat
quality values	Open. Hide. 58 36 35 26 58 35 35 42 58 62 62 62 62 31 19 62 62 54 54 62 47 51 62 62 62 54 62 62 62 54 14 24 18 13 27 13 22 18 25 18 18 28 28 36 24 43 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 59 59 62 59 54 54 54 48 40 35 23 33 34 36 45 36 32 28 28 28 31 32 56 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 45 59 49 46 56 59 56 43 46 56 56 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 56 56 56 56 56 56 56 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 56 62 47 56 62 62 62 49 54 47 47 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 54 54 62 62 62 62 62 62 52 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 58 54 58 58 49 58 54 54 54 54 58 52 54 54 58 58 58 58 52 58 58 58 58 58 58 52 54 54 54 54 54 52 46 42 46 58 49 52 54 54 54 52 52 52 54 54 58 58 58 48 41 58 40 48 54 48 54 58 54 58 48 49 58 49 37 58 42 40 49 58 58 37 51 54 51 50 34 38 40 46 46 41 51 58 32 49 51 58 46 35 58 51 53 53 49 58 47 39 58 58 50 58 48 51 51 51 58 51 58 54 52 51 51 58 58 51 52 41 58 53 53 58 50 58 51 40 48 50 51 54 47 41 53 53 58 51 52 47 50 38 28 35 52 50 49 37 37 54 51 50 50 58 53 58 49 28 21 25 41 50 53 32 58 39 52 49 54 24 50 31 26 50 44 54 49 21 32 39 26 54 38 24 54 40 38 51 41 35 46 47 54 50 45 37 35 30 32 33 45 34 32 49 38 42 46 49 44 51 32 53 25 40 33 37 37 39 38 32 53 42 37 52 42 52 37 39 31 47 34 36 32 42 53 16 47 32 32 41 53 39 32 42 37 34 33 47 32 41 20 37 35 6 46 32 21 53 19 9 18 32 31 35 35 35 31 53 33 32 32 32 32 35 20 21 34 26 49 32 27 15 42 31 30 51 31 51 18 41 31 26 40 30 35 30 29 37 34 31 31 15 33 28 21 28 45 28 32 25 25 30 30 18 21 31 34 34 14 41 11 32 26 33 28 21 46 26 46 31 27 19 15 8 24 25 31 30 31 31 24 22 29 31 32 31 26 33 21 46 33 12 25 23 8 46 10 32 42 19 31 12 41 22 38 27 10 21 21 16 32 32 31 38 10 41 31 29 28 27 15 19 6 30 31 30 21 16 27 31 25 39 35 32 36 33 38 26 24 18 44 14 9 21 21 31 17 17 20 31 34 27 44 12 9 8 8 9 22 33 29 42 37 14 33 24 18 20 32 33 9 8 13 10 22 8 25 8 43 22 16 29 9 21 11 32 10 14 23 12 34 10 14 20 15 18 21 11 18 22 29 48 16 10 7 6 7 24 33 19 7 5 10 8 12 15 6 7 5 31 9 13 14 23 30 14 17 6 31 29 13 7 15 18 6 6 25 18 24 28 24 29 21 17 10 23 18 24 40 20 8 9 23 27 11 7 25 12 7 5 5 20 4 5 20 27 25 40 9 29 25 5 7 21 12 18 28 20 9 8 7 9 6 8 10 5 25 22 10 10 11 27 17 5 11 15 15 14 3 8 20 4 9 11 23 18 16 19 22 17 8 5 7 14 7 14 8 13 16 5 9 4 4 6 6 6 7 16 16 17 14 4 11 21 13 5 12	Open. Hide. 62 47 51 44 62 62 62 62 59 62 62 30 30 29 23 24 23 23 23 23 23 28 25 21 48 49 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 48 48 38 33 32 33 56 46 34 32 40 50 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 54 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 54 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 50 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 50 39 54 56 56 56 56 56 56 56 51 56 62 47 56 56 56 62 62 62 56 62 62 62 62 62 62 56 62 56 62 56 62 62 62 47 47 38 41 56 62 62 62 62 52 52 52 52 52 47 43 62 62 62 62 62 52 62 62 52 62 62 39 35 46 43 52 50 52 43 47 38 47 52 52 54 54 46 54 46 54 48 42 52 46 40 54 41 40 58 54 52 54 52 52 47 52 54 58 47 52 32 52 34 32 33 50 49 48 48 37 54 46 42 52 54 42 58 54 52 50 52 52 54 54 52 47 54 42 42 49 58 58 27 40 34 58 46 24 46 35 37 35 19 47 58 51 50 52 47 37 58 44 29 26 51 47 41 52 51 58 47 54 48 58 12 10 39 31 30 46 18 27 50 46 42 50 33 58 58 39 53 52 30 53 53 39 26 26 32 17 7 10 17 30 19 19 20 24 42 18 32 21 29 41 37 32 31 37 17 25 50 26 50 7 14 18 15 16 17 14 15 16 11 22 18 23 26 21 35 24 35 41 44 9 24 31 17 6 19 21 11 20 28 49 32 37 32 18 7 44 54 8 16 38 26 21 40 19 17 33 18 21 29 19 29 32 37 28 44 11 19 37 46 34 45 23 18 35 8 39 30 52 33 31 37 47 13 35 26 41 13 19 12 25 9 6 23 16 25 18 14 9 14 27 23 28 25 24 24 31 31 33 45 23 22 6 11 22 26 12 31 27 18 18 22 18 9 7 11 12 16 23 13 11 10 21 30 40 26 23 31 18 13 20 8 26 15 33 18 45 25 29 28 24 23 17 31 18 25 14 13 15 13 16 21 8 20 30 13 17 9 11 16 9 6 10 31 9 12 31 21 24 9 13 21 9 20 25 21 22 12 7 15 9 24 15 13 15 12 10 8 12 9 5 10 5 9 8 8 6 18 8 16 21 6 9 16 28 18 27 13 12 13 6 6 6 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_29938024_29939140
seq2: B6Ng01-180B24.b_47_1177 (reverse)

