MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-195N14
Chromosome	2 (Build37)
Map Location	153,594,052 - 153,763,396
singlet/doublet	doublet
Overlap gene	Mapre1, EG329541, LOC100043869, Spag4l, Bpil1, Bpil3, Rya3, LOC100043870
Upstream gene	Bcl2l1, Tpx2, Mylk2, Fkhl18, Dusp15, Ttll9, Pdrg1, Xkr7, BC020535, Hck, Tm9sf4, Tspyl3, Plagl2, Pofut1, Kif3b, 2500004C02Rik, Asxl1, 8430427H17Rik, Commd7, 7530422B04Rik, Dnmt3b, LOC668932
Downstream gene	Gm1006, EG545477, Psp, LOC100043652, 1700058C13Rik, Plunc, 2310021H06Rik, U46068, BC018465, 5430413K10Rik, OTTMUSG00000015915, Cdk5rap1, Snta1, Cbfa2t2, Apba2bp, 1700003F12Rik, E2f1, Pxmp4, Zfp341, Chmp4b, LOC668936, LOC435692, Raly, Eif2s2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Bcl2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12048 MGI:88139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72119 MGI:1919369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mylk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228785 MGI:2139434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkhl18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14239 MGI:95546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252864 MGI:1934928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttll9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74711 MGI:1913589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pdrg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68559 MGI:1915809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xkr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228787 MGI:3526711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC020535 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228788 MGI:2385159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hck (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15162 MGI:96052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tm9sf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99237 MGI:2139220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspyl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241732 MGI:2139328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plagl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54711 MGI:1933165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pofut1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140484 MGI:2153207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Kif3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16569 MGI:107688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2500004C02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72326 MGI:1919576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	Asxl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228790 MGI:2684063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	8430427H17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329540 MGI:1918765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Commd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99311 MGI:1914197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	7530422B04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228792 MGI:2685409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Dnmt3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13436 MGI:1261819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	LOC668932 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 11 Proteins

name	Mapre1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13589 MGI:891995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG329541 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329541 MGI:3644206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043869 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 531 ESTs, 7 Proteins

name	Spag4l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76407 MGI:1923657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bpil1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66557 MGI:1913807
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bpil3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228796 MGI:2684965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rya3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378700 MGI:2675077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043870 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gm1006 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381399 MGI:2685852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545477 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545477 MGI:3647736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19194 MGI:97787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	1700058C13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73388 MGI:1920638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plunc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18843 MGI:1338036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310021H06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67135 MGI:1914385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	U46068 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228801 MGI:2137431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC018465 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228802 MGI:2385160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430413K10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71425 MGI:1918675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000015915 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433492 MGI:3709343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk5rap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66971 MGI:1914221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snta1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20648 MGI:101772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbfa2t2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12396 MGI:1333833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apba2bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56846 MGI:1861721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700003F12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75480 MGI:1922730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E2f1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13555 MGI:101941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pxmp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59038 MGI:1891701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228807 MGI:2682937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chmp4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75608 MGI:1922858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 1543 ESTs, 11 Proteins

name	LOC435692 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins pseudo : _no_value

name	Raly (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19383 MGI:97850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2s2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67204 MGI:1914454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129881 GeneID:12048 MGI:88139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl2-like 1 transcript_id : NM_009743.4

name	Tpx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88900516 GeneID:72119 MGI:1919369
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TPX2, microtubule-associated protein homolog (Xenopus laevis) transcript_id : NM_028109.3

name	Mylk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486659 GeneID:228785 MGI:2139434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, light polypeptide kinase 2, skeletal muscle transcript_id : NM_001081044.1

name	Fkhl18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371908 GeneID:14239 MGI:95546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead-like 18 (Drosophila) transcript_id : NM_010226.2

name	Dusp15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130203 GeneID:252864 MGI:1934928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase-like 15 transcript_id : NM_145744.2

name	Ttll9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288893 GeneID:74711 MGI:1913589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 9 transcript_id : NM_001083618.1

name	Ttll9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288918 GeneID:74711 MGI:1913589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 9 transcript_id : NM_029064.2

name	Pdrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130583 GeneID:68559 MGI:1915809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : p53 and DNA damage regulated 1 transcript_id : NM_178939.2

name	Xkr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59858536 GeneID:228787 MGI:3526711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X Kell blood group precursor related family member 7 homolog transcript_id : NM_001011732.1

name	BC020535 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704055 GeneID:228788 MGI:2385159
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC020535 transcript_id : NM_145536.1

name	Hck (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34734055 GeneID:15162 MGI:96052
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemopoietic cell kinase transcript_id : NM_010407.3

name	Tm9sf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130852 GeneID:99237 MGI:2139220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane 9 superfamily protein member 4 transcript_id : NM_133847.3

name	Tspyl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348483 GeneID:241732 MGI:2139328
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TSPY-like 3 transcript_id : NM_198617.1

name	Plagl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130736 GeneID:54711 MGI:1933165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleiomorphic adenoma gene-like 2 transcript_id : NM_018807.5

name	Pofut1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794592 GeneID:140484 MGI:2153207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein O-fucosyltransferase 1 transcript_id : NM_080463.3

name	Pofut1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794594 GeneID:140484 MGI:2153207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein O-fucosyltransferase 1 transcript_id : NM_001039055.1

name	Kif3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377724 GeneID:16569 MGI:107688
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 3B transcript_id : NM_008444.3

name	2500004C02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250211 GeneID:72326 MGI:1919576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : RIKEN cDNA 2500004C02 gene transcript_id : XM_001004869.2

name	Asxl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90568302 GeneID:228790 MGI:2684063
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : additional sex combs like 1 (Drosophila) transcript_id : NM_001039939.1

name	8430427H17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50233835 GeneID:329540 MGI:1918765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 8430427H17 gene transcript_id : NM_001001986.1

name	Commd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29789332 GeneID:99311 MGI:1914197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COMM domain containing 7 transcript_id : NM_133850.1

name	7530422B04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250069 GeneID:228792 MGI:2685409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 7530422B04 gene transcript_id : XM_001480604.1

name	Dnmt3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801915 GeneID:13436 MGI:1261819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3B transcript_id : NM_001003961.2

