MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-181H11
Chromosome	2 (Build37)
Map Location	120,500,488 - 120,615,930
singlet/doublet	doublet
Overlap gene	Stard9, Cdan1, Ttbk2
Upstream gene	LOC625328, Rtf1, Itpka, Ltk, Rpap1, Tyro3, 6330405D24Rik, LOC625403, Mga, Mapkbp1, Pla2g4b, Spnb5, Ehd4, Pla2g4e, LOC100043635, Pla2g4d, Pla2g4f, Vps39, Tmem87a, Ganc, Capn3, Zfp106, Snap23, Lrrc57, Cep27
Downstream gene	Ubr1, Tmem62, Rnu3b-ps2, Ccndbp1, Epb4.2, Tgm5, LOC640543, Lcmt2, Adal, Zscan29, D2Ertd435e, Trp53bp1, Mtap1a, Hisppd2a, Ckmt1, Strc, Catsper2, Pdia3, Ell3, Serf2, LOC574418, 2310003F16Rik, Mfap1b, Wdr76p, Mfap1a, Wdr76, Frmd5
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC625328 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625328
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 1433 ESTs, 27 Proteins

name	Rtf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76246 MGI:1309480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs, 5 Proteins

name	Itpka (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228550 MGI:1333822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17005 MGI:96840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Rpap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68925 MGI:1916175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tyro3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22174 MGI:104294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330405D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70715 MGI:1917965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs

name	LOC625403 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 7 Proteins pseudo : _no_value

name	Mga (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29808 MGI:1352483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapkbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26390 MGI:1347004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211429 MGI:2384819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spnb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640524 MGI:2685200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 22 Proteins

name	Ehd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98878 MGI:1919619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g4e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329502 MGI:1919144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043635 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Pla2g4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78390 MGI:1925640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g4f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271844 MGI:2685493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269338 MGI:2443189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmem87a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211499 MGI:2441844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ganc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76051 MGI:1923301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12335 MGI:107437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20402 MGI:1270153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snap23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20619 MGI:109356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc57 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66606 MGI:1913856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cep27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66296 MGI:1913546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stard9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668880 MGI:3045258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 46 ESTs, 4 Proteins

name	Cdan1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68968 MGI:1916218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttbk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140810 MGI:2155779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ubr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22222 MGI:1277977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem62 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:96957 MGI:2139461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu3b-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19853 MGI:97980
definition	note : U3B small nuclear RNA pseudogene 2 pseudo : _no_value

name	Ccndbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17151 MGI:109595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epb4.2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13828 MGI:95402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74176 MGI:1921426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC640543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	Lcmt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329504 MGI:1353659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 41 ESTs, 5 Proteins

name	Adal (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75894 MGI:1923144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zscan29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99334 MGI:2139317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 10 Proteins

name	D2Ertd435e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51885 MGI:1196293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trp53bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27223 MGI:1351320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtap1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17754 MGI:1306776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hisppd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327655 MGI:2443281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ckmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12716 MGI:99441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Strc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140476 MGI:2153816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Catsper2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212670 MGI:2387404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdia3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14827 MGI:95834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ell3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269344 MGI:2673679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378702 MGI:1337041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC574418 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:574418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310003F16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67693 MGI:1914943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfap1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100034361 MGI:3694697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr76p (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100008564
definition	note : WD repeat domain 76 pseudogene pseudo : _no_value

name	Mfap1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67532 MGI:1914782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr76 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241627 MGI:1926186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frmd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228564 MGI:2442557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250062 GeneID:76246 MGI:1309480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs, 5 Proteins product : Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) transcript_id : XM_283757.7

name	Itpka (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130226 GeneID:228550 MGI:1333822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,4,5-trisphosphate 3-kinase A transcript_id : NM_146125.2

name	Ltk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45935378 GeneID:17005 MGI:96840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte tyrosine kinase transcript_id : NM_206942.1

name	Ltk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45935372 GeneID:17005 MGI:96840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte tyrosine kinase transcript_id : NM_203345.1

name	Ltk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45935374 GeneID:17005 MGI:96840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte tyrosine kinase transcript_id : NM_008523.2

name	Ltk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45935376 GeneID:17005 MGI:96840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte tyrosine kinase transcript_id : NM_206941.1

name	Rpap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144445948 GeneID:68925 MGI:1916175
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase II associated protein 1 transcript_id : NM_177294.4

name	Tyro3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68989242 GeneID:22174 MGI:104294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TYRO3 protein tyrosine kinase 3 transcript_id : NM_019392.2

name	6330405D24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249970 GeneID:70715 MGI:1917965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs product : RIKEN cDNA 6330405D24 gene transcript_id : XM_917516.3

name	Mga (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444913 GeneID:29808 MGI:1352483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAX gene associated transcript_id : NM_013720.2

name	Mapkbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037374 GeneID:26390 MGI:1347004
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase binding protein 1 transcript_id : NM_011941.2

name	Pla2g4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249336 GeneID:211429 MGI:2384819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVB (cytosolic) transcript_id : NM_145378.2

name	Spnb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249972 GeneID:640524 MGI:2685200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 22 Proteins product : spectrin beta 5 transcript_id : XM_001481329.1

