MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-219K15
Chromosome	2 (Build37)
Map Location	167,472,130 - 167,680,631
singlet/doublet	doublet
Overlap gene	AI840826, Cebpb
Upstream gene	BC067047, Trp53rk, Arfgef2, LOC670802, Cse1l, Stau1, LOC383774, Ddx27, AI481105, 1500012F01Rik, LOC668950, Kcnb1, Ptgis, LOC668951, B4galt5, Slc9a8, Spata2, Zfp313, Snai1, Ube2v1
Downstream gene	LOC100043728, Ptpn1, 2310033K02Rik, Pard6b, Adnp, Dpm1, Mocs3, LOC100043908, Kcng1, LOC668952, Nfatc2, Atp9a, Sall4
Link	Open Mouse BAC browser

Click to get alignment info.

name	BC067047 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277360 MGI:3040696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trp53rk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76367 MGI:1914050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arfgef2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99371 MGI:2139354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 147 ESTs, 20 Proteins

name	LOC670802 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Cse1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110750 MGI:1339951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stau1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20853 MGI:1338864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383774 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	Ddx27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228889 MGI:2385884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI481105 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98999 MGI:2138982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500012F01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68949 MGI:1916199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 2 Proteins

name	Kcnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16500 MGI:96666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptgis (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19223 MGI:1097156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	B4galt5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56336 MGI:1927169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc9a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77031 MGI:1924281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Spata2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:263876 MGI:2146885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp313 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81018 MGI:1933159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snai1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20613 MGI:98330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2v1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66589 MGI:1913839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI840826 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407243 MGI:2142624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cebpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12608 MGI:88373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs

name	Ptpn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19246 MGI:97805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310033K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69553 MGI:1916803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pard6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58220 MGI:2135605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adnp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11538 MGI:1338758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13480 MGI:1330239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mocs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69372 MGI:1916622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 35 ESTs, 6 Proteins

name	LOC100043908 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043908
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Kcng1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241794 MGI:3616086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668952 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Nfatc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18019 MGI:102463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Atp9a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11981 MGI:1330826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sall4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99377 MGI:2139360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	BC067047 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517733 GeneID:277360 MGI:3040696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC067047 transcript_id : NM_177782.3

name	Trp53rk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130623 GeneID:76367 MGI:1914050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 regulating kinase transcript_id : NM_023815.4

name	Arfgef2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367432 GeneID:99371 MGI:2139354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 147 ESTs, 20 Proteins product : ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) transcript_id : XM_130646.7

name	LOC670802 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250113 GeneID:670802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical LOC670802 transcript_id : XM_001480821.1

name	Cse1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356854 GeneID:110750 MGI:1339951
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromosome segregation 1-like (S. cerevisiae) transcript_id : NM_023565.2

name	Stau1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130158 GeneID:20853 MGI:1338864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : staufen (RNA binding protein) homolog 1 (Drosophila) transcript_id : NM_011490.2

name	Ddx27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379510 GeneID:228889 MGI:2385884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 transcript_id : NM_153065.3

name	AI481105 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487310 GeneID:98999 MGI:2138982
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI481105 transcript_id : NM_001033196.2

name	1500012F01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487304 GeneID:68949 MGI:1916199
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500012F01 gene transcript_id : NM_001081005.1

name	LOC668950 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250260 GeneID:668950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 2 Proteins product : similar to RPL17 protein transcript_id : XM_001005073.2

name	Kcnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254348 GeneID:16500 MGI:96666
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage gated channel, Shab-related subfamily, member 1 transcript_id : NM_008420.3

name	Ptgis (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802458 GeneID:19223 MGI:1097156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin I2 (prostacyclin) synthase transcript_id : NM_008968.3

name	B4galt5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089305 GeneID:56336 MGI:1927169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5 transcript_id : NM_019835.2

name	Slc9a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46909603 GeneID:77031 MGI:1924281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 9 (sodium/hydrogen exchanger), member 8 transcript_id : NM_148929.2

