MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-216I04
Chromosome	2 (Build37)
Map Location	22,845,216 - 23,017,830
singlet/doublet	doublet
Overlap gene	Abi1, 1200016E24Rik, Acbd5, Mastl, Yme1l1
Upstream gene	LOC637235, Myo3a, LOC100041703, Myo3a, Gad2, Apbb1ip, Pdss1
Downstream gene	4931423N10Rik, LOC664835, Nxph2, LOC664822, 4921517N04Rik, LOC100039149, Sh3d2c-ps1, Hnmt, Tbpl2, Il1f8
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC637235 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 ESTs, 3 Proteins pseudo : _no_value

name	Myo3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667663 MGI:2183924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041703 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 155 ESTs, 13 Proteins

name	Myo3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667663 MGI:2183924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gad2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14417 MGI:95634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apbb1ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54519 MGI:1861354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56075 MGI:1889278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11308 MGI:104913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	1200016E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319202 MGI:2441660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 40 ESTs

name	Acbd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74159 MGI:1921409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mastl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67121 MGI:1914371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yme1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27377 MGI:1351651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931423N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70981 MGI:1918231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 4 Proteins

name	LOC664835 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 134 ESTs, 8 Proteins pseudo : _no_value

name	Nxph2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18232 MGI:107491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 126 ESTs, 26 Proteins pseudo : _no_value

name	4921517N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76857 MGI:1924107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039149 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Sh3d2c-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20406 MGI:1313300
definition	note : SH3 domain protein 2C, pseudogene 1 pseudo : _no_value

name	Hnmt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140483 MGI:2153181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbpl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227606 MGI:2684058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1f8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69677 MGI:1916927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380640 GeneID:667663 MGI:2183924
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IIIA transcript_id : NM_148413.1

name	LOC100041703 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248946 GeneID:100041703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 155 ESTs, 13 Proteins product : similar to G protein gamma-5 subunit transcript_id : XM_001477173.1

name	Myo3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380640 GeneID:667663 MGI:2183924
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IIIA transcript_id : NM_148413.1

name	Gad2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517708 GeneID:14417 MGI:95634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamic acid decarboxylase 2 transcript_id : NM_008078.2

name	Apbb1ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328064 GeneID:54519 MGI:1861354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein transcript_id : NM_019456.1

name	Pdss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90577180 GeneID:56075 MGI:1889278
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prenyl (solanesyl) diphosphate synthase, subunit 1 transcript_id : NM_019501.3

name	Abi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089350 GeneID:11308 MGI:104913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abl-interactor 1 transcript_id : NM_001077193.1

name	Abi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089342 GeneID:11308 MGI:104913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abl-interactor 1 transcript_id : NM_001077192.1

name	Abi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089346 GeneID:11308 MGI:104913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abl-interactor 1 transcript_id : NM_007380.2

name	Abi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089344 GeneID:11308 MGI:104913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abl-interactor 1 transcript_id : NM_145994.1

name	Abi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089340 GeneID:11308 MGI:104913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abl-interactor 1 transcript_id : NM_001077190.1

name	1200016E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249214 GeneID:319202 MGI:2441660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 40 ESTs product : RIKEN cDNA 1200016E24 gene transcript_id : XM_001472371.1

name	Acbd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892632 GeneID:74159 MGI:1921409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A binding domain containing 5 transcript_id : NM_028793.2

name	Mastl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383836 GeneID:67121 MGI:1914371
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule associated serine/threonine kinase-like transcript_id : NM_025979.3

name	Yme1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383574 GeneID:27377 MGI:1351651
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : YME1-like 1 (S. cerevisiae) transcript_id : NM_013771.3

name	4931423N10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366275 GeneID:70981 MGI:1918231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 4 Proteins product : RIKEN cDNA 4931423N10 gene transcript_id : XM_130063.4

name	Nxph2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379890 GeneID:18232 MGI:107491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurexophilin 2 transcript_id : NM_008752.2

name	4921517N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079700 GeneID:76857 MGI:1924107
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921517N04 gene transcript_id : NM_029773.1