name	Dnmt3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803432 GeneID:13436 MGI:1261819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3B transcript_id : NM_001003963.2

name	Dnmt3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388604 GeneID:13436 MGI:1261819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3B transcript_id : NM_001003960.2

name	Dnmt3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803558 GeneID:13436 MGI:1261819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3B transcript_id : NM_010068.3

name	LOC668932 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250071 GeneID:668932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 11 Proteins product : similar to DNA cytosine-5 methyltransferase 3B2 transcript_id : XM_001004878.2

name	Mapre1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063571 GeneID:13589 MGI:891995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein, RP/EB family, member 1 transcript_id : NM_007896.3

name	EG329541 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802612 GeneID:329541 MGI:3644206
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG329541 transcript_id : NM_177849.3

name	LOC100043869 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250212 GeneID:100043869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 531 ESTs, 7 Proteins product : similar to Translocase of outer mitochondrial membrane 20 homolog (yeast) transcript_id : XM_001481127.1

name	Spag4l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32261333 GeneID:76407 MGI:1923657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 4-like transcript_id : NM_029599.1

name	Bpil1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380515 GeneID:66557 MGI:1913807
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bactericidal/permeability-increasing protein-like 1 transcript_id : NM_025631.2

name	Bpil3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556281 GeneID:228796 MGI:2684965
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bactericidal/permeability-increasing protein-like 3 transcript_id : NM_199303.1

name	Rya3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:35902743 GeneID:378700 MGI:2675077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : antimicrobial peptide RYA3 transcript_id : NM_194357.1

name	LOC100043870 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250214 GeneID:100043870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043870 transcript_id : XM_001481133.1

name	Gm1006 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131066 GeneID:381399 MGI:2685852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1006, (NCBI) transcript_id : NM_001034875.2

name	EG545477 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249112 GeneID:545477 MGI:3647736
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545477 transcript_id : NM_001080811.1

name	Psp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982095 GeneID:19194 MGI:97787
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : parotid secretory protein transcript_id : NM_008953.2

name	1700058C13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130490 GeneID:73388 MGI:1920638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700058C13 gene transcript_id : NM_028528.2

name	Plunc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348464 GeneID:18843 MGI:1338036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : palate, lung, and nasal epithelium carcinoma associated transcript_id : NM_011126.2

name	2310021H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802605 GeneID:67135 MGI:1914385
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310021H06 gene transcript_id : NM_025990.2

name	U46068 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59939911 GeneID:228801 MGI:2137431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence U46068 transcript_id : NM_001012392.1

name	U46068 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59939909 GeneID:228801 MGI:2137431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence U46068 transcript_id : NM_153418.2

name	BC018465 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450266 GeneID:228802 MGI:2385160
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC018465 transcript_id : NM_144890.1

name	5430413K10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982542 GeneID:71425 MGI:1918675
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430413K10 gene transcript_id : NM_175167.3

name	OTTMUSG00000015915 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909313 GeneID:433492 MGI:3709343
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000015915 transcript_id : NM_001025574.1

name	Cdk5rap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130251 GeneID:66971 MGI:1914221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDK5 regulatory subunit associated protein 1 transcript_id : NM_025876.2

name	Snta1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678056 GeneID:20648 MGI:101772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntrophin, acidic 1 transcript_id : NM_009228.1

name	Cbfa2t2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41152519 GeneID:12396 MGI:1333833
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) transcript_id : NM_172860.1

name	Apba2bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130437 GeneID:56846 MGI:1861721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor protein-binding, family A, member 1 binding protein transcript_id : NM_021546.2

name	1700003F12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802924 GeneID:75480 MGI:1922730
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700003F12 gene transcript_id : NM_029305.2

name	E2f1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347517 GeneID:13555 MGI:101941
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E2F transcription factor 1 transcript_id : NM_007891.2

name	Pxmp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365206 GeneID:59038 MGI:1891701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal membrane protein 4 transcript_id : NM_021534.3

name	Zfp341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556275 GeneID:228807 MGI:2682937
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 341 transcript_id : NM_199304.1

name	Chmp4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672914 GeneID:75608 MGI:1922858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromatin modifying protein 4B transcript_id : NM_029362.3

name	LOC668936 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250072 GeneID:668936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 1543 ESTs, 11 Proteins product : similar to ribosomal protein L5 transcript_id : XM_001004898.2

name	Raly (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963504 GeneID:19383 MGI:97850
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hnRNP-associated with lethal yellow transcript_id : NM_023130.1

name	Eif2s2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311551 GeneID:67204 MGI:1914454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2, subunit 2 (beta) transcript_id : NM_026030.2

name	Bcl2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037550 CCDS:CCDS16899.1 GeneID:12048 MGI:88139
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0006915 - apoptosis [Evidence IDA]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0045768 - positive regulation of anti-apoptosis [Evidence IDA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0009314 - response to radiation [Evidence IMP] codon_start : 1 note : Bcl2-like; B-cell leukemia/lymphoma x; anti-apoptosis regulatory protein product : Bcl2-like 1 protein_id : NP_033873.3

name	Tpx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88900517 CCDS:CCDS16900.1 GeneID:72119 MGI:1919369
definition	GO_component : GO:0005818 - aster [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS]; GO:0005876 - spindle microtubule [Evidence ISS] GO_function : GO:0019901 - protein kinase binding [Evidence ISS] GO_process : GO:0051227 - mitotic spindle assembly [Evidence ISS] codon_start : 1 product : TPX2, microtubule-associated protein homolog protein_id : NP_082385.3

name	Mylk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486660 GeneID:228785 MGI:2139434
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0007274 - neuromuscular synaptic transmission [Evidence IGI] [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : myosin, light polypeptide kinase 2, skeletal muscle protein_id : NP_001074513.1

name	Fkhl18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563254 CCDS:CCDS16901.1 GeneID:14239 MGI:95546
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : forkhead-like 18 protein_id : NP_034356.1

name	Dusp15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21919414 CCDS:CCDS16902.1 GeneID:252864 MGI:1934928
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] codon_start : 1 product : dual specificity phosphatase 15 protein_id : NP_665687.1

name	Ttll9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288894 GeneID:74711 MGI:1913589
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; tubulin tyrosine ligase like family 9; putative polyglutamylase product : tubulin tyrosine ligase like family 9 isoform 1 protein_id : NP_001077087.1