seq1  TGCCTGCCCC-TGTG--CACTTG-AGA-CCATGGTGCCCACCAGACCCTG  45
      |||||||||| ||||   ||||| ||| |||||||| |||||||||||||
seq2  TGCCTGCCCCTTGTGACAACTTGAAGACCCATGGTG-CCACCAGACCCTG  49

seq1  AGCT-CAAGGTAGCAGTTTCCCTCATCCTGTGGCTTTACAAAGCTTGGGA  94
      |||| ||||||||||| |||||||||| |||| | |||||||||||||||
seq2  AGCTCCAAGGTAGCAGGTTCCCTCATCTTGTGAC-TTACAAAGCTTGGGA  98

seq1  GAAGTCCTGTTCTTACATT-CCTG-CT-GTGTTCT--GCCACTGCATA-G  138
      |||||||||||| |||||| |||| || |||||||   |||||||||| |
seq2  GAAGTCCTGTTC-TACATTCCCTGACTGGTGTTCTTGCCCACTGCATAGG  147

seq1  GCACT-CAGG-AAGGA-GAGCTAG-CCGGGCTGCTAAGGATGCTGGGT-G  183
      ||||| |||| ||||| ||||||| ||||||||||||||||||||||| |
seq2  GCACTCCAGGAAAGGAGGAGCTAGCCCGGGCTGCTAAGGATGCTGGGTGG  197

seq1  GTAACTAAGTGTGGTAGGTAGGGTTTAGATCGGCTGCTCCTAGCTCTGAC  233
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAACTAAGTGTGGTAGGTAGGGTTTAGATCGGCTGCTCCTAGCTCTGAC  247

seq1  CCTCCTAGAGCAGGTGGTGTCCCTCTGGGGTTCCATTGGTGGTGGCTGCT  283
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTAGAGCAGGTGGTGTCCCTCTGGGGTTCCATTGGTGGTGGCTGCT  297

seq1  GACAGAGGGCTCTCTTGACTCCCAACCAGGGACACTGCAGGTTCGCCTCC  333
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGAGGGCTCTCTTGACTCCCAACCAGGGACACTGCAGGTTCGCCTCC  347

seq1  TGGGCTGCAAAGATCTGCTGGTAGCTGTGCCTGGACGGTCTCCCATGGCT  383
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCTGCAAAGATCTGCTGGTAGCTGTGCCTGGACGGTCTCCCATGGCT  397