name	LOC100039149 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249219 GeneID:100039149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100039149 transcript_id : XM_001472660.1

name	Hnmt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922616 GeneID:140483 MGI:2153181
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histamine N-methyltransferase transcript_id : NM_080462.2

name	Tbpl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39979629 GeneID:227606 MGI:2684058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TATA box binding protein like 2 transcript_id : NM_199059.1

name	Il1f8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382420 GeneID:69677 MGI:1916927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 family, member 8 transcript_id : NM_027163.3

name	Myo3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380641 GeneID:667663 MGI:2183924
definition	codon_start : 1 exception : unclassified translation discrepancy product : myosin IIIA protein_id : NP_680779.1

name	LOC100041703 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248947 GeneID:100041703
definition	codon_start : 1 product : similar to G protein gamma-5 subunit protein_id : XP_001477223.1

name	Myo3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380641 GeneID:667663 MGI:2183924
definition	codon_start : 1 exception : unclassified translation discrepancy product : myosin IIIA protein_id : NP_680779.1

name	Gad2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517709 CCDS:CCDS15724.1 GeneID:14417 MGI:95634
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0004351 - glutamate decarboxylase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0019752 - carboxylic acid metabolism [Evidence IEA]; GO:0042136 - neurotransmitter biosynthesis [Evidence IEA]; GO:0007268 - synaptic transmission [Evidence IEA] codon_start : 1 note : glutamate decarboxylase 65 product : glutamic acid decarboxylase 2 protein_id : NP_032104.2

name	Apbb1ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328065 GeneID:54519 MGI:1861354
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : proline-rich protein 48 product : amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein protein_id : NP_062329.1

name	Pdss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90577181 GeneID:56075 MGI:1889278
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046982 - protein heterodimerization activity [Evidence IDA]; GO:0000010 - trans-hexaprenyltranstransferase activity [Evidence IDA]; GO:0050347 - trans-octaprenyltranstransferase activity [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008299 - isoprenoid biosynthesis [Evidence IEA] [Evidence IDA]; GO:0051290 - protein heterotetramerization [Evidence IPI]; GO:0006744 - ubiquinone biosynthesis [Evidence IDA] [Evidence IPI] codon_start : 1 note : subunit 1 of solanesyl diphosphate synthase; trans-prenyltransferase product : prenyl diphosphate synthase, subunit 1 protein_id : NP_062374.2

name	Abi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089351 GeneID:11308 MGI:104913
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030296 - protein tyrosine kinase activator activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA] [Evidence IPI]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 note : isoform 5 is encoded by transcript variant 5; ablphilin-1; eps8 binding protein; spectrin SH3 domain binding protein 1; abelson interactor 1 product : spectrin SH3 domain binding protein 1 isoform 5 protein_id : NP_001070661.1

name	Abi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089343 GeneID:11308 MGI:104913
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030296 - protein tyrosine kinase activator activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA] [Evidence IPI]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; ablphilin-1; eps8 binding protein; spectrin SH3 domain binding protein 1; abelson interactor 1 product : spectrin SH3 domain binding protein 1 isoform 4 protein_id : NP_001070660.1

name	Abi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089347 GeneID:11308 MGI:104913
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030296 - protein tyrosine kinase activator activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA] [Evidence IPI]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; ablphilin-1; eps8 binding protein; spectrin SH3 domain binding protein 1; abelson interactor 1 product : spectrin SH3 domain binding protein 1 isoform 3 protein_id : NP_031406.2

name	Abi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089345 GeneID:11308 MGI:104913
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030296 - protein tyrosine kinase activator activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA] [Evidence IPI]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ablphilin-1; eps8 binding protein; spectrin SH3 domain binding protein 1; abelson interactor 1 product : spectrin SH3 domain binding protein 1 isoform 2 protein_id : NP_666106.1

name	Abi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089341 GeneID:11308 MGI:104913
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030296 - protein tyrosine kinase activator activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA] [Evidence IPI]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ablphilin-1; eps8 binding protein; spectrin SH3 domain binding protein 1; abelson interactor 1 product : spectrin SH3 domain binding protein 1 isoform 1 protein_id : NP_001070658.1