name	Ttll9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288919 CCDS:CCDS16903.1 GeneID:74711 MGI:1913589
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; tubulin tyrosine ligase like family 9; putative polyglutamylase product : tubulin tyrosine ligase like family 9 isoform 2 protein_id : NP_083340.2

name	Pdrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32490570 CCDS:CCDS16904.1 GeneID:68559 MGI:1915809
definition	GO_function : GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : p53 and DNA damage-regulated protein protein_id : NP_849270.1

name	Xkr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858537 CCDS:CCDS16905.1 GeneID:228787 MGI:3526711
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : XK-related protein 7 product : X Kell blood group precursor related family member 7 homolog protein_id : NP_001011732.1

name	BC020535 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704056 GeneID:228788 MGI:2385159
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC228788 protein_id : NP_663511.1

name	Hck (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34734056 GeneID:15162 MGI:96052
definition	EC_number : 2.7.10.1 GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : non-AUG (CUG) translation initiation codon product : hemopoietic cell kinase isoform p59Hck protein_id : NP_034537.2 transl_except : (pos:152934429..152934431,aa:Met)

name	Tm9sf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542095 CCDS:CCDS16906.1 GeneID:99237 MGI:2139220
definition	codon_start : 1 product : transmembrane 9 superfamily protein member 4 protein_id : NP_598608.2

name	Tspyl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348484 CCDS:CCDS16907.1 GeneID:241732 MGI:2139328
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : TSPY-like 3 protein_id : NP_941019.1

name	Plagl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34610215 CCDS:CCDS16908.1 GeneID:54711 MGI:1933165
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : pleomorphic adenoma gene like 2 product : pleiomorphic adenoma gene-like 2 protein_id : NP_061277.2

name	Pofut1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794593 CCDS:CCDS16909.1 GeneID:140484 MGI:2153207
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030173 - integral to Golgi membrane [Evidence ISS] GO_function : GO:0008417 - fucosyltransferase activity [Evidence ISS]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046922 - peptide-O-fucosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006004 - fucose metabolism [Evidence TAS]; GO:0007507 - heart development [Evidence IMP]; GO:0007399 - nervous system development [Evidence IMP]; GO:0007219 - Notch signaling pathway [Evidence IMP]; GO:0006493 - protein amino acid O-linked glycosylation [Evidence ISS]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : protein O-fucosyltransferase 1 isoform 1 protein_id : NP_536711.3

name	Pofut1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794595 CCDS:CCDS16910.1 GeneID:140484 MGI:2153207
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030173 - integral to Golgi membrane [Evidence ISS] GO_function : GO:0008417 - fucosyltransferase activity [Evidence ISS]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046922 - peptide-O-fucosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006004 - fucose metabolism [Evidence TAS]; GO:0007507 - heart development [Evidence IMP]; GO:0007399 - nervous system development [Evidence IMP]; GO:0007219 - Notch signaling pathway [Evidence IMP]; GO:0006493 - protein amino acid O-linked glycosylation [Evidence ISS]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : protein O-fucosyltransferase 1 isoform 2 protein_id : NP_001034144.1

name	Kif3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560675 CCDS:CCDS16911.1 GeneID:16569 MGI:107688
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 exception : mismatches in translation product : kinesin family member 3B protein_id : NP_032470.2

name	2500004C02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94367334 GeneID:72326 MGI:1919576
definition	codon_start : 1 product : hypothetical protein LOC72326 protein_id : XP_001004869.1

name	Asxl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90568303 GeneID:228790 MGI:2684063
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : additional sex combs like 1 protein_id : NP_001035028.1

name	8430427H17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50233836 GeneID:329540 MGI:1918765
definition	codon_start : 1 product : hypothetical protein LOC329540 protein_id : NP_001001986.1

name	Commd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789333 CCDS:CCDS16912.1 GeneID:99311 MGI:1914197
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : COMM domain containing 7 protein_id : NP_598611.1

name	7530422B04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250070 GeneID:228792 MGI:2685409
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480654.1

name	Dnmt3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556229 CCDS:CCDS16914.1 GeneID:13436 MGI:1261819
definition	GO_component : GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence ISS] [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IGI]; GO:0006349 - imprinting [Evidence IMP]; GO:0031503 - protein complex localization [Evidence IDA] codon_start : 1 exception : mismatches in translation function : methylates cytosine in DNA note : isoform 1 is encoded by transcript variant 1 product : DNA methyltransferase 3B isoform 1 protein_id : NP_001003961.1

name	Dnmt3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556271 CCDS:CCDS16915.1 GeneID:13436 MGI:1261819
definition	GO_component : GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence ISS] [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IGI]; GO:0006349 - imprinting [Evidence IMP]; GO:0031503 - protein complex localization [Evidence IDA] codon_start : 1 exception : mismatches in translation function : methylates cytosine in DNA note : isoform 4 is encoded by transcript variant 4 product : DNA methyltransferase 3B isoform 4 protein_id : NP_001003963.1

name	Dnmt3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556217 CCDS:CCDS16913.1 GeneID:13436 MGI:1261819
definition	GO_component : GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence ISS] [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IGI]; GO:0006349 - imprinting [Evidence IMP]; GO:0031503 - protein complex localization [Evidence IDA] codon_start : 1 exception : mismatches in translation function : methylates cytosine in DNA note : isoform 2 is encoded by transcript variant 2 product : DNA methyltransferase 3B isoform 2 protein_id : NP_001003960.1

name	Dnmt3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556223 CCDS:CCDS16916.1 GeneID:13436 MGI:1261819
definition	GO_component : GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence ISS] [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IGI]; GO:0006349 - imprinting [Evidence IMP]; GO:0031503 - protein complex localization [Evidence IDA] codon_start : 1 exception : mismatches in translation function : methylates cytosine in DNA note : isoform 3 is encoded by transcript variant 3 product : DNA methyltransferase 3B isoform 3 protein_id : NP_034198.2

name	LOC668932 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367338 GeneID:668932
definition	codon_start : 1 product : similar to DNA cytosine-5 methyltransferase 3B2 protein_id : XP_001004878.1