seq1  GTCCTGGCAGGTAGCCCTTCTGAAAGCTGGCTCCGAACAAGGTCCCGGCA  433
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTGGCAGGTAGCCCTTCTGAAAGCTGGCTCCGAACAAGGTCCCGGCA  447

seq1  GCAGCGTGGTGGAGGCGAACTGGCCAGTGAGTAGGGAGAAACCATGGGAG  483
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCGTGGTGGAGGCGAACTGGCCAGTGAGTAGGGAGAAACCATGGGAG  497

seq1  GTGGTGAGGCCCCCTGCTCTGGCCATGCCCTAAATCCAAGCCCTGGCACT  533
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTGAGGCCCCCTGCTCTGGCCATGCCCTAAATCCAAGCCCTGGCACT  547

seq1  ACAGGTGAGGTACTGGCTGTGTTGAAGGTTGACAATCGTGTTGTGGGCCA  583
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGTGAGGTACTGGCTGTGTTGAAGGTTGACAATCGTGTTGTGGGCCA  597

seq1  GACAGGATGGGGACTGGTGGCTGAGAAATCCTGGGACCAGAGTTTTATCA  633
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGGATGGGGACTGGTGGCTGAGAAATCCTGGGACCAGAGTTTTATCA  647

seq1  TCTCCTTGGACCGAGTAGGCTGGCCTTTGTGTGGTTAGGGTTAGCTGTGG  683
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCTTGGACCGAGTAGGCTGGCCTTTGTGTGGTTAGGGTTAGCTGTGG  697

seq1  GGTACGGGGGGGGGCACTCAGGTGAGGGCTGAGCCTGATCTTTTCCACAT  733
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTACGGGGGGGGGCACTCAGGTGAGGGCTGAGCCTGATCTTTTCCACAT  747

seq1  AGGCTCGCGAGCTGGAGATTGGGGTTCACTGGCGGGACTGGCGACAGTTG  783
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTCGCGAGCTGGAGATTGGGGTTCACTGGCGGGACTGGCGACAGTTG  797

seq1  TGTGGTGTGGCGTTTCTGAAGCTTGAGGACTTCCTGGACAATGCCTGTCA  833
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGTGTGGCGTTTCTGAAGCTTGAGGACTTCCTGGACAATGCCTGTCA  847

seq1  CCAGCTTTCTCTCAGTCTGGTGCCTCAGGGGCGGCTCTTTGCCCAGGTTC  883
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCTTTCTCTCAGTCTGGTGCCTCAGGGGCGGCTCTTTGCCCAGGTTC  897

seq1  CTACTGACCCCTGACCTCTAACAGGGGATCTTTAGGACTGACATTTTGGG  933
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTGACCCCTGACCTCTAACAGGGGATCTTTAGGACTGACATTTTGGG  947

seq1  TTGGGGTGATGGCTCAGTGGGTAAAGTGTTTACTGTGGAAGCATGAGGAC  983
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGGTGATGGCTCAGTGGGTAAAGTGTTTACTGTGGAAGCATGAGGAC  997

seq1  CTGAGTTCAAATCCCCAGGATCTGTGTAAAAACCATGTGTGGCTTGGTGT  1033
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGTTCAAATCCCCAGGATCTGTGTAAAAACCATGTGTGGCTTGGTGT  1047

seq1  GTCTCTAAGTTCATGGCTGGCCGTACAGAGACATGGGTTCTCCAGACTCG  1083
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTCTAAGTTCATGGCTGGCCGTACAGAGACATGGGTTCTCCAGACTCG  1097

seq1  CTGGCCAGCCAAGTCTAGCTGAAACAGTGAATTC  1117
      ||||||||||||||||||||||||||||||||||
seq2  CTGGCCAGCCAAGTCTAGCTGAAACAGTGAATTC  1131

seq1: chr2_29786376_29787292
seq2: B6Ng01-180B24.g_69_991

seq1  GAATTCTCTAATCCTCACAGCCGTGCATTTGCCACATTAGGTACCAGATT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTAATCCTCACAGCCGTGCATTTGCCACATTAGGTACCAGATT  50

seq1  TTGAAATCCCTGGAACTTTACATACAGAGTCTGCTTCCTTTCCTCAGGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAATCCCTGGAACTTTACATACAGAGTCTGCTTCCTTTCCTCAGGGA  100