name	1200016E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249215 GeneID:319202 MGI:2441660
definition	codon_start : 1 product : hypothetical protein LOC319202 protein_id : XP_001472421.1

name	Acbd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229192 GeneID:74159 MGI:1921409
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0000062 - acyl-CoA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : acyl-Coenzyme A binding domain containing 5 protein_id : NP_083069.1

name	Mastl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29568088 CCDS:CCDS15727.1 GeneID:67121 MGI:1914371
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : microtubule associated serine/threonine kinase-like protein_id : NP_080255.2

name	Yme1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305635 CCDS:CCDS15728.1 GeneID:27377 MGI:1351651
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IEA] codon_start : 1 note : ATP-dependent metalloprotease FtsH1 product : YME1-like 1 protein_id : NP_038799.1

name	4931423N10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249216 GeneID:70981 MGI:1918231
definition	codon_start : 1 product : hypothetical protein LOC70981 protein_id : XP_130063.5

name	Nxph2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468865 CCDS:CCDS15729.1 GeneID:18232 MGI:107491
definition	GO_function : GO:0005102 - receptor binding [Evidence TAS] codon_start : 1 product : neurexophilin 2 protein_id : NP_032778.1

name	4921517N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079701 CCDS:CCDS15730.1 GeneID:76857 MGI:1924107
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC76857 protein_id : NP_084049.1

name	LOC100039149 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249220 GeneID:100039149
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472710.1

name	Hnmt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17978276 CCDS:CCDS15731.1 GeneID:140483 MGI:2153181
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046539 - histamine N-methyltransferase activity [Evidence IEA]; GO:0008170 - N-methyltransferase activity [Evidence IDA] GO_process : GO:0001505 - regulation of neurotransmitter levels [Evidence TAS] codon_start : 1 product : histamine N-methyltransferase protein_id : NP_536710.1

name	Tbpl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39979630 CCDS:CCDS15732.1 GeneID:227606 MGI:2684058
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006367 - transcription initiation from RNA polymerase II promoter [Evidence IEA] codon_start : 1 note : TBP-related factor 3 (Trf3) product : TBP-related factor 3 protein_id : NP_951014.1

name	Il1f8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601193 GeneID:69677 MGI:1916927
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 product : interleukin 1 family, member 8 protein_id : NP_081439.1

name	LOC637235 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149248930 GeneID:637235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 ESTs, 3 Proteins product : similar to 3-phosphoglycerate dehydrogenase pseudo : _no_value transcript_id : XR_032647.1

name	LOC664835 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249217 GeneID:664835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 134 ESTs, 8 Proteins product : similar to protein-tyrosine phosphatase pseudo : _no_value transcript_id : XR_030736.1

name	LOC664822 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249218 GeneID:664822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 126 ESTs, 26 Proteins product : similar to ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) pseudo : _no_value transcript_id : XR_030808.1