name	Mapre1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106301 CCDS:CCDS16917.1 GeneID:13589 MGI:891995
definition	GO_component : GO:0030981 - cortical microtubule cytoskeleton [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005874 - microtubule [Evidence IDA]; GO:0005819 - spindle [Evidence ISS] GO_function : GO:0008017 - microtubule binding [Evidence IEA]; GO:0051010 - microtubule plus-end binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0031115 - negative regulation of microtubule polymerization [Evidence ISS] codon_start : 1 note : adenomatosis polyposis coli binding protein Eb1; APC-binding protein EB1; end-binding protein 1 product : microtubule-associated protein, RP/EB family, member 1 protein_id : NP_031922.1

name	EG329541 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244438 GeneID:329541 MGI:3644206
definition	codon_start : 1 product : hypothetical protein LOC329541 protein_id : NP_808517.1

name	LOC100043869 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250213 GeneID:100043869
definition	codon_start : 1 product : similar to Translocase of outer mitochondrial membrane 20 homolog (yeast) protein_id : XP_001481177.1

name	Spag4l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32261334 GeneID:76407 MGI:1923657
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007283 - spermatogenesis [Evidence ISS] codon_start : 1 product : spermatogenesis-related gene 4 protein_id : NP_083875.1

name	Bpil1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385094 CCDS:CCDS16919.1 GeneID:66557 MGI:1913807
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : bactericidal/permeability-increasing protein-like 1 protein_id : NP_079907.1

name	Bpil3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556282 CCDS:CCDS16920.1 GeneID:228796 MGI:2684965
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : bactericidal/permeability-increasing protein-like 3 product : bactericidal/permeability-increasing protein-like 3 precursor protein_id : NP_955007.1

name	Rya3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925587 CCDS:CCDS16921.1 GeneID:378700 MGI:2675077
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005549 - odorant binding [Evidence ISS] GO_process : GO:0045087 - innate immune response [Evidence ISS] codon_start : 1 product : antimicrobial peptide RYA3 protein_id : NP_919338.2

name	LOC100043870 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250215 GeneID:100043870
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481183.1

name	Gm1006 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702217 CCDS:CCDS16922.1 GeneID:381399 MGI:2685852
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 note : Novel LBP / BPI / CETP family, N-terminal domain containing protein product : hypothetical protein LOC381399 protein_id : NP_001030047.1

name	EG545477 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249113 GeneID:545477 MGI:3647736
definition	codon_start : 1 product : hypothetical protein LOC545477 protein_id : NP_001074280.1

name	Psp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679509 CCDS:CCDS16923.1 GeneID:19194 MGI:97787
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : parotid secretory protein protein_id : NP_032979.1

name	1700058C13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037321 CCDS:CCDS16924.1 GeneID:73388 MGI:1920638
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 note : Novel LBP / BPI / CETP family, N-terminal domain containing protein product : hypothetical protein LOC73388 protein_id : NP_082804.1

name	Plunc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10242375 CCDS:CCDS16925.1 GeneID:18843 MGI:1338036
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0045087 - innate immune response [Evidence ISS] codon_start : 1 exception : mismatches in translation note : palate, lung, and nasal epithelium expressed transcript product : palate, lung, and nasal epithelium carcinoma associated protein_id : NP_035256.1

name	2310021H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735429 CCDS:CCDS16926.1 GeneID:67135 MGI:1914385
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 2310021H06 protein_id : NP_080266.1

name	U46068 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59939912 CCDS:CCDS16927.1 GeneID:228801 MGI:2137431
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; von Ebner minor salivary gland protein; long palate, lung and nasal epithelium carcinoma associated 1; von Ebner minor salivary protein product : long palate, lung and nasal epithelium carcinoma associated 1 isoform 1 protein_id : NP_001012392.1

name	U46068 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59939910 CCDS:CCDS16927.1 GeneID:228801 MGI:2137431
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; von Ebner minor salivary gland protein; long palate, lung and nasal epithelium carcinoma associated 1; von Ebner minor salivary protein product : long palate, lung and nasal epithelium carcinoma associated 1 isoform 2 protein_id : NP_700467.2

name	BC018465 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450267 CCDS:CCDS16928.1 GeneID:228802 MGI:2385160
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC228802 protein_id : NP_659139.1

name	5430413K10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982543 GeneID:71425 MGI:1918675
definition	GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71425 protein_id : NP_780376.2

name	OTTMUSG00000015915 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909314 GeneID:433492 MGI:3709343
definition	codon_start : 1 product : hypothetical protein LOC433492 protein_id : NP_001020745.1

name	Cdk5rap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385358 CCDS:CCDS16931.1 GeneID:66971 MGI:1914221
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA]; GO:0042808 - neuronal Cdc2-like kinase binding [Evidence ISS] GO_process : GO:0007420 - brain development [Evidence ISS]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0045736 - negative regulation of cyclin-dependent protein kinase activity [Evidence ISS]; GO:0045664 - regulation of neuron differentiation [Evidence ISS] codon_start : 1 product : CDK5 regulatory subunit associated protein 1 protein_id : NP_080152.1

name	Snta1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678057 GeneID:20648 MGI:101772
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007528 - neuromuscular junction development [Evidence IMP] codon_start : 1 note : alpha1-syntrophin; syntrophin acidic 1 product : syntrophin, acidic 1 protein_id : NP_033254.1

name	Cbfa2t2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41152520 CCDS:CCDS16932.1 GeneID:12396 MGI:1333833
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030855 - epithelial cell differentiation [Evidence IMP]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : CBFA2T2 identified gene homolog; core-binding factor runt domain alpha subunit 2 translocated to 2 homolog product : core-binding factor, runt domain, alpha subunit 2, translocated to, 2 homolog protein_id : NP_766448.1

name	Apba2bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946982 GeneID:56846 MGI:1861721
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IEA]; GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005789 - endoplasmic reticulum membrane [Evidence ISS]; GO:0000137 - Golgi cis cisterna [Evidence IDA] [Evidence ISS] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0017000 - antibiotic biosynthesis [Evidence IEA]; GO:0019538 - protein metabolism [Evidence TAS] [Evidence ISS]; GO:0009306 - protein secretion [Evidence ISS] codon_start : 1 product : amyloid beta (A4) precursor protein-binding, family A, member 1 binding protein protein_id : NP_067521.1