name	Slc9a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46909604 GeneID:77031 MGI:1924281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 9 (sodium/hydrogen exchanger), member 8 transcript_id : NM_178371.3

name	Spata2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625966 GeneID:263876 MGI:2146885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 2 transcript_id : NM_170756.2

name	Zfp313 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892281 GeneID:81018 MGI:1933159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 313 transcript_id : NM_030743.5

name	Snai1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981483 GeneID:20613 MGI:98330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : snail homolog 1 (Drosophila) transcript_id : NM_011427.2

name	Ube2v1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326404 GeneID:66589 MGI:1913839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2 variant 1 transcript_id : NM_023230.2

name	AI840826 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130157 GeneID:407243 MGI:2142624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI840826 transcript_id : NM_145538.2

name	Cebpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227244 GeneID:12608 MGI:88373
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCAAT/enhancer binding protein (C/EBP), beta transcript_id : NM_009883.2

name	LOC100043728 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250116 GeneID:100043728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs product : hypothetical protein LOC100043728 transcript_id : XM_001480832.1

name	Ptpn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133505844 GeneID:19246 MGI:97805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 1 transcript_id : NM_011201.3

name	2310033K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123959721 GeneID:69553 MGI:1916803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310033K02 gene transcript_id : NM_001080708.1

name	Pard6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946765 GeneID:58220 MGI:2135605
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : par-6 (partitioning defective 6) homolog beta (C. elegans) transcript_id : NM_021409.1

name	Adnp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90093348 GeneID:11538 MGI:1338758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activity-dependent neuroprotective protein transcript_id : NM_009628.2

name	Dpm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114688043 GeneID:13480 MGI:1330239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dolichol-phosphate (beta-D) mannosyltransferase 1 transcript_id : NM_010072.3

name	Mocs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367439 GeneID:69372 MGI:1916622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 35 ESTs, 6 Proteins product : molybdenum cofactor synthesis 3 transcript_id : XM_130596.6

name	Kcng1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487486 GeneID:241794 MGI:3616086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily G, member 1 transcript_id : NM_001081134.1

name	Nfatc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:81295417 GeneID:18019 MGI:102463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 transcript_id : NM_010899.2

name	Nfatc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:81295411 GeneID:18019 MGI:102463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 transcript_id : NM_001037178.1

name	Nfatc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:81295420 GeneID:18019 MGI:102463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 transcript_id : NM_001037177.1

name	Atp9a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130946 GeneID:11981 MGI:1330826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, class II, type 9A transcript_id : NM_015731.3

name	Sall4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117553632 GeneID:99377 MGI:2139360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sal-like 4 (Drosophila) transcript_id : NM_201396.2

name	Sall4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117553622 GeneID:99377 MGI:2139360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sal-like 4 (Drosophila) transcript_id : NM_201395.2

name	Sall4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117553630 GeneID:99377 MGI:2139360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sal-like 4 (Drosophila) transcript_id : NM_175303.3

name	BC067047 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517734 GeneID:277360 MGI:3040696
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : SET domain containing 6 product : hypothetical protein LOC277360 protein_id : NP_808450.2

name	Trp53rk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560052 CCDS:CCDS17090.1 GeneID:76367 MGI:1914050
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : TP53 regulating kinase; Trp53 regulating kinase product : Nori-2 protein protein_id : NP_076304.2

name	Arfgef2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82887368 GeneID:99371 MGI:2139354
definition	codon_start : 1 product : ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) protein_id : XP_130646.6

name	LOC670802 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250114 GeneID:670802
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480871.1

name	Cse1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963737 CCDS:CCDS17092.1 GeneID:110750 MGI:1339951
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008262 - importin-alpha export receptor activity [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0000059 - protein import into nucleus, docking [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : chromosome segregation 1-like protein_id : NP_076054.1