clone name	MSMg01-475B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215J08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-477L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159I07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-468E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265M17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-216I04.b	B6Ng01-216I04.g
ACC	GA033181	GA033182
length	1,122	1,094
definition	B6Ng01-216I04.b	B6Ng01-216I04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(23,016,714 - 23,017,830)	(22,845,216 - 22,846,304)
sequence	gaattccctaataatgcccttaaataagtgacatcactgaaaccaaaaga gccagttaagcattctgagtcacaatgaagtgaaaggcttcacaaagttt tccttctcgtcatataaagcactgtgacatggttccaacctaacaaccat ctgtcacttataagaataattatctgctggatggagtacagagaaacaga ctatgttgcgacagaacctccactgtaatataattgttctttcattattg ttattaatcttattaacttataaattcaaccttatagtattttcactact gaggctttcttgaactgtatgattggaaagtagaatgatcaagagaagaa aagcaatggagagcctacagaaaggagcaagagggattgggcaaataggg taaaataaagtacaaatatgacaagacaaacttcccatgtagtcaaaata tgtgttatcatgccaggcatggtggggcacacatgcaatcctagcagaag gtccctgagttcaagatcctacccatgatgaccataaccacctcaagcga gcttctttcctattttcctctactgtcttctgccataggtcctgatgtca aaactaagaacatccagtatatacaggttaaaagttttaaaaaacttcac acttttttcttcaataaaaagtgcgctcaggaggcagaggcaggcagatc tctgagttcaaggtcagcctggtctacagagtgagttccaggacaaccag ggatacacagagaaacattatcttgaagaagaaaaaaaaacaaagaaaaa gaaagaaagattctgcgcttttaactatcttattaataaaatttgtaaac agaaaaggttcttagtccatgacttgctgaatccttgcacactgtccatc agcgacttcatgattataaaaaatactgaaagtgtagtttccctgcttat agatctactttcaagtactatgctctgttattgttgtgttttggttcttt aattgactgtttgagctagagtaccaggctgaagactcagccatgccctc atccccatttaattatcatacgcagttagaaagtgaatgctatcacctgg tgctgctgacctttccctaaga	gaattcttggattaatgcttcatatcactcccaggtggagtggagaagag taatttacttcacattattcattgcaattggctattgttacttgttgctt ggccactagacactttactcctgtggctcctcttaaacctatatacaaat tgtctaatgctctgaataaagttggttagtgcatgagactttagtccacc tcatatattcgctccattttctcaggtctcaccacctctagagcagtaaa aatgaggcttaaagagaagaggtgtagtactaaaatttcctcaagagcta tgaaagggggaacagaaaaagcatgaaaatcctttcagcccgaaaagcaa caacaaaagccacttgttcaggtccaaaacaagtttctatgctgtacatc tttagtattcctgaagactccacaatgatgaggaaggcaatggctctatt aggtccaaacagagcattaactgagccacctgagcagtgctgatctcaac aggaaacagtattctaatggtgaatggtatgaggactacataaactgata aagatagattgacggtcccacaattaaccttaagcaagtttggcttaaaa ggcctgaaggaagcaaatctaacctctacacttctgttacagaaaggaaa tattcagtcaaacattcataactgttcgctgcatttgttatcaagtgtaa tgtgccatttgattaagaaaacagtgagaagcacatttccatcaatggtt aagaggatgtgtatctgcaagtactactctaactacttagatcacactga tatgtcaaagacctaataaaaatataattgtgattattacaatatttgct tcttatgtccaatgactaaaaggtaggtatatatacttataaatatattt gtggggatttctaaaacattgaggcttcttacgtaaatacatctcatctc atacttagtaaactattgctattatttattctgccaatctttacatttcc atctttgtcattcatcatatttataaataagactaggaaaataattccca tacataacttaattgtatgttttaaataactggaatttaaacta
quality values	Open. Hide. 58 36 25 31 58 58 58 58 58 62 62 62 62 62 28 41 54 62 62 46 62 62 62 62 62 56 47 47 47 54 54 56 56 62 49 59 62 62 62 44 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 54 54 54 62 62 62 62 54 47 47 62 62 54 42 62 62 62 62 62 62 62 58 54 58 58 58 58 58 49 54 58 58 58 58 52 58 58 58 58 54 49 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 54 58 45 54 58 49 58 54 58 58 58 58 58 58 58 54 54 58 58 58 52 58 54 58 58 58 58 54 54 37 54 58 42 54 54 54 41 52 58 58 50 54 51 52 49 51 58 54 54 58 52 58 52 58 58 50 53 51 51 38 