name	1700003F12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626064 CCDS:CCDS16933.1 GeneID:75480 MGI:1922730
definition	codon_start : 1 product : hypothetical protein LOC75480 protein_id : NP_083581.1

name	E2f1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681243 CCDS:CCDS16935.1 GeneID:13555 MGI:101941
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : E2F transcription factor 1 protein_id : NP_031917.1

name	Pxmp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946966 CCDS:CCDS16936.1 GeneID:59038 MGI:1891701
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : 24 kDa intrinsic membrane protein product : peroxisomal membrane protein 4 protein_id : NP_067509.1

name	Zfp341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76559897 CCDS:CCDS16937.1 GeneID:228807 MGI:2682937
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 341 protein_id : NP_955008.2

name	Chmp4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077049 CCDS:CCDS16938.1 GeneID:75608 MGI:1922858
definition	GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : chromatin modifying protein 4B protein_id : NP_083638.1

name	LOC668936 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250073 GeneID:668936
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004898.2

name	Raly (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963505 CCDS:CCDS16939.1 GeneID:19383 MGI:97850
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hnRNP-associated with lethal yellow protein_id : NP_075619.1

name	Eif2s2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149756 GeneID:67204 MGI:1914454
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045946 - positive regulation of translation [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : eukaryotic translation initiation factor 2, subunit 2 (beta, 38kDa); eukaryotic translation initiation factor 2 subunit 2 (beta) product : eukaryotic translation initiation factor 2, subunit 2 (beta) protein_id : NP_080306.1

name	LOC100043652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043652
definition	number : 1 pseudo : _no_value

name	LOC435692 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250216 GeneID:435692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_035020.1