name	Ehd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803304 GeneID:98878 MGI:1919619
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EH-domain containing 4 transcript_id : NM_133838.3

name	Pla2g4e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861233 GeneID:329502 MGI:1919144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVE transcript_id : NM_177845.4

name	LOC100043635 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250067 GeneID:100043635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043635 transcript_id : XM_001480419.1

name	Pla2g4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906182 GeneID:78390 MGI:1925640
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVD transcript_id : NM_001024137.1

name	Pla2g4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972422 GeneID:271844 MGI:2685493
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVF transcript_id : NM_001024145.1

name	Vps39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892962 GeneID:269338 MGI:2443189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 39 (yeast) transcript_id : NM_178851.2

name	Vps39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30578430 GeneID:269338 MGI:2443189
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 39 (yeast) transcript_id : NM_147153.2

name	Tmem87a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343465 GeneID:211499 MGI:2441844
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 87A transcript_id : NM_173734.2

name	Ganc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487338 GeneID:76051 MGI:1923301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosidase, alpha; neutral C transcript_id : NM_172672.2

name	Capn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680843 GeneID:12335 MGI:107437
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 3 transcript_id : NM_007601.1

name	Zfp106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948268 GeneID:20402 MGI:1270153
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 106 transcript_id : NM_011743.2

name	Snap23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389019 GeneID:20619 MGI:109356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptosomal-associated protein 23 transcript_id : NM_009222.3

name	Lrrc57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981232 GeneID:66606 MGI:1913856
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 57 transcript_id : NM_025657.2

name	Cep27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68299778 GeneID:66296 MGI:1913546
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrosomal protein 27 transcript_id : NM_025475.2

name	Stard9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249974 GeneID:668880 MGI:3045258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 46 ESTs, 4 Proteins product : START domain containing 9 transcript_id : XM_001004201.2

name	Cdan1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430552 GeneID:68968 MGI:1916218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : congenital dyserythropoietic anemia, type I (human) transcript_id : NM_026891.2

name	Ttbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326518 GeneID:140810 MGI:2155779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tau tubulin kinase 2 transcript_id : NM_080788.3

name	Ttbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326517 GeneID:140810 MGI:2155779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tau tubulin kinase 2 transcript_id : NM_001024857.2

name	Ttbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326516 GeneID:140810 MGI:2155779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tau tubulin kinase 2 transcript_id : NM_001024856.2

name	Ubr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678490 GeneID:22222 MGI:1277977
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin protein ligase E3 component n-recognin 1 transcript_id : NM_009461.1

name	Tmem62 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271525 GeneID:96957 MGI:2139461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 62 transcript_id : NM_175285.3

name	Ccndbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955252 GeneID:17151 MGI:109595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D-type binding-protein 1 transcript_id : NM_010761.2

name	Epb4.2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129920 GeneID:13828 MGI:95402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythrocyte protein band 4.2 transcript_id : NM_013513.2

name	Tgm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368844 GeneID:74176 MGI:1921426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transglutaminase 5 transcript_id : NM_028799.2

name	LOC640543 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249976 GeneID:640543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : similar to transglutaminase 7 transcript_id : XM_001479973.1

name	Lcmt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367205 GeneID:329504 MGI:1353659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 41 ESTs, 5 Proteins product : leucine carboxyl methyltransferase 2 transcript_id : XM_141327.6

name	Adal (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626055 GeneID:75894 MGI:1923144
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase-like transcript_id : NM_029475.1

name	Zscan29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250076 GeneID:99334 MGI:2139317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 10 Proteins product : zinc finger SCAN domains 29 transcript_id : XM_001480554.1

name	D2Ertd435e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130151 GeneID:51885 MGI:1196293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 2, ERATO Doi 435, expressed transcript_id : NM_153387.2

name	Trp53bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34852026 GeneID:27223 MGI:1351320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 binding protein 1 transcript_id : NM_013735.2

name	Mtap1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244032 GeneID:17754 MGI:1306776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 1 A transcript_id : NM_032393.1

name	Hisppd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328430 GeneID:327655 MGI:2443281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histidine acid phosphatase domain containing 2A transcript_id : NM_178795.3

name	Ckmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129846 GeneID:12716 MGI:99441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : creatine kinase, mitochondrial 1, ubiquitous transcript_id : NM_009897.2

name	Strc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120300984 GeneID:140476 MGI:2153816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stereocilin transcript_id : NM_080459.2

name	Catsper2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001553 GeneID:212670 MGI:2387404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cation channel, sperm associated 2 transcript_id : NM_153075.2

name	Pdia3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112293263 GeneID:14827 MGI:95834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein disulfide isomerase associated 3 transcript_id : NM_007952.2

name	Ell3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:35901197 GeneID:269344 MGI:2673679
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation factor RNA polymerase II-like 3 transcript_id : NM_145973.2

name	Serf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875510 GeneID:378702 MGI:1337041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small EDRK-rich factor 2 transcript_id : NM_011354.2

name	LOC574418 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:70778957 GeneID:574418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC574418 transcript_id : NM_001025371.1