42 51 53 58 47 53 53 52 51 50 54 58 36 46 51 58 58 58 50 50 58 58 51 53 58 58 58 58 58 50 58 58 50 50 50 48 43 50 50 58 58 58 48 52 54 51 46 50 50 46 58 58 51 51 51 41 51 58 58 58 51 39 35 49 36 58 32 20 51 35 50 39 36 15 32 50 53 49 46 28 41 39 53 39 42 52 53 53 50 58 37 58 38 37 29 35 20 58 24 41 42 39 49 51 35 39 37 32 52 42 39 42 39 42 54 42 45 50 47 33 50 35 37 39 30 27 33 33 29 32 41 37 50 40 28 22 39 42 32 32 39 30 40 32 40 53 23 48 54 40 35 29 47 47 45 45 40 37 49 47 42 53 31 54 31 11 36 54 54 54 54 54 52 52 47 44 27 53 49 27 51 54 54 54 35 29 53 54 42 31 32 47 33 32 42 31 31 45 34 31 29 21 40 47 53 52 27 12 30 31 31 16 33 42 53 32 33 25 21 16 25 20 35 53 52 41 34 53 48 39 20 14 46 18 26 29 26 33 51 46 22 12 30 15 13 31 37 34 43 18 17 28 28 18 30 30 32 31 34 39 43 18 31 29 32 37 29 20 51 26 39 35 31 27 31 24 31 31 43 30 26 30 31 32 31 31 23 36 9 32 18 33 31 33 26 32 33 31 28 18 9 5 5 37 42 46 48 22 25 31 32 31 21 27 48 31 27 32 29 9 31 21 32 41 25 11 46 9 11 31 22 32 21 15 8 9 21 26 31 25 46 10 19 31 46 33 26 16 21 37 14 15 14 19 7 23 31 13 14 27 21 28 13 16 31 17 30 13 5 10 9 22 10 13 44 28 38 9 20 32 13 14 14 44 25 22 30 14 32 33 13 13 26 29 25 44 15 26 33 14 26 27 22 16 29 27 10 9 7 10 15 32 23 33 15 21 20 6 5 24 24 32 31 13 24 19 11 22 24 7 18 31 17 9 9 19 17 19 39 48 34 26 32 48 12 33 19 15 18 9 24 9 9 4 3 5 4 10 13 10 8 6 7 8 24 28 20 5 5 24 6 11 13 10 14 24 10 13 10 6 7 15 7 6 15 9 19 27 16 16 23 24 20 26 12 13 13 29 8 11 25 15 6 9 6 5 16	Open. Hide. 62 47 51 42 62 62 62 62 62 62 47 42 54 59 38 29 29 43 62 62 59 43 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 48 58 58 52 52 58 48 58 54 58 58 58 58 54 41 58 58 58 54 58 58 58 58 54 54 58 54 54 45 58 58 58 54 49 58 58 58 58 58 58 54 47 58 49 52 54 54 58 58 54 58 58 49 54 54 58 58 58 49 58 58 58 58 58 58 58 52 58 58 58 58 42 54 58 37 41 58 58 58 51 58 58 50 58 58 54 50 51 49 54 49 51 51 54 51 58 58 51 58 50 46 50 43 58 54 53 58 51 58 54 52 53 58 53 53 58 49 41 36 16 39 54 58 54 36 23 44 58 44 34 52 49 58 58 50 49 32 28 58 50 54 51 51 53 41 50 26 53 58 54 53 52 58 29 41 34 39 32 49 58 26 33 52 36 39 58 43 50 42 39 51 42 37 35 50 49 28 58 58 51 39 47 58 53 39 42 26 22 35 52 58 40 51 41 39 41 49 52 53 41 51 58 54 50 29 46 39 50 45 35 39 40 42 51 31 21 33 37 49 50 52 24 35 29 31 54 40 39 39 25 33 27 36 18 54 54 54 40 37 35 31 34 49 47 40 47 29 25 34 37 42 30 36 36 53 40 53 28 53 37 28 28 40 54 30 33 42 34 28 36 54 16 33 31 29 52 37 49 37 45 38 42 42 45 37 32 40 33 41 32 42 34 37 37 40 53 21 12 26 31 37 28 53 45 32 26 31 42 32 29 23 32 33 32 31 52 37 28 29 31 52 31 30 27 49 40 18 34 14 46 19 26 32 32 25 46 51 46 27 28 29 26 15 27 31 27 46 26 34 31 16 20 26 16 33 31 31 25 31 31 36 32 51 42 31 31 14 21 30 41 30 26 31 31 30 33 31 31 29 25 41 36 31 34 18 46 46 25 19 13 6 31 33 31 17 12 9 24 30 14 27 26 38 31 38 16 30 30 46 32 32 21 34 26 34 46 31 31 19 31 48 48 32 34 18 47 29 29 32 32 47 48 31 23 32 24 13 25 32 21 26 23 33 17 27 21 21 14 15 20 30 36 48 22 14 10 17 7 22 21 34 32 32 34 36 34 16 12 22 14 14 31 21 25 16 24 28 44 25 31 20 19 8 28 25 22 25 18 12 9 14 31 44 15 19 18 6 8 18 26 15 15 12 22 24 21 13 47 33 20 22 14 32 43 26 11 12 22 33 27 22 36 25 31 19 32 21 32 32 24 20 32 32 28 8 4 5 43 14 4 7 7 31 6 8 16 22 10 4 12 19 13 5 12 18 30 34 20 6 6 6 11 14 17 34 15 18 6 6 7 5 8 15 6 11 13 8 21 27 13 6 9 5 18 13 18 5 34 32 21 12 28 24 7 6 7 18 7 17 7 32 15 3 47 13 19 28 7 27 16 19