clone name	MSMg01-084F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168E21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-168E20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-153E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316J12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-119O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146N09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-303P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526C06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-126O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-094F02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-463I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-174A11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-409O08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-070L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425J13
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-171P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275P19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-195N14.b	B6Ng01-195N14.g
ACC	GA018153	GA018154
length	1,136	1,074
definition	B6Ng01-195N14.b	B6Ng01-195N14.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(153,762,270 - 153,763,396)	(153,594,052 - 153,595,115)
sequence	gaattcacgtgtacagcaaagctgagagaaccatccagtgagtgccacac accagccagctctcgtcagcctcaccaacatctgcattccgtgcatggta cctgctctgtcacattttttaatccaaccatggagcctcaagttcaccat gtagcagaggataacctaagcatcctgcattcacctcgctgggattgcag ccagtcaccaccatacttggtctgtgtgatgctgtggattgaatccaaga ctttctacacgacactagtgagccctcggacctctgattttgtgctgaca gccgactgtgacactacccacctccacacacaggctacgattttgtatat aaatttccacagtgaaaacccgagcctatgatgattttatgtatttgtgt agcctgcatctcaccacactatagaacattccctcactcaaagttcccac cttcctttcccccatcactccctattcccatagaggcaccagttgcccag tcttctacccaggcttcccttgacacccaagactccacccccaccccgtc ttctccttatgctctcacctgctccttgtcacgccccctgcctttggacc tttgcacatgccagtcctgccatctacctgccttttactccccctctgga ccactcagacatccctggacccatctgagatgtgaattctccaggaaaat caggagggtgaccagctcagagcccagcataagtgcagttgccagtgtaa ccacaaatgatgaccgagccccaactggcctgagcactcactgaggcctt ctgctgcccgcacccagcccagcccaggcccagttttcacacctgttttt ttaccacctcctccaggccccagccttcccactcactacttcaaagagcc agggttgttctctctcctaccccggcaagcctcgggtccttcattggcca gccttccccaagagatgctttctgccctttccctaccagttaaaggtgcc tttgaggcaggtggcatatatattttgaatcctggacagcttggcctggt gtcagccacagcatcatctgtttttcctgggtcaggcctccttcttgggg actcagttttccccgtacagcaggattggttattaa	gaattcagaggaaaatccaggctcagtgattaacaatgccaaaaaaagaa aaaaaaaaaacaaacaaaaagcaagtaacgagccattgttcaaacgacag cggtgctgtttctcctctgtggcctttcagacttctgttgcccccaaatt ccattttattgggaacccattttccacctggtctttcttgacagggtttt tttctactttaaacagtttttaaataaaattctgtatttcaagagtgtcc tgtcttctgaaatgtgtcttgccttgggtataagcttttaattctagagg taagatagctatgcatccatctttggctgagcttagacagaggctgagaa atgattcccaccgtcttaaataggactaatcttttaaaatccctcacttt tctcaagctaactaatctggctctccccttcctctatcctcctttctcct tctcccttccttcctccctctttttcctcttcctccctccttttggtttt taagacagagcttttagtattgttgtcctgattggcctcatatttgtcac agtccttcttcctcattctcttgaaagattatgtgtgtgtgccatcgtgc ctggcttaaaattgcttattttgaattctttttaaaaaaaaaaatcacat tacatttttcagtcttctactgctttaaattcctgttaccctgagaaggt tttcctcacagaaacagaaagcctgacctagttgcttaaggctctttagg aatgtagttggccggtgtttggcagatgatttaattggaggtaattgttt catttgtcctgaaaatgcatttacaaagtcagtttagtacactcttaaac tggagagtaaagttgttgcttcttaaaactgttctataaagtcctacacc ttttgaagaatgagttgaaaatatgatcctctcctgttgttgttcttgaa atgttaaataaggcagaaaggtaattcatctgctctttgagagtaccatg tacagtaccctggctgctgtggaagtgatcttggagagtaccacggtaca gtactctgggctgctgtggagtgg
quality values	Open. Hide. 36 38 17 35 54 25 21 36 62 62 62 43 56 56 29 62 47 62 56 62 62 62 62 46 62 56 62 62 49 32 37 59 59 62 51 44 29 36 45 46 43 50 56 46 59 59 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 54 62 62 62 56 62 56 56 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 62 59 56 62 62 59 62 62 62 62 59 62 62 54 54 59 62 62 62 59 48 34 38 54 62 62 62 62 62 62 62 59 59 62 62 62 62 51 62 59 62 59 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 54 62 62 62 54 62 48 62 62 62 62 62 58 58 58 58 58 58 54 54 58 58 54 52 54 48 49 46 58 58 58 52 54 58 58 58 54 52 54 52 52 54 44 44 58 58 58 58 54 58 58 58 47 58 54 58 58 58 58 58 54 54 51 54 52 52 48 54 58 58 58 58 58 43 54 52 42 54 54 58 58 52 52 47 54 50 50 50 50 48 44 47 45 32 58 51 58 58 50 51 42 53 51 58 58 47 35 49 52 58 58 49 51 58 49 58 53 53 53 51 51 47 58 54 54 51 58 48 58 58 49 50 37 54 54 58 58 58 51 54 53 41 58 58 41 28 50 50 39 49 52 51 33 58 39 34 53 46 58 54 51 58 58 49 30 58 46 34 53 42 52 51 51 21 39 25 51 41 49 58 39 39 50 50 47 58 51 34 49 50 51 42 42 32 31 47 50 32 54 46 25 44 49 36 49 37 40 39 33 39 52 54 37 39 22 54 18 47 54 53 53 32 39 39 52 45 53 36 45 49 37 38 35 45 42 45 38 39 37 33 24 49 19 13 49 29 33 39 53 12 49 51 37 35 37 22 53 23 15 54 36 32 18 46 51 54 49 28 28 41 37 31 14 13 29 30 51 53 30 40 34 31 35 32 32 40 32 43 32 8 46 20 32 31 33 31 26 41 31 40 45 26 47 28 30 31 32 28 53 45 40 26 47 47 17 31 26 27 47 43 30 31 44 30 46 46 31 29 37 51 51 20 30 31 27 29 30 37 30 27 6 45 51 51 51 51 18 18 31 31 30 28 28 33 24 31 30 18 29 30 28 46 36 41 40 31 30 21 31 12 9 46 27 47 30 10 14 22 33 17 31 32 37 28 37 39 27 23 46 29 18 42 18 30 31 29 42 43 25 7 6 14 27 27 31 29 30 31 30 27 21 14 14 23 13 39 38 38 26 31 22 19 13 15 32 31 31 11 7 31 11 8 10 19 10 31 31 27 33 25 18 24 30 15 9 10 17 31 10 14 11 36 32 19 10 21 22 36 21 42 21 37 31 31 48 23 30 23 32 31 36 26 9 44 13 22 48 34 21 11 9 21 15 12 18 10 48 24 13 9 14 9 10 11 15 32 43 34 12 9 4 6 8 13 19 16 22 22 22 4 5 13 7 7 9 6 6 15 48 32 32 12 25 17 27 17 27 25 18 13 27 10 26 21 22 17 20 11 21 6 6 24 6 5 5 27 9 14 8 10 8 15 21 16 16 27 24 28 28 17 7 27 23 20 15 6 21 34 30 10 10 14 18 9 16 4 3 4 11 10 25 13 11 25 11 27 7 13 4 7 19 15 29 27 8 17 12 10 10 18 6 14 23 25 9 22 24 28 21 20 11 6 7 8 11 15 15 6 17 6 7 4 6 8 11 1 6 3 6 4 1	Open. Hide. 62 38 32 47 62 44 31 62 62 62 59 43 28 27 25 21 28 21 15 23 28 36 49 59 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 50 56 54 56 56 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 54 62 59 62 59 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 59 62 54 62 62 59 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 46 54 62 62 62 62 62 56 59 62 62 62 56 46 59 56 56 59 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 56 56 50 56 54 50 59 62 59 62 62 62 62 59 62 59 62 62 59 62 62 59 59 59 62 54 62 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 59 62 62 54 59 62 62 59 59 62 59 62 62 62 62 62 62 62 56 62 59 62 51 62 59 62 62 62 62 62 56 62 62 62 51 62 62 62 62 56 62 62 59 62 62 62 62 59 62 62 59 32 59 56 43 44 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 62 43 56 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 58 54 54 58 54 54 52 54 54 52 58 52 41 52 58 54 58 58 58 58 44 58 52 58 58 54 58 54 35 58 58 54 54 54 54 58 54 54 54 58 54 54 58 54 58 52 54 52 45 58 52 58 58 54 52 52 54 52 43 58 58 58 58 58 58 48 58 54 58 53 50 51 51 51 51 52 58 49 49 58 58 51 50 58 39 49 50 49 49 49 58 53 53 53 53 50 42 41 49 52 53 58 53 53 54 50 49 50 58 54 46 58 29 35 58 58 50 50 58 51 52 58 46 50 50 58 58 50 40 42 48 43 52 53 58 58 58 51 53 50 58 58 58 58 58 58 46 51 51 37 40 46 50 42 53 52 41 51 41 45 51 58 58 54 58 37 53 50 42 51 54 40 52 52 50 49 32 58 38 47 58 29 54 26 25 37 52 50 39 32 54 26 40 30 53 51 38 39 42 31 22 54 49 24 32 13 51 54 16 31 53 39 47 31 39 32 29 24 33 22 42 34 38 54 54 49 30 37 41 37 44 37 30 42 37 32 24 35 28 37 33 33 47 29 53 25 32 28 42 39 29 54 7 24 9 37 25 18 25 45 30 32 28 34 39 40 40 30 52 30 54 14 41 53 53 28 47 24 22 33 19 42 29 28 41 27 53 53 25 33 32 32 43 31 35 18 42 23 33 31 32 30 41 34 53 39 45 15 13 52 9 22 16 42 18 29 29 30 51 46 23 28 36 32 20 31 51 31 28 34 32 41 24 28 26 30 33 31 23 46 8 15 19 30 38 39 23 32 30 32 45 13 25 41 18 18 23 23 27 23 5 22 13 25 38 48 28 21 20 20 27 13 16 30 31 38 33 29 21 32 32 46 46 32 31 32 33 9 28 31 31 24 21 13 48 32 31 20 18 25 32 16 8 5 10 25 14 39 35 14 17 26 11 8 28 22 27 26 28 8 6 12 24 27 46 41 37 31 21 16 31 23 21 29 31 26 20 18 15 41 20 39 23 11 13 14 16 7 6 10 18 31 9 22 28 48 19 14 28 10 22 14 41 29 15 11 19 24 25 18 12 11 26 36 22 17 30 6 5 13 12 30 22 18 31 34 32 31 13 9 11 9 32 13 15 27 7 7 6 10 24 23 28 23 12 19 7 9 18 12 28 8 20 34 48 24 32 11 19 13 12 31 21 15 20 6 6 15 12 13 14 10 21 32 27 17 6 19 13 5 4 5 16 12 14 6 20 10 5 15 9 10 5 6 15 10 6 11 16 15 26 28 7 9 28 6 7 6 9 12 20 11 5 8 7 3 3 3 3 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_153762270_153763396
seq2: B6Ng01-195N14.b_46_1181 (reverse)