name	Stau1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755674 CCDS:CCDS17093.1 GeneID:20853 MGI:1338864
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IDA] GO_function : GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IDA] GO_process : GO:0008298 - intracellular mRNA localization [Evidence IDA] codon_start : 1 note : staufen product : staufen (RNA binding protein) homolog 1 protein_id : NP_035620.1

name	Ddx27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249330 GeneID:228889 MGI:2385884
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : RNA-helicase like protein; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 protein_id : NP_694705.2

name	AI481105 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487311 GeneID:98999 MGI:2138982
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger, NFX1-type containing 1 protein_id : NP_001028368.2

name	1500012F01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487305 GeneID:68949 MGI:1916199
definition	codon_start : 1 product : hypothetical protein LOC68949 protein_id : NP_001074474.1

name	LOC668950 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250261 GeneID:668950
definition	codon_start : 1 product : similar to RPL17 protein protein_id : XP_001005073.2

name	Kcnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560819 CCDS:CCDS17096.1 GeneID:16500 MGI:96666
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence ISS] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium voltage gated channel Shab-related subfamily member 1 product : potassium voltage gated channel, Shab-related subfamily, member 1 protein_id : NP_032446.2

name	Ptgis (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679535 CCDS:CCDS17097.1 GeneID:19223 MGI:1097156
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008116 - prostaglandin-I synthase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0001516 - prostaglandin biosynthesis [Evidence IEA] codon_start : 1 note : prostacyclin synthase; prostaglandin I2 synthase product : prostaglandin I2 (prostacyclin) synthase protein_id : NP_032994.1

name	B4galt5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089306 CCDS:CCDS17098.1 GeneID:56336 MGI:1927169
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 note : beta-1,4-galactosyltransferase V; UDP-Gal:betaGlcNAc beta 1 4-galactosyltransferase polypeptide 5 product : UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5 protein_id : NP_062809.2

name	Slc9a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507327 GeneID:77031 MGI:1924281
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015297 - antiporter activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015385 - sodium:hydrogen antiporter activity [Evidence IEA]; GO:0015299 - solute:hydrogen antiporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006885 - regulation of pH [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; Na-H exchanger isoform NHE8; sodium/proton exchanger NHE8; solute carrier family 9 (sodium/hydrogen exchanger) member 8 product : Na-H exchanger isoform NHE8 isoform a protein_id : NP_683731.1

name	Slc9a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909605 GeneID:77031 MGI:1924281
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015297 - antiporter activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015385 - sodium:hydrogen antiporter activity [Evidence IEA]; GO:0015299 - solute:hydrogen antiporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006885 - regulation of pH [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; Na-H exchanger isoform NHE8; sodium/proton exchanger NHE8; solute carrier family 9 (sodium/hydrogen exchanger) member 8 product : Na-H exchanger isoform NHE8 isoform b protein_id : NP_848458.2

name	Spata2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25054856 CCDS:CCDS17100.1 GeneID:263876 MGI:2146885
definition	codon_start : 1 product : spermatogenesis associated 2 protein_id : NP_739562.1

name	Zfp313 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229275 CCDS:CCDS17101.1 GeneID:81018 MGI:1933159
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 product : zinc finger protein 313 protein_id : NP_109668.2

name	Snai1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755586 CCDS:CCDS17102.1 GeneID:20613 MGI:98330
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0031069 - hair follicle morphogenesis [Evidence IDA] codon_start : 1 product : snail homolog 1 protein_id : NP_035557.1

name	Ube2v1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42741690 CCDS:CCDS17103.1 GeneID:66589 MGI:1913839
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : ubiquitin-conjugating enzyme E2 variant 1 protein_id : NP_075719.1

name	AI840826 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704060 CCDS:CCDS17104.1 GeneID:407243 MGI:2142624
definition	codon_start : 1 product : ubiquitin-conjugating enzyme variant Kua protein_id : NP_663513.1