seq1  ATGTTTGGACGGACTGTTCCATGCAGACTCCTTCCAGCCCTCCTCTTTCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTTGGACGGACTGTTCCATGCAGACTCCTTCCAGCCCTCCTCTTTCC  150

seq1  AGGCATCTCTCTCTTGGGGTTTTTTGAGCTAAAGTTGCAGGAATCCTTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCATCTCTCTCTTGGGGTTTTTTGAGCTAAAGTTGCAGGAATCCTTCT  200

seq1  CCACTGAATGCCTACATTGCCTTTTCTTTCCTTTTTATTTATTTATTTTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACTGAATGCCTACATTGCCTTTTCTTTCCTTTTTATTTATTTATTTTT  250

seq1  TATTTTATTTTTTTAATAAAAATAGAACTTTATTTGTATCAAGAAATAGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTATTTTTTTAATAAAAATAGAACTTTATTTGTATCAAGAAATAGT  300

seq1  GAAAACAGGTAAATTAGTATCTGAGGTAAATTAGTCAGGGCTCATGGAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAACAGGTAAATTAGTATCTGAGGTAAATTAGTCAGGGCTCATGGAGA  350

seq1  TGAGATGTTCACGGCTCCCTTGCTCCTGTGGAATCTGTAGCTACGAATGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGATGTTCACGGCTCCCTTGCTCCTGTGGAATCTGTAGCTACGAATGT  400

seq1  CATGAAAATAAATACATTGTTTGCGTCCCTCATTACATAGCAACTGGCAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGAAAATAAATACATTGTTTGCGTCCCTCATTACATAGCAACTGGCAT  450

seq1  AGTCCCAGCTACAGCAGGTGTGTTCACAATGAACTGTTTGGACACAGACC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCCAGCTACAGCAGGTGTGTTCACAATGAACTGTTTGGACACAGACC  500

seq1  TAACAGTGGCAAGTGTGCTTGTAACCATGTGGTCTGGTTTCACAGTTCTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACAGTGGCAAGTGTGCTTGTAACCATGTGGTCTGGTTTCACAGTTCTG  550

seq1  GGAACTGCAACTCCCAGCCTCTTACTCCAGGAACAATACCCAACGGTGTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAACTGCAACTCCCAGCCTCTTACTCCAGGAACAATACCCAACGGTGTC  600

seq1  ATCCTTGCGCAGGGGCCATGGTGATCTGTATTGTTCCAGCTGTAGTGGAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTTGCGCAGGGGCCATGGTGATCTGTATTGTTCCAGCTGTAGTGGAT  650

seq1  GCTCTGCTGAAGGGGAGTCAGCTTTTCTCCTCCTGGTGGGTCCTGCAGGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTGCTGAAGGGGAGTCAGCTTTTCTCCTCCTGGTGGGTCCTGCAGGA  700

seq1  AGCAGTG-TTCTCCTTGGTGCCCGGGGAAACCT-CCCATGTCTG-TTTCC  747
      ||||||| ||||||||||||||||||||||||| |||||||||| |||||
seq2  AGCAGTGTTTCTCCTTGGTGCCCGGGGAAACCTCCCCATGTCTGTTTTCC  750

seq1  TATAGGCCACTTG-TTCCTCACGACCATCCGGCCTGACAATCAGAATTCC  796
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  TATAGGCCACTTGTTTCCTCACGACCATCCGGCCTGACAATCAGAATTCC  800

seq1  TATCTCA-TTGCTTGTCAG-TTCTCTTTGTATCTCTGGG-ATTCCTTTAT  843
      ||||||| ||||||||||| ||| ||||| ||||||||| ||||||||||
seq2  TATCTCATTTGCTTGTCAGTTTCCCTTTG-ATCTCTGGGAATTCCTTTAT  849

seq1  TTTT-GAAATTTTTGTGTGGTTTTACAGGAAATAAAGTTTGTATCA-CTA  891
      |||| ||||||||  ||||| ||||| |||||| ||||||| | || |||
seq2  TTTTAGAAATTTT--TGTGGGTTTACGGGAAAT-AAGTTTGGACCACCTA  896

seq1  TGTCAGACT-CCTTTGATTTCCCTTAT  917
      |||| |||| ||||||||||||| |||
seq2  TGTCCGACTCCCTTTGATTTCCCCTAT  923

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information