name	2310003F16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388228 GeneID:67693 MGI:1914943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310003F16 gene transcript_id : NM_026318.2

name	Mfap1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802334 GeneID:100034361 MGI:3694697
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microfibrillar-associated protein 1B transcript_id : NM_001081975.2

name	Mfap1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802646 GeneID:67532 MGI:1914782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microfibrillar-associated protein 1A transcript_id : NM_026220.4

name	Wdr76 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487320 GeneID:241627 MGI:1926186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 76 transcript_id : NM_030234.2

name	Frmd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115298679 GeneID:228564 MGI:2442557
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FERM domain containing 5 transcript_id : NM_172673.3

name	Rtf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250063 GeneID:76246 MGI:1309480
definition	codon_start : 1 product : Rtf1, Paf1/RNA polymerase II complex component, homolog protein_id : XP_283757.6

name	Itpka (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122643 CCDS:CCDS16607.1 GeneID:228550 MGI:1333822
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0004428 - inositol or phosphatidylinositol kinase activity [Evidence TAS]; GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006020 - myo-inositol metabolism [Evidence IMP] codon_start : 1 note : IP3-kinase A product : inositol 1,4,5-trisphosphate 3-kinase A protein_id : NP_666237.1

name	Ltk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45935379 CCDS:CCDS16609.1 GeneID:17005 MGI:96840
definition	EC_number : 2.7.10.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform C is encoded by transcript variant 3; leukocyte tyrosine kinase receptor product : leukocyte tyrosine kinase isoform C protein_id : NP_996825.1

name	Ltk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45935373 CCDS:CCDS16608.1 GeneID:17005 MGI:96840
definition	EC_number : 2.7.10.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform D is encoded by transcript variant 4; leukocyte tyrosine kinase receptor product : leukocyte tyrosine kinase isoform D protein_id : NP_976220.1

name	Ltk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45935375 GeneID:17005 MGI:96840
definition	EC_number : 2.7.10.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : isoform A is encoded by transcript variant 1; leukocyte tyrosine kinase receptor product : leukocyte tyrosine kinase isoform A protein_id : NP_032549.2 transl_except : (pos:complement(119584032..119584034),aa:Met)

name	Ltk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45935377 GeneID:17005 MGI:96840
definition	EC_number : 2.7.10.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : isoform B is encoded by transcript variant 2; leukocyte tyrosine kinase receptor product : leukocyte tyrosine kinase isoform B protein_id : NP_996824.1 transl_except : (pos:complement(119584032..119584034),aa:Met)

name	Rpap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537534 CCDS:CCDS16610.1 GeneID:68925 MGI:1916175
definition	GO_component : GO:0030880 - RNA polymerase complex [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : RNA polymerase II associated protein 1 protein_id : NP_796268.2

name	Tyro3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68989243 CCDS:CCDS16611.1 GeneID:22174 MGI:104294
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : TYRO3 protein tyrosine kinase 3 protein_id : NP_062265.2

name	6330405D24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249971 GeneID:70715 MGI:1917965
definition	codon_start : 1 product : hypothetical protein LOC70715 protein_id : XP_922609.3

name	Mga (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444914 GeneID:29808 MGI:1352483
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Max dimerization protein 5 product : MAX-interacting protein protein_id : NP_038748.2

name	Mapkbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037375 CCDS:CCDS16612.1 GeneID:26390 MGI:1347004
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007256 - activation of JNKK activity [Evidence IDA] codon_start : 1 exception : mismatches in translation note : JNK-binding protein 1; Jun N-terminal kinase-binding protein 1; Jun N-terminal kinase binding protein 1; mitogen activated protein kinase binding proten 1 product : mitogen activated protein kinase binding protein 1 protein_id : NP_036071.2

name	Pla2g4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249337 GeneID:211429 MGI:2384819
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IEA]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : cytosolic phospholipase A2 beta; phospholipase A2 group IVB (cytosolic) product : phospholipase A2, group IVB protein_id : NP_663353.2

name	Spnb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249973 GeneID:640524 MGI:2685200
definition	codon_start : 1 note : overriding stop codons product : similar to beta V spectrin protein_id : XP_001481379.1 transl_except : (pos:complement(119884630..119884632),aa:OTHER)

name	Ehd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981592 CCDS:CCDS16615.1 GeneID:98878 MGI:1919619
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : EH domain containing protein MPAST2 product : EH-domain containing 4 protein_id : NP_598599.2

name	Pla2g4e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63999319 CCDS:CCDS16616.1 GeneID:329502 MGI:1919144
definition	EC_number : 3.1.1.4 GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IDA]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : phospholipase A2 group IVE product : cytosolic phospholipase A2 epsilon protein_id : NP_808513.2

name	LOC100043635 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250068 GeneID:100043635
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480469.1

name	Pla2g4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906183 CCDS:CCDS16617.1 GeneID:78390 MGI:1925640
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IDA]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : phospholipase A2 group IVD product : cytosolic phospholipase A2 delta protein_id : NP_001019308.1

name	Pla2g4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972423 CCDS:CCDS16618.1 GeneID:271844 MGI:2685493
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IDA]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : phospholipase A2 group IVF product : cytosolic phospholipase A2 zeta protein_id : NP_001019316.1