seq1  TTAATAACTCTATTAACATACCTGCTGTACGGGG-AAACTGAGTCCCAAA  49
      ||||||||        ||  |||||||||||||| |||||||||||| ||
seq2  TTAATAAC--------CAATCCTGCTGTACGGGGAAAACTGAGTCCCCAA  42

seq1  G-AGGA-GCCTGA-CCAGG-AAAACAGATGATGCTGT-GCTGACA-CAAG  93
      | |||| |||||| ||||| ||||||||||||||||| ||||||| || |
seq2  GAAGGAGGCCTGACCCAGGAAAAACAGATGATGCTGTGGCTGACACCAGG  92

seq1  CCAAGCTTGTCAGGATTCAA---ATATATGCCACCTGCCTTCAAAGCACC  140
      |||||||   ||||||||||   |||||||||||||||||  || |||||
seq2  CCAAGCTGTCCAGGATTCAAAATATATATGCCACCTGCCTCAAAGGCACC  142

seq1  TTT-ACTGGTAGGG-AAGGGCAGAAAGCATCTCTTGGGG-AGGCTGG-CA  186
      ||| |||||||||| |||||||||||||||||||||||| ||||||| ||
seq2  TTTAACTGGTAGGGAAAGGGCAGAAAGCATCTCTTGGGGAAGGCTGGCCA  192

seq1  ATGAAGGA-CCGAGGCTTGCCGGGGTAGGAGAGAGAAC-ACCCTGGCTCT  234
      |||||||| ||||||||||||||||||||||||||||| |||||||||||
seq2  ATGAAGGACCCGAGGCTTGCCGGGGTAGGAGAGAGAACAACCCTGGCTCT  242

seq1  TTGAAGTAGTGAGTGGGAAGGCTGGGGCCTGGAGGAGGTGGT-AAAAAAC  283
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  TTGAAGTAGTGAGTGGGAAGGCTGGGGCCTGGAGGAGGTGGTAAAAAAAC  292

seq1  AGGTGTGAAAACTGGGCCTGGGCTGGGCTGGGTGCGGGCAGCAGAAGGCC  333
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGTGAAAACTGGGCCTGGGCTGGGCTGGGTGCGGGCAGCAGAAGGCC  342

seq1  TCAGTGAGTGCTCAGGCCAGTTGGGGCTCGGTCATCATTTGTGGTTACAC  383
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTGAGTGCTCAGGCCAGTTGGGGCTCGGTCATCATTTGTGGTTACAC  392

seq1  TGGCAACTGCACTTATGCTGGGCTCTGAGCTGGTCACCCTCCTGATTTTC  433
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCAACTGCACTTATGCTGGGCTCTGAGCTGGTCACCCTCCTGATTTTC  442

seq1  CTGGAGAATTCACATCTCAGATGGGTCCAGGGATGTCTGAGTGGTCCAGA  483
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGAGAATTCACATCTCAGATGGGTCCAGGGATGTCTGAGTGGTCCAGA  492

seq1  GGGGGAGTAAAAGGCAGGTAGATGGCAGGACTGGCATGTGCAAAGGTCCA  533
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGAGTAAAAGGCAGGTAGATGGCAGGACTGGCATGTGCAAAGGTCCA  542

seq1  AAGGCAGGGGGCGTGACAAGGAGCAGGTGAGAGCATAAGGAGAAGACGGG  583
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCAGGGGGCGTGACAAGGAGCAGGTGAGAGCATAAGGAGAAGACGGG  592

seq1  GTGGGGGTGGAGTCTTGGGTGTCAAGGGAAGCCTGGGTAGAAGACTGGGC  633
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGGGTGGAGTCTTGGGTGTCAAGGGAAGCCTGGGTAGAAGACTGGGC  642

seq1  AACTGGTGCCTCTATGGGAATAGGGAGTGATGGGGGAAAGGAAGGTGGGA  683
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGGTGCCTCTATGGGAATAGGGAGTGATGGGGGAAAGGAAGGTGGGA  692

seq1  ACTTTGAGTGAGGGAATGTTCTATAGTGTGGTGAGATGCAGGCTACACAA  733
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTGAGTGAGGGAATGTTCTATAGTGTGGTGAGATGCAGGCTACACAA  742

seq1  ATACATAAAATCATCATAGGCTCGGGTTTTCACTGTGGAAATTTATATAC  783
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACATAAAATCATCATAGGCTCGGGTTTTCACTGTGGAAATTTATATAC  792

seq1  AAAATCGTAGCCTGTGTGTGGAGGTGGGTAGTGTCACAGTCGGCTGTCAG  833
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATCGTAGCCTGTGTGTGGAGGTGGGTAGTGTCACAGTCGGCTGTCAG  842

seq1  CACAAAATCAGAGGTCCGAGGGCTCACTAGTGTCGTGTAGAAAGTCTTGG  883
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAAAATCAGAGGTCCGAGGGCTCACTAGTGTCGTGTAGAAAGTCTTGG  892

seq1  ATTCAATCCACAGCATCACACAGACCAAGTATGGTGGTGACTGGCTGCAA  933
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCAATCCACAGCATCACACAGACCAAGTATGGTGGTGACTGGCTGCAA  942

seq1  TCCCAGCGAGGTGAATGCAGGATGCTTAGGTTATCCTCTGCTACATGGTG  983
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAGCGAGGTGAATGCAGGATGCTTAGGTTATCCTCTGCTACATGGTG  992

seq1  AACTTGAGGCTCCATGGTTGGATTAAAAAATGTGACAGAGCAGGTACCAT  1033
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTGAGGCTCCATGGTTGGATTAAAAAATGTGACAGAGCAGGTACCAT  1042