name	Cebpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753404 CCDS:CCDS17105.1 GeneID:12608 MGI:88373
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0046982 - protein heterodimerization activity [Evidence IDA]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0001892 - embryonic placenta development [Evidence IGI]; GO:0045444 - fat cell differentiation [Evidence IDA]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0030182 - neuron differentiation [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045408 - regulation of interleukin-6 biosynthesis [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : DNA binding protein note : C/EBP BETA; nuclear protein Il6; CCAAT/enhancer binding protein (C/EBP) beta product : CCAAT/enhancer binding protein beta protein_id : NP_034013.1

name	LOC100043728 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250117 GeneID:100043728
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480882.1

name	Ptpn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133505845 CCDS:CCDS17107.1 GeneID:19246 MGI:97805
definition	EC_number : 3.1.3.48 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008286 - insulin receptor signaling pathway [Evidence IMP]; GO:0006470 - protein amino acid dephosphorylation [Evidence IMP] codon_start : 1 note : protein-protein-tyrosine phosphatase HA2 product : protein tyrosine phosphatase, non-receptor type 1 protein_id : NP_035331.3

name	2310033K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123959722 GeneID:69553 MGI:1916803
definition	codon_start : 1 product : hypothetical protein LOC69553 protein_id : NP_001074177.1

name	Pard6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946766 CCDS:CCDS17108.1 GeneID:58220 MGI:2135605
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0005938 - cell cortex [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0005923 - tight junction [Evidence ISS] [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] GO_process : GO:0007409 - axonogenesis [Evidence ISS]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007163 - establishment and/or maintenance of cell polarity [Evidence ISS]; GO:0007043 - intercellular junction assembly [Evidence ISS]; GO:0030334 - regulation of cell migration [Evidence ISS] codon_start : 1 exception : mismatches in translation note : partitioning-defective protein 6, beta product : par-6 (partitioning defective 6) homolog beta protein_id : NP_067384.1

name	Adnp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90093349 GeneID:11538 MGI:1338758
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005184 - neuropeptide hormone activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : activity-dependent neuroprotective protein protein_id : NP_033758.2

name	Dpm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753670 CCDS:CCDS17109.1 GeneID:13480 MGI:1330239
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence ISS]; GO:0031501 - mannosyltransferase complex [Evidence ISS] GO_function : GO:0004582 - dolichyl-phosphate beta-D-mannosyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0004169 - dolichyl-phosphate-mannose-protein mannosyltransferase activity [Evidence ISS]; GO:0000030 - mannosyltransferase activity [Evidence IMP]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence ISS]; GO:0018406 - protein amino acid C-linked glycosylation via 2'-alpha-mannosyl-L-tryptophan [Evidence ISS]; GO:0035269 - protein amino acid O-linked mannosylation [Evidence ISS] codon_start : 1 product : dolichol-phosphate (beta-D) mannosyltransferase 1 protein_id : NP_034202.1

name	Mocs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82887378 GeneID:69372 MGI:1916622
definition	codon_start : 1 product : molybdenum cofactor synthesis 3 protein_id : XP_130596.4

name	Kcng1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487487 GeneID:241794 MGI:3616086
definition	codon_start : 1 note : orthologue of H. sapiens potassium voltage-gated channel, subfamily G, member 1 (KCNG1) product : potassium voltage-gated channel, subfamily G, member 1 protein_id : NP_001074603.1

name	Nfatc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:81295418 CCDS:CCDS17112.1 GeneID:18019 MGI:102463
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence ISS] GO_process : GO:0001816 - cytokine production [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 isoform a protein_id : NP_035029.2

name	Nfatc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:81295421 CCDS:CCDS17113.1 GeneID:18019 MGI:102463
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence ISS] GO_process : GO:0001816 - cytokine production [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 isoform b protein_id : NP_001032254.1

name	Nfatc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:81295412 CCDS:CCDS17114.1 GeneID:18019 MGI:102463
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence ISS] GO_process : GO:0001816 - cytokine production [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3 product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 isoform c protein_id : NP_001032255.1