name	Vps39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30578384 CCDS:CCDS16619.1 GeneID:269338 MGI:2443189
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Vam6/Vps39-like product : vacuolar protein sorting 39 isoform 2 protein_id : NP_849182.1

name	Vps39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164794 GeneID:269338 MGI:2443189
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Vam6/Vps39-like product : vacuolar protein sorting 39 isoform 1 protein_id : NP_671495.1

name	Tmem87a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424573 GeneID:211499 MGI:2441844
definition	codon_start : 1 product : hypothetical protein LOC211499 protein_id : NP_776095.1

name	Ganc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487339 GeneID:76051 MGI:1923301
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004558 - alpha-glucosidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0006006 - glucose metabolism [Evidence IC]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glucosidase, alpha; neutral C protein_id : NP_766260.2

name	Capn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680844 CCDS:CCDS16620.1 GeneID:12335 MGI:107437
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004198 - calpain activity [Evidence IDA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030239 - myofibril assembly [Evidence IMP]; GO:0006508 - proteolysis [Evidence IDA]; GO:0006938 - sarcomere alignment [Evidence IMP]; GO:0045214 - sarcomere organization [Evidence IMP] codon_start : 1 exception : mismatches in translation function : intracellular calcium-dependant cysteine proteinase note : skeletal muscle specific calpain p94 product : calpain 3 protein_id : NP_031627.1

name	Zfp106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109948269 CCDS:CCDS16621.1 GeneID:20402 MGI:1270153
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0001515 - opioid peptide activity [Evidence IPI]; GO:0017124 - SH3 domain binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SH3-domain binding protein 3 protein_id : NP_035873.2

name	Snap23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678049 CCDS:CCDS16622.1 GeneID:20619 MGI:109356
definition	GO_component : GO:0005792 - microsome [Evidence IDA]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : synaptosomal-associated protein, 23kD product : synaptosomal-associated protein 23 protein_id : NP_033248.1

name	Lrrc57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981233 CCDS:CCDS16623.1 GeneID:66606 MGI:1913856
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 57 protein_id : NP_079933.2

name	Cep27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539591 CCDS:CCDS16624.1 GeneID:66296 MGI:1913546
definition	codon_start : 1 product : centrosomal protein 27 protein_id : NP_079751.1

name	Stard9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249975 GeneID:668880 MGI:3045258
definition	codon_start : 1 product : START domain containing 9 protein_id : XP_001004201.2

name	Cdan1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430553 GeneID:68968 MGI:1916218
definition	GO_process : GO:0006998 - nuclear membrane organization and biogenesis [Evidence TAS] codon_start : 1 product : congenital dyserythropoietic anemia, type I protein_id : NP_081167.2

name	Ttbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906805 CCDS:CCDS16626.1 GeneID:140810 MGI:2155779
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : tau tubulin kinase 2 isoform 1 protein_id : NP_542966.2

name	Ttbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906807 CCDS:CCDS16627.1 GeneID:140810 MGI:2155779
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : tau tubulin kinase 2 isoform 2 protein_id : NP_001020027.1

name	Ttbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906809 CCDS:CCDS16627.1 GeneID:140810 MGI:2155779
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 3 product : tau tubulin kinase 2 isoform 2 protein_id : NP_001020028.1

name	Ubr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678491 CCDS:CCDS16628.1 GeneID:22222 MGI:1277977
definition	GO_component : GO:0000502 - proteasome complex (sensu Eukaryota) [Evidence IGI]; GO:0000151 - ubiquitin ligase complex [Evidence IGI] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IGI]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IGI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IGI]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IMP] [Evidence IDA] codon_start : 1 exception : mismatches in translation note : E3 alpha; ubiquitin-protein ligase e3 componen n-recognin product : ubiquitin protein ligase E3 component n-recognin 1 protein_id : NP_033487.1

name	Tmem62 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424948 CCDS:CCDS16629.1 GeneID:96957 MGI:2139461
definition	codon_start : 1 product : transmembrane protein 62 protein_id : NP_780494.1

name	Ccndbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955253 GeneID:17151 MGI:109595
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence TAS] codon_start : 1 note : maternal inhibition of differentiation; stage specific embryonic cDNA-8 product : cyclin D-type binding-protein 1 protein_id : NP_034891.2

name	Epb4.2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305035 CCDS:CCDS16631.1 GeneID:13828 MGI:95402
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0043249 - erythrocyte maturation [Evidence IEA]; GO:0018149 - peptide cross-linking [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 product : erythrocyte protein band 4.2 protein_id : NP_038541.1

name	Tgm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229194 CCDS:CCDS16632.1 GeneID:74176 MGI:1921426
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003810 - protein-glutamine gamma-glutamyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0018149 - peptide cross-linking [Evidence IEA] codon_start : 1 product : transglutaminase 5 protein_id : NP_083075.1

name	LOC640543 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249977 GeneID:640543
definition	codon_start : 1 product : similar to transglutaminase 7 protein_id : XP_001480023.1