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_23016714_23017830
seq2: B6Ng01-216I04.b_42_1163 (reverse)

seq1  TCTTAGGGAA--GTCAGCAGCAC--AGTGATAGCA-TCACTTTCT-ACTG  44
      ||||||||||  |||||||||||   ||||||||| ||||||||| ||||
seq2  TCTTAGGGAAAGGTCAGCAGCACCAGGTGATAGCATTCACTTTCTAACTG  50

seq1  CCTTAATGATAATTAAATGGGGATGAGGGCATGGCTGGAGTC-TCAGCCT  93
      | |  ||||||||||||||||||||||||||||||| ||||| |||||||
seq2  CGT--ATGATAATTAAATGGGGATGAGGGCATGGCT-GAGTCTTCAGCCT  97

seq1  -GTACTCTAGCTCAAACAGTCAATTAAAGAACAAAACAACAACAATAACA  142
       ||||||||||||||||||||||||||||||| |||  ||||||||||||
seq2  GGTACTCTAGCTCAAACAGTCAATTAAAGAACCAAAACACAACAATAACA  147

seq1  GAGCATAAGTACTTGAAAGTAAGATCTATAAGCA-GGAAACTACACTTTC  191
      |||||| ||||||||||||| ||||||||||||| |||||||||||||||
seq2  GAGCAT-AGTACTTGAAAGT-AGATCTATAAGCAGGGAAACTACACTTTC  195

seq1  AGTA-TTTTTATAATCATGAAGTCGCTGATGGACAGTGTGCAAGGATTCA  240
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTATTTTTTATAATCATGAAGTCGCTGATGGACAGTGTGCAAGGATTCA  245

seq1  GCAAGTCATGGACTAAGAACCTTTTCTGTTTACAAATTTTATTAATAAGA  290
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAGTCATGGACTAAGAACCTTTTCTGTTTACAAATTTTATTAATAAGA  295

seq1  TAGTTAAAAGCGCAGAATCTTTCTTTCTTTTTCTTTGTTTTTTTTTCTTC  340
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTAAAAGCGCAGAATCTTTCTTTCTTTTTCTTTGTTTTTTTTTCTTC  345

seq1  TTCAAGATAATGTTTCTCTGTGTATCCCTGGTTGTCCTGGAACTCACTCT  390
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAAGATAATGTTTCTCTGTGTATCCCTGGTTGTCCTGGAACTCACTCT  395

seq1  GTAGACCAGGCTGACCTTGAACTCAGAGATCTGCCTGCCTCTGCCTCCTG  440
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGACCAGGCTGACCTTGAACTCAGAGATCTGCCTGCCTCTGCCTCCTG  445

seq1  AGCGCACTTTTTATTGAAGAAAAAAGTGTGAAGTTTTTTAAAACTTTTAA  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGCACTTTTTATTGAAGAAAAAAGTGTGAAGTTTTTTAAAACTTTTAA  495

seq1  CCTGTATATACTGGATGTTCTTAGTTTTGACATCAGGACCTATGGCAGAA  540
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTATATACTGGATGTTCTTAGTTTTGACATCAGGACCTATGGCAGAA  545