name	Atp9a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40795674 GeneID:11981 MGI:1330826
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004012 - phospholipid-translocating ATPase activity [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : ATPase, class 2; ATPase 9A, p type; Class II; ATPase 9A, class II product : ATPase, class II, type 9A protein_id : NP_056546.2

name	Sall4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117553633 CCDS:CCDS17117.1 GeneID:99377 MGI:2139360
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IC] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030326 - embryonic limb morphogenesis [Evidence IGI] [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI] [Evidence IDA] codon_start : 1 note : isoform c is encoded by transcript variant c product : sal-like 4 isoform c protein_id : NP_958798.2

name	Sall4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117553623 CCDS:CCDS17116.1 GeneID:99377 MGI:2139360
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IC] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030326 - embryonic limb morphogenesis [Evidence IGI] [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI] [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant b product : sal-like 4 isoform b protein_id : NP_958797.2

name	Sall4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117553631 CCDS:CCDS17115.1 GeneID:99377 MGI:2139360
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IC] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030326 - embryonic limb morphogenesis [Evidence IGI] [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI] [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant a product : sal-like 4 isoform a protein_id : NP_780512.2

name	LOC668951 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668951
definition	number : 2 pseudo : _no_value

name	LOC668951 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668951
definition	number : 1 pseudo : _no_value

name	LOC100043908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043908
definition	number : 1 pseudo : _no_value

name	LOC668952 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668952
definition	number : 1 pseudo : _no_value

name	LOC383774 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250115 GeneID:383774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : similar to GLE1 RNA export mediator-like (yeast pseudo : _no_value transcript_id : XR_034855.1