name	Lcmt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82886834 GeneID:329504 MGI:1353659
definition	codon_start : 1 product : leucine carboxyl methyltransferase 2 protein_id : XP_141327.5

name	Adal (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626056 CCDS:CCDS16633.1 GeneID:75894 MGI:1923144
definition	GO_function : GO:0019239 - deaminase activity [Evidence IEA] GO_process : GO:0009168 - purine ribonucleoside monophosphate biosynthesis [Evidence IEA] codon_start : 1 product : adenosine deaminase-like protein_id : NP_083751.1

name	Zscan29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250077 GeneID:99334 MGI:2139317
definition	codon_start : 1 product : zinc finger protein 690 protein_id : XP_001480604.1

name	D2Ertd435e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943924 CCDS:CCDS16637.1 GeneID:51885 MGI:1196293
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005815 - microtubule organizing center [Evidence IEA]; GO:0000922 - spindle pole [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : gamma tubulin ring complex protein protein_id : NP_700436.1

name	Trp53bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34852027 GeneID:27223 MGI:1351320
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0000776 - kinetochore [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0003684 - damaged DNA binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0006281 - DNA repair [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : murine p53-binding protein; transformation related protein 53 binding-protein 1 product : transformation related protein 53 binding protein 1 protein_id : NP_038763.2

name	Mtap1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244033 GeneID:17754 MGI:1306776
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007605 - sensory perception of sound [Evidence IDA] codon_start : 1 note : modifier of tubby hearing 1 product : microtubule-associated protein 1 A protein_id : NP_115769.1

name	Hisppd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328431 CCDS:CCDS16639.1 GeneID:327655 MGI:2443281
definition	codon_start : 1 exception : mismatches in translation note : KIAA0377-like product : histidine acid phosphatase domain containing 2A protein_id : NP_848910.2

name	Ckmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753428 CCDS:CCDS16640.1 GeneID:12716 MGI:99441
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0004111 - creatine kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016772 - transferase activity, transferring phosphorus-containing groups [Evidence IEA] codon_start : 1 note : creatine kinase mitochondrial 1 ubiquitous product : creatine kinase, mitochondrial 1, ubiquitous protein_id : NP_034027.1

name	Strc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120300985 CCDS:CCDS16641.1 GeneID:140476 MGI:2153816
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007605 - sensory perception of sound [Evidence ISS] codon_start : 1 product : stereocilin protein_id : NP_536707.2

name	Catsper2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001554 GeneID:212670 MGI:2387404
definition	GO_component : GO:0019861 - flagellum [Evidence IDA] codon_start : 1 product : sperm-associated cation channel 2 protein_id : NP_694715.2

name	Pdia3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112293264 CCDS:CCDS16643.1 GeneID:14827 MGI:95834
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003756 - protein disulfide isomerase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0043065 - positive regulation of apoptosis [Evidence IMP] codon_start : 1 note : endoplasmic reticulum protein; glucose regulated protein, 58 kDa; phospholipase C, alpha product : protein disulfide isomerase associated 3 protein_id : NP_031978.2

name	Ell3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:35901198 CCDS:CCDS16644.1 GeneID:269344 MGI:2673679
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : elongation factor RNA polymerase II-like 3 protein_id : NP_666085.2

name	Serf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755472 CCDS:CCDS16645.1 GeneID:378702 MGI:1337041
definition	codon_start : 1 note : modifier of spinal muscular atrophy candidate 1-like; 4F5rel (4F5 related) product : small EDRK-rich factor 2 protein_id : NP_035484.1

name	LOC574418 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:70778958 CCDS:CCDS16646.1 GeneID:574418
definition	codon_start : 1 product : hypothetical protein LOC574418 protein_id : NP_001020542.1

name	2310003F16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229055 CCDS:CCDS16647.1 GeneID:67693 MGI:1914943
definition	codon_start : 1 product : Huntingtin interacting protein K protein_id : NP_080594.2

name	Mfap1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517472 GeneID:100034361 MGI:3694697
definition	codon_start : 1 product : microfibrillar-associated protein 1B protein_id : NP_001075444.1

name	Mfap1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385728 CCDS:CCDS16648.1 GeneID:67532 MGI:1914782
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] codon_start : 1 note : microfibrillar-associated protein 1 product : microfibrillar-associated protein 1A protein_id : NP_080496.1

name	Wdr76 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487321 GeneID:241627 MGI:1926186
definition	codon_start : 1 product : WD repeat domain 76 protein_id : NP_084510.2

name	Frmd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51036627 CCDS:CCDS16649.1 GeneID:228564 MGI:2442557
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] codon_start : 1 product : FERM domain containing 5 protein_id : NP_766261.2

name	LOC625403 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250066 GeneID:625403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 7 Proteins product : similar to keratinocyate lipid-binding protein pseudo : _no_value transcript_id : XR_034672.1