seq1  GACAGTAGAGGAAAATAGGAAAGAAGCTCGCTTGAGGTGGTTATGGTCAT  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGTAGAGGAAAATAGGAAAGAAGCTCGCTTGAGGTGGTTATGGTCAT  595

seq1  CATGGGTAGGATCTTGAACTCAGGGACCTTCTGCTAGGATTGCATGTGTG  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGGTAGGATCTTGAACTCAGGGACCTTCTGCTAGGATTGCATGTGTG  645

seq1  CCCCACCATGCCTGGCATGATAACACATATTTTGACTACATGGGAAGTTT  690
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCACCATGCCTGGCATGATAACACATATTTTGACTACATGGGAAGTTT  695

seq1  GTCTTGTCATATTTGTACTTTATTTTACCCTATTTGCCCAATCCCTCTTG  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTGTCATATTTGTACTTTATTTTACCCTATTTGCCCAATCCCTCTTG  745

seq1  CTCCTTTCTGTAGGCTCTCCATTGCTTTTCTTCTCTTGATCATTCTACTT  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTTTCTGTAGGCTCTCCATTGCTTTTCTTCTCTTGATCATTCTACTT  795

seq1  TCCAATCATACAGTTCAAGAAAGCCTCAGTAGTGAAAATACTATAAGGTT  840
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAATCATACAGTTCAAGAAAGCCTCAGTAGTGAAAATACTATAAGGTT  845

seq1  GAATTTATAAGTTAATAAGATTAATAACAATAATGAAAGAACAATTATAT  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTTATAAGTTAATAAGATTAATAACAATAATGAAAGAACAATTATAT  895

seq1  TACAGTGGAGGTTCTGTCGCAACATAGTCTGTTTCTCTGTACTCCATCCA  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGTGGAGGTTCTGTCGCAACATAGTCTGTTTCTCTGTACTCCATCCA  945

seq1  GCAGATAATTATTCTTATAAGTGACAGATGGTTGTTAGGTTGGAACCATG  990
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGATAATTATTCTTATAAGTGACAGATGGTTGTTAGGTTGGAACCATG  995

seq1  TCACAGTGCTTTATATGACGAGAAGGAAAACTTTGTGAAGCCTTTCACTT  1040
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAGTGCTTTATATGACGAGAAGGAAAACTTTGTGAAGCCTTTCACTT  1045

seq1  CATTGTGACTCAGAATGCTTAACTGGCTCTTTTGGTTTCAGTGATGTCAC  1090
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGTGACTCAGAATGCTTAACTGGCTCTTTTGGTTTCAGTGATGTCAC  1095

seq1  TTATTTAAGGGCATTATTAGGGAATTC  1117
      |||||||||||||||||||||||||||
seq2  TTATTTAAGGGCATTATTAGGGAATTC  1122

seq1: chr2_22845216_22846304
seq2: B6Ng01-216I04.g_65_1158

seq1  GAATTCTTGGATTAATGCTTCATATCACTCCCAGGTGGAGTGGAGAAGAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTGGATTAATGCTTCATATCACTCCCAGGTGGAGTGGAGAAGAG  50

seq1  TAATTTACTTCACATTATTCATTGCAATTGGCTATTGTTACTTGTTGCTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTTACTTCACATTATTCATTGCAATTGGCTATTGTTACTTGTTGCTT  100

seq1  GGCCACTAGACACTTTACTCCTGTGGCTCCTCTTAAACCTATATACAAAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCACTAGACACTTTACTCCTGTGGCTCCTCTTAAACCTATATACAAAT  150

seq1  TGTCTAATGCTCTGAATAAAGTTGGTTAGTGCATGAGACTTTAGTCCACC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTAATGCTCTGAATAAAGTTGGTTAGTGCATGAGACTTTAGTCCACC  200

seq1  TCATATATTCGCTCCATTTTCTCAGGTCTCACCACCTCTAGAGCAGTAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATATATTCGCTCCATTTTCTCAGGTCTCACCACCTCTAGAGCAGTAAA  250