seq1  GCACGGAATGCAGATGTTGGTGAGGCTGACGAGAGCTGGCTGGTGTGTGG  1083
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACGGAATGCAGATGTTGGTGAGGCTGACGAGAGCTGGCTGGTGTGTGG  1092

seq1  CACTCACTGGATGGTTCTCTCAGCTTTGCTGTACACGTGAATTC  1127
      ||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCACTGGATGGTTCTCTCAGCTTTGCTGTACACGTGAATTC  1136

seq1: chr2_153594052_153595115
seq2: B6Ng01-195N14.g_67_1140

seq1  GAATTCAGAGGAAAATCCAGGCTCAGTGATTAACAATGCCAAAAAAAGAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGAGGAAAATCCAGGCTCAGTGATTAACAATGCCAAAAAAAGAA  50

seq1  AAAAAAAAAACAAACAAAAAGCAAGTAACGAGCCATTGTTCAAACGACAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAAACAAACAAAAAGCAAGTAACGAGCCATTGTTCAAACGACAG  100

seq1  CGGTGCTGTTTCTCCTCTGTGGCCTTTCAGACTTCTGTTGCCCCCAAATT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGTGCTGTTTCTCCTCTGTGGCCTTTCAGACTTCTGTTGCCCCCAAATT  150

seq1  CCATTTTATTGGGAACCCATTTTCCACCTGGTCTTTCTTGACAGGGTTTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTTTATTGGGAACCCATTTTCCACCTGGTCTTTCTTGACAGGGTTTT  200

seq1  TTTCTACTTTAAACAGTTTTTAAATAAAATTCTGTATTTCAAGAGTGTCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTACTTTAAACAGTTTTTAAATAAAATTCTGTATTTCAAGAGTGTCC  250

seq1  TGTCTTCTGAAATGTGTCTTGCCTTGGGTATAAGCTTTTAATTCTAGAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTTCTGAAATGTGTCTTGCCTTGGGTATAAGCTTTTAATTCTAGAGG  300

seq1  TAAGATAGCTATGCATCCATCTTTGGCTGAGCTTAGACAGAGGCTGAGAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGATAGCTATGCATCCATCTTTGGCTGAGCTTAGACAGAGGCTGAGAA  350

seq1  ATGATTCCCACCGTCTTAAATAGGACTAATCTTTTAAAATCCCTCACTTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATTCCCACCGTCTTAAATAGGACTAATCTTTTAAAATCCCTCACTTT  400

seq1  TCTCAAGCTAACTAATCTGGCTCTCCCCTTCCTCTATCCTCCTTTCTCCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCAAGCTAACTAATCTGGCTCTCCCCTTCCTCTATCCTCCTTTCTCCT  450

seq1  TCTCCCTTCCTTCCTCCCTCTTTTTCCTCTTCCTCCCTCCTTTTGGTTTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCTTCCTTCCTCCCTCTTTTTCCTCTTCCTCCCTCCTTTTGGTTTT  500

seq1  TAAGACAGAGCTTTTAGTATTGTTGTCCTGATTGGCCTCATATTTGTCAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGACAGAGCTTTTAGTATTGTTGTCCTGATTGGCCTCATATTTGTCAC  550

seq1  AGTCCTTCTTCCTCATTCTCTTGAAAGATTATGTGTGTGTGCCATCGTGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCTTCTTCCTCATTCTCTTGAAAGATTATGTGTGTGTGCCATCGTGC  600

seq1  CTGGCTTAAAATTGCTTATTTTGAATTCTTTTTAAAAAAAAAAATCACAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCTTAAAATTGCTTATTTTGAATTCTTTTTAAAAAAAAAAATCACAT  650

seq1  TACATTTTTCAGTCTTCTACTGCTTTAAATTCCTGTTACCCTGAGAAGGT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATTTTTCAGTCTTCTACTGCTTTAAATTCCTGTTACCCTGAGAAGGT  700

seq1  TTTCCTCACAGAAACAGAAAGCCTGACCTAGTTGCTTAAGGCTC-TTAGG  749
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  TTTCCTCACAGAAACAGAAAGCCTGACCTAGTTGCTTAAGGCTCTTTAGG  750

seq1  AATGTAGTTGGCCGGTGTTTGGCAGATGATTTAATTGGAGGTAATTGTTT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTAGTTGGCCGGTGTTTGGCAGATGATTTAATTGGAGGTAATTGTTT  800

seq1  CA-TTGTCCTGAAAATGCATTTACAAAGTCAG-TTAGTACACTCTTAAAC  847
      || ||||||||||||||||||||||||||||| |||||||||||||||||
seq2  CATTTGTCCTGAAAATGCATTTACAAAGTCAGTTTAGTACACTCTTAAAC  850

seq1  TGGAGAGTAAAGTTGTTGCTTCTTAAAACTGTTCTATAAAGTCCTACACC  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGAGTAAAGTTGTTGCTTCTTAAAACTGTTCTATAAAGTCCTACACC  900

seq1  TTT--GAGAATGAGTTGAAAATATGATCCTCTCCTGTTGTTG-TCTTGAA  944
      |||   |||||||||||||||||||||||||||||||||||| |||||||
seq2  TTTTGAAGAATGAGTTGAAAATATGATCCTCTCCTGTTGTTGTTCTTGAA  950

seq1  ATGTTAAAT-AGGCAGAAAGGTAATTCATCTGCTC-TTGAGAGTACCATG  992
      ||||||||| ||||||||||||||||||||||||| ||||||||||||||
seq2  ATGTTAAATAAGGCAGAAAGGTAATTCATCTGCTCTTTGAGAGTACCATG  1000

seq1  TACAGTACCCTGGCTGCTGTGGAAGTGATCTT-GAGAGTACCAC-GTACA  1040
      |||||||||||||||||||||||||||||||| ||||||||||| |||||
seq2  TACAGTACCCTGGCTGCTGTGGAAGTGATCTTGGAGAGTACCACGGTACA  1050

seq1  GTACTCT-GGCTGCTGTGGAAGTGG  1064
      ||||||| ||||||||||| |||||
seq2  GTACTCTGGGCTGCTGTGG-AGTGG  1074

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information