clone name	MSMg01-435D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533E23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-162C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548G19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-191L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353L16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-476M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092N10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-336O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070E01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-181H11.b	B6Ng01-181H11.g
ACC	GA007619	GA007620
length	909	922
definition	B6Ng01-181H11.b	B6Ng01-181H11.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(120,500,488 - 120,501,266)	(120,615,010 - 120,615,930)
sequence	gaattcaaaatcagtctgggctataacaagttcaaggccaccgggcaagt tggcacacacctttaatccagcatttaggagggagagacaggtggatctc tgtaaatttgagccctggtctacaaagctagtccaggacagccagggcta tacagagaaaccctgccccccaaaacaaacaaacaaacaaacaaacaaac aacaaaaaccaaattcaaggccagcctgggctaaggtctgtatctaaaca attaaaacagaaaaacaaaataatgagattgtagcctttgcttattatct caggacttgagaggcacagggaagaagttcagaaattcaaggtcagcctg ggctacatgaaattttgtttcaaggaaaccgaccccattgtggtgctgga ctttaattctagcacttgggaagctgaggcagaaaaattgcaagcttgat actattctgtgatagagagagtgagcagttaagtacttgagaaaaatgtt caacatcactagtaattaaagaaaaacaagttaaaacctacctttgacca tgaataatgttttgttattttttgtttgggtattttgagacagttccctg gctgtcctggaactcactctgtagaccaggctggccttgaatttagagat ctgcctgcctctgctcttgcttattgagtgctgggattaaaggcttgctc caccattgtatgactaccatggataaaattttaaagagtttttacattac atattgacaaggctagagttctataatcctgtactatatgtataaaatgg cacaactttagaaaagaccagtagtttctttaaacgttagataataccta atcatatgacccaggcaacttttcctcctaggtatctgtggtggttttgt atatgcttg	gaattcttatgtatgctgaacagatgaagtgcgtcatatcatctattttt aaaaatacaacttattagttgtcatttttgtatgtgtttaatcccagata gattgtgagttacagtacagcctcgcttatactccaagttcttccccttt tcatcttttctcccttgggctttcagatctccactcccactgtgttaaaa ttgttgcatagttgaaggagagggtgagcgttttctctgtctgtcagcat ggcatgctccatccccttgagatggaggagagatggactgaaagagtaga agctcagaaagagacgatgggagaatgagaaaacagctccgttgtccttg acactgcctgtctcctgaacacacacagcacggtcaccctcaaagtcaaa ccatggttcacctcactgcctaaactgtcggttctcagtttcctttcata ttcagaagactttattttgacatttggattctttattttccttcacagta cttatataccagtgagttaaaatcataaatccaggcttaaatgtttcctc ttctcttcagaaggctttcccagtgctcttcaatatttgacttagaccta aagatatgttaccctttcttaaaactatatttgttgttgttatttatctt ttaaaaacatggtctcactgagtagcacaaaatgcttttgatctcactaa atgtgcaagatttgccttaaactcaggtcctcctactttcgcctcctgat ttctaagatacagctgtgtgctaccatggctggcttggtcttatttaaaa ttaattaattgggtgttggaagaatgtatcatggtgtgtgtggacttcag aagcaacttgtggagttgggtctctcctttgtaccatgtaggtcctaggg attaaacttgggtgttcggact
quality values	Open. Hide. 58 26 33 26 58 28 15 48 58 48 45 39 28 45 62 62 62 62 62 62 62 47 56 62 62 62 47 51 49 62 62 62 47 51 42 50 49 51 47 38 43 38 28 49 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 59 59 62 62 62 62 62 54 54 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 53 62 62 62 62 44 62 62 42 62 62 62 62 62 62 49 39 62 62 62 62 62 62 58 58 58 58 54 58 58 52 54 58 54 58 54 58 54 42 54 54 52 47 58 54 54 58 45 42 42 45 41 58 52 54 54 50 54 54 58 52 58 48 41 54 58 40 52 54 26 45 47 58 52 54 52 53 58 58 41 58 52 54 54 58 52 50 58 58 58 54 54 51 50 58 38 49 46 51 41 49 58 58 49 58 58 50 58 58 58 50 40 49 49 42 58 49 58 58 40 58 46 58 52 51 51 54 20 25 39 46 51 38 58 52 44 36 54 37 41 46 31 58 37 37 46 58 58 26 40 41 58 58 49 31 52 50 40 32 52 39 35 51 26 37 52 52 51 50 39 43 38 39 39 50 52 33 41 39 41 50 50 33 47 27 43 27 58 42 50 37 32 50 39 27 29 35 30 37 39 41 51 40 30 33 41 54 29 31 45 38 38 28 39 52 54 53 31 39 38 54 54 54 32 51 28 30 24 27 25 31 41 33 44 36 28 9 34 52 54 54 31 40 32 32 33 41 31 39 15 22 39 28 40 39 54 41 33 54 33 31 33 30 28 29 19 20 20 31 36 37 30 29 53 32 26 18 32 41 31 35 35 40 32 23 16 53 53 32 34 21 23 33 34 31 53 51 46 30 32 35 31 45 42 23 12 25 32 23 21 31 29 30 33 25 51 34 14 29 46 7 41 40 25 31 18 17 18 17 19 31 34 31 21 29	Open. Hide. 62 44 51 59 62 62 62 62 62 59 59 49 34 44 29 28 27 25 25 28 27 23 27 54 54 62 59 59 62 62 62 59 62 62 62 59 62 62 62 59 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 49 51 56 48 48 48 50 54 59 54 54 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 54 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 47 58 58 58 58 44 58 58 58 58 58 42 58 54 58 58 58 58 58 58 58 58 58 58 58 54 46 50 58 48 42 54 54 58 58 58 58 58 58 54 58 51 58 58 58 49 58 58 49 46 58 54 58 51 58 58 58 58 42 58 51 58 48 42 42 58 58 54 58 51 51 51 52 51 42 58 51 58 51 51 58 58 58 58 58 53 58 28 33 58 58 51 58 51 58 58 53 47 58 58 58 58 58 58 53 58 58 49 35 47 51 58 54 52 58 58 58 58 58 47 51 58 58 58 58 50 50 50 58 58 52 58 58 53 53 51 51 58 51 28 51 51 37 53 53 53 51 54 54 49 49 54 31 54 33 49 54 50 49 32 45 53 39 42 49 53 40 51 51 44 51 42 51 42 32 54 45 52 27 49 54 42 38 51 47 39 53 54 40 33 54 51 36 45 54 37 51 54 52 42 36 31 45 52 41 54 54 53 40 52 53 33 39 53 45 45 33 30 52 41 47 33 45 46 32 46 30 35 32 40 35 42 40 52 32 51 34 52 32 42 31 31 31 29 29 45 46 30 29 36 35 22 46 33 38 35 31 45 31 31 45 26 46 11 23 51 51 43 26 42 31 46 35 46 27 32 41 31 46 41 46 31 44 29 16 46 24 27 33 31 46 28 31 42 23 27 31 32 30 25 46 43 31 39 31 38 32 39 32 38 32 15 28 33 37 31 29 12 18 13 21 31 19 14 31 31 31 39 22 39 24 22 9 16 15 32 41 21 25 21 21 31 31 13 13 17 18 7 6 9 17 24 34 27 34 31 24 20 12 29 10 22 17 15 26 25 48 31 25 9 18 11 13 20 24 26 7 6 33 10 10 14 5 8 4 7 23 28 10 19