seq1  AATGAGGCTTAAAGAGAAGAGGTGTAGTACTAAAATTTCCTCAAGAGCTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAGGCTTAAAGAGAAGAGGTGTAGTACTAAAATTTCCTCAAGAGCTA  300

seq1  TGAAAGGGGGAACAGAAAAAGCATGAAAATCCTTTCAGCCCGAAAAGCAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAAGGGGGAACAGAAAAAGCATGAAAATCCTTTCAGCCCGAAAAGCAA  350

seq1  CAACAAAAGCCACTTGTTCAGGTCCAAAACAAGTTTCTATGCTGTACATC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACAAAAGCCACTTGTTCAGGTCCAAAACAAGTTTCTATGCTGTACATC  400

seq1  TTTAGTATTCCTGAAGACTCCACAATGATGAGGAAGGCAATGGCTCTATT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGTATTCCTGAAGACTCCACAATGATGAGGAAGGCAATGGCTCTATT  450

seq1  AGGTCCAAACAGAGCATTAACTGAGCCACCTGAGCAGTGCTGATCTCAAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCCAAACAGAGCATTAACTGAGCCACCTGAGCAGTGCTGATCTCAAC  500

seq1  AGGAAACAGTATTCTAATGGTGAATGGTATGAGGACTACATAAACTGATA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAACAGTATTCTAATGGTGAATGGTATGAGGACTACATAAACTGATA  550

seq1  AAGATAGATTGACGGTCCCACAATTAACCTTAAGCAAGTTTGGCTTAAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATAGATTGACGGTCCCACAATTAACCTTAAGCAAGTTTGGCTTAAAA  600

seq1  GGCCTGAAGGAAGCAAATCTAACCTCTACACTTCTGTTACAGAAAGGAAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTGAAGGAAGCAAATCTAACCTCTACACTTCTGTTACAGAAAGGAAA  650

seq1  TATTCAGTCAAACATTCATAACTGTTCGCTGCATTTGTTATCAAGTGTAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCAGTCAAACATTCATAACTGTTCGCTGCATTTGTTATCAAGTGTAA  700

seq1  TGTGCCATTTGATTAAGAAAACAGTGAGAAGCACATTTCCATCAATGGTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCCATTTGATTAAGAAAACAGTGAGAAGCACATTTCCATCAATGGTT  750

seq1  AAGAGGATGTGTATCTGCAAGTACTACTCTAACTACTTAGATCACACTGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGGATGTGTATCTGCAAGTACTACTCTAACTACTTAGATCACACTGA  800

seq1  TATGTCAAAGACCTAATAAAAATATAATTGTGATTATTACAATATTTGCT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTCAAAGACCTAATAAAAATATAATTGTGATTATTACAATATTTGCT  850

seq1  TCTTATGTCCAATGACTAAAAGGTAGGTATATATACTTATAAATATATTT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTATGTCCAATGACTAAAAGGTAGGTATATATACTTATAAATATATTT  900

seq1  GTGGGGATTTCTAAAACATTGAGGCTTCTTACGTAAATACATCTCATCTC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGGATTTCTAAAACATTGAGGCTTCTTACGTAAATACATCTCATCTC  950

seq1  ATACTTAGTAAACTATTGCTA-TATTTA-TCTGCCAATCTTTACATTTCC  998
      ||||||||||||||||||||| |||||| |||||||||||||||||||||
seq2  ATACTTAGTAAACTATTGCTATTATTTATTCTGCCAATCTTTACATTTCC  1000

seq1  ATCTTTGTCATTCATCATATTTATAAATAAGACTAGGAAAATATTTCCCA  1048
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  ATCTTTGTCATTCATCATATTTATAAATAAGACTAGGAAAATAATTCCCA  1050

seq1  TACATAACT--AATGTATG-TTTAAATAACTGAAATTTAAACTA  1089
      |||||||||  | |||||| |||||||||||| |||||||||||
seq2  TACATAACTTAATTGTATGTTTTAAATAACTGGAATTTAAACTA  1094

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information