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_120500488_120501266
seq2: B6Ng01-181H11.b_45_823

seq1  GAATTCAAAATCAGTCTGGGCTATAACAAGTTCAAGGCCACCGGGCAAGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAAATCAGTCTGGGCTATAACAAGTTCAAGGCCACCGGGCAAGT  50

seq1  TGGCACACACCTTTAATCCAGCATTTAGGAGGGAGAGACAGGTGGATCTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCACACACCTTTAATCCAGCATTTAGGAGGGAGAGACAGGTGGATCTC  100

seq1  TGTAAATTTGAGCCCTGGTCTACAAAGCTAGTCCAGGACAGCCAGGGCTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAAATTTGAGCCCTGGTCTACAAAGCTAGTCCAGGACAGCCAGGGCTA  150

seq1  TACAGAGAAACCCTGCCCCCCAAAACAAACAAACAAACAAACAAACAAAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGAGAAACCCTGCCCCCCAAAACAAACAAACAAACAAACAAACAAAC  200

seq1  AACAAAAACCAAATTCAAGGCCAGCCTGGGCTAAGGTCTGTATCTAAACA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAAAAACCAAATTCAAGGCCAGCCTGGGCTAAGGTCTGTATCTAAACA  250

seq1  ATTAAAACAGAAAAACAAAATAATGAGATTGTAGCCTTTGCTTATTATCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAAAACAGAAAAACAAAATAATGAGATTGTAGCCTTTGCTTATTATCT  300

seq1  CAGGACTTGAGAGGCACAGGGAAGAAGTTCAGAAATTCAAGGTCAGCCTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGACTTGAGAGGCACAGGGAAGAAGTTCAGAAATTCAAGGTCAGCCTG  350

seq1  GGCTACATGAAATTTTGTTTCAAGGAAACCGACCCCATTGTGGTGCTGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTACATGAAATTTTGTTTCAAGGAAACCGACCCCATTGTGGTGCTGGA  400

seq1  CTTTAATTCTAGCACTTGGGAAGCTGAGGCAGAAAAATTGCAAGCTTGAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAATTCTAGCACTTGGGAAGCTGAGGCAGAAAAATTGCAAGCTTGAT  450

seq1  ACTATTCTGTGATAGAGAGAGTGAGCAGTTAAGTACTTGAGAAAAATGTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTATTCTGTGATAGAGAGAGTGAGCAGTTAAGTACTTGAGAAAAATGTT  500

seq1  CAACATCACTAGTAATTAAAGAAAAACAAGTTAAAACCTACCTTTGACCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACATCACTAGTAATTAAAGAAAAACAAGTTAAAACCTACCTTTGACCA  550

seq1  TGAATAATGTTTTGTTATTTTTTGTTTGGGTATTTTGAGACAGTTCCCTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATAATGTTTTGTTATTTTTTGTTTGGGTATTTTGAGACAGTTCCCTG  600

seq1  GCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTTGAATTTAGAGAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTTGAATTTAGAGAT  650

seq1  CTGCCTGCCTCTGCTCTTGCTTATTGAGTGCTGGGATTAAAGGCTTGCTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCTGCCTCTGCTCTTGCTTATTGAGTGCTGGGATTAAAGGCTTGCTC  700

seq1  CACCATTGTATGACTACCATGGATAAAATTTTAAAGAGTTTTTACATTAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCATTGTATGACTACCATGGATAAAATTTTAAAGAGTTTTTACATTAC  750

seq1  ATATTGACAAGGCTAGAGTTCTATAATCC  779
      |||||||||||||||||||||||||||||
seq2  ATATTGACAAGGCTAGAGTTCTATAATCC  779

seq1: chr2_120615010_120615930
seq2: B6Ng01-181H11.g_66_987 (reverse)

seq1  AGTCCG-ACACCCAAGTTTAATCCCTAGGACCTACATGGTAC-AAGGAGA  48
      |||||| ||||||||||||||||||||||||||||||||||| |||||||
seq2  AGTCCGAACACCCAAGTTTAATCCCTAGGACCTACATGGTACAAAGGAGA  50

seq1  GACCCAACTTCCACAAGTTGCTTCTGAAGTCCACACACACCATGATACAT  98
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  GACCCAAC-TCCACAAGTTGCTTCTGAAGTCCACACACACCATGATACAT  99

seq1  TCTTCCAACACCCAATTAATTAATTTTAAATAAGACCAAGCCAGCCATGG  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCAACACCCAATTAATTAATTTTAAATAAGACCAAGCCAGCCATGG  149

seq1  TAGCACACAGCTGTATCTTAGAAATCAGGAGGCGAAAGTAGGAGGACCTG  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCACACAGCTGTATCTTAGAAATCAGGAGGCGAAAGTAGGAGGACCTG  199

seq1  AGTTTAAGGCAAATCTTGCACATTTAGTGAGATCAAAAGCATTTTGTGCT  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTAAGGCAAATCTTGCACATTTAGTGAGATCAAAAGCATTTTGTGCT  249

seq1  ACTCAGTGAGACCATGTTTTTAAAAGATAAATAACAACAACAAATATAGT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCAGTGAGACCATGTTTTTAAAAGATAAATAACAACAACAAATATAGT  299

seq1  TTTAAGAAAGGGTAACATATCTTTAGGTCTAAGTCAAATATTGAAGAGCA  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAGAAAGGGTAACATATCTTTAGGTCTAAGTCAAATATTGAAGAGCA  349

seq1  CTGGGAAAGCCTTCTGAAGAGAAGAGGAAACATTTAAGCCTGGATTTATG  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGAAAGCCTTCTGAAGAGAAGAGGAAACATTTAAGCCTGGATTTATG  399

seq1  ATTTTAACTCACTGGTATATAAGTACTGTGAAGGAAAATAAAGAATCCAA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTAACTCACTGGTATATAAGTACTGTGAAGGAAAATAAAGAATCCAA  449

seq1  ATGTCAAAATAAAGTCTTCTGAATATGAAAGGAAACTGAGAACCGACAGT  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCAAAATAAAGTCTTCTGAATATGAAAGGAAACTGAGAACCGACAGT  499

seq1  TTAGGCAGTGAGGTGAACCATGGTTTGACTTTGAGGGTGACCGTGCTGTG  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGCAGTGAGGTGAACCATGGTTTGACTTTGAGGGTGACCGTGCTGTG  549

seq1  TGTGTTCAGGAGACAGGCAGTGTCAAGGACAACGGAGCTGTTTTCTCATT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTTCAGGAGACAGGCAGTGTCAAGGACAACGGAGCTGTTTTCTCATT  599

seq1  CTCCCATCGTCTCTTTCTGAGCTTCTACTCTTTCAGTCCATCTCTCCTCC  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCATCGTCTCTTTCTGAGCTTCTACTCTTTCAGTCCATCTCTCCTCC  649

seq1  ATCTCAAGGGGATGGAGCATGCCATGCTGACAGACAGAGAAAACGCTCAC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCAAGGGGATGGAGCATGCCATGCTGACAGACAGAGAAAACGCTCAC  699

seq1  CCTCTCCTTCAACTATGCAACAATTTTAACACAGTGGGAGTGGAGATCTG  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTCCTTCAACTATGCAACAATTTTAACACAGTGGGAGTGGAGATCTG  749

seq1  AAAGCCCAAGGGAGAAAAGATGAAAAGGGGAAGAACTTGGAGTATAAGCG  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCCCAAGGGAGAAAAGATGAAAAGGGGAAGAACTTGGAGTATAAGCG  799

seq1  AGGCTGTACTGTAACTCACAATCTATCTGGGATTAAACACATACAAAAAT  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTGTACTGTAACTCACAATCTATCTGGGATTAAACACATACAAAAAT  849

seq1  GACAACTAATAAGTTGTATTTTTAAAAATAGATGATATGACGCACTTCAT  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAACTAATAAGTTGTATTTTTAAAAATAGATGATATGACGCACTTCAT  899

seq1  CTGTTCAGCATACATAAGAATTC  921
      |||||||||||||||||||||||
seq2  CTGTTCAGCATACATAAGAATTC  922

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information