clone name	MSMg01-160A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384G23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-128L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184L21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-059B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-219K15.b	B6Ng01-219K15.g
ACC	GA035434	GA035435
length	1,104	1,046
definition	B6Ng01-219K15.b	B6Ng01-219K15.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(167,679,514 - 167,680,631)	(167,472,130 - 167,473,185)
sequence	gaattcattacagctacctgcacaccccacatgggtaactgtcatggtaa agacagatcttcacagtgtaacagcaaaacacaggactcaggtcaccact cagtcagaaaatccccaataaatagatgaaatgaaccctgctcctctctt ccataaagtggaggagcggtacctgggctggcagaatggcttcatgagtt cattaggtactggccacccttttctctattgctcctctttggcccaagat agtcacacagattctagccatcacatctgctttccaaacaaccagaagga agttggtaggaagagacacccttctctatagacatgtcttagcagttact cagatgctattgcccagaatttagtcacatggccacacatagctgcaagg gagtcaggaaagtgtagtgttccccaccccatcccaccccctgcctccga ctgacccataatctagcaaaagtttgggattcctattgtgaaagaagaga gagagagagacagacagacagacagacagagacagagacagaaacagaga cagagacagagacagagagagagcaaagcagcagggagggacagcaggga ccttaataaaattagtaacaatgaaaacaacaatctaagaagagtcttca gtcacagggtaccactgtacaatgtggggaacagaagaagggcttggaga tccatataaacatgattgtaactttctaataaaatttcaaaatagggtct ggacagagggtggctcagtggtaagaacactggctgctgttatagaggct ccgagttgactttccagcacccaggtgtcagctcacagccttctgaaact ccctctagtcccaggggacctgctgctctctctggcctctggagacatca gcacacatgcagcacacagacacacaagcagcaaacaccccaaacacata agaaaatttttaagttttaaattcaaactggagaagtgactcaaggtaaa ctggcctttaaggacacaatatgatttggtttggttttgtttgttttccc tgctttttatttacaagtgtcttttgaagatgtgtgtactcaagtatttg cgga	gaattctctaggcagacaggagtggaggcctgaactcagcagggaaggca gagactagagatggaatgcccattctgaaaaggtggctgccctggcttta acttagcactgactgactcggaatccttgcctgatggaactggtttgaat tcaatcttctgcctaagcccgaaagcctcaccgacagcttacatgcgagc acgggattggccctgacttgagggaagactccaggaggctctccgaccca ccctcctgtgctgttaccaacctcggggatcctcagtccagtcttagggg actgaccccgggacagtcacacagcccggcatacgcaccttcccgacaat gggcaggtccacagaaccccatgtatcagcaccccaatgtaccaggccgg acaggaagtcagcgacgagagcccctgcaactgtgggcaacaagaatgta agccagggcaggggcactcagagacgtcctcgcccctcctgttggggacc attccccgctccacaatcttgactgtttattcattatgagatcggagcat ccgggcccctgcccagtgcacagagtctcacgcaacatccctggttctgg tctgcacagagcagactcactccctgaggtgggggcatcactgccttcct aggcctcagctgagctgcctagaatcccagcacctgggaggctgaggtgg gaggatccagagttagaggctagcctgggctacagcaaacataagcaatt ccttacttgcaattttgtctccatcccacctatcccacctggcttgtatc atggactcagttttgagctttccctttgtttagtttttttgtttgttttg ttttgttttgttttcagacagggttttctctgtatagcctgctgtcctgg aacttactttgtagaccaggctggcctcgaacccagaaatcgcctgctct gctctcccaagctgggattaaggtgtgcgccaccacagcggctcttgttt acttccactgctcagactaagcttgggggtagcccctcccctcccc
quality values	Open. Hide. 58 33 18 21 58 38 18 47 54 62 42 24 62 62 62 62 62 62 62 62 49 62 56 44 62 62 62 49 47 62 59 41 43 34 27 23 23 28 28 28 49 34 29 28 59 62 62 59 62 62 62 62 59 62 59 62 59 59 62 62 62 59 59 62 59 62 62 62 59 62 62 62 59 62 62 49 51 56 48 56 56 48 46 56 54 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 49 44 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 54 62 52 52 62 46 52 48 62 48 54 62 52 62 62 43 62 62 52 52 62 46 52 62 48 52 62 43 36 62 47 52 62 47 62 62 52 47 62 52 54 54 43 54 58 49 58 54 45 54 58 54 54 52 54 54 54 54 54 52 58 54 41 58 45 42 54 58 43 54 40 58 58 58 54 52 58 54 42 30 58 58 47 52 58 58 58 58 58 54 39 58 58 54 54 54 54 54 52 58 58 58 58 58 58 54 58 42 54 54 52 52 58 54 42 52 58 52 58 54 50 58 27 52 53 52 52 52 52 41 53 53 46 51 41 52 51 38 37 35 34 54 46 51 51 49 50 42 53 41 50 50 58 34 54 58 47 47 38 50 36 50 46 58 38 22 58 41 16 58 49 32 53 41 58 28 49 32 41 36 50 50 32 53 46 53 52 58 51 49 37 50 50 52 32 49 54 25 39 49 37 50 58 51 58 21 14 44 36 22 58 58 25 26 58 58 40 42 58 58 41 33 28 41 58 58 31 53 50 58 58 39 30 39 39 52 32 54 51 25 51 51 24 37 40 32 29 27 53 42 25 27 49 52 38 46 39 30 34 40 52 52 38 49 53 42 35 49 29 33 28 37 31 28 52 26 54 31 34 26 47 23 31 9 52 51 42 33 25 40 54 51 24 53 32 32 45 34 30 54 53 39 40 40 39 39 31 35 31 29 40 45 32 19 26 29 34 33 41 28 30 32 33 34 35 47 35 30 42 29 40 25 31 30 31 29 30 34 32 51 43 33 31 51 51 31 30 7 28 29 31 34 35 31 26 32 34 30 31 31 30 31 42 33 30 19 27 30 24 31 31 36 33 31 19 17 35 28 6 7 9 31 31 23 31 21 32 31 31 32 34 32 34 34 23 13 10 27 25 25 17 41 27 25 19 25 26 28 6 7 9 37 41 34 26 15 29 44 41 35 22 41 35 21 6 5 6 35 19 32 33 42 48 47 23 12 43 43 48 22 25 31 18 32 48 47 35 14 38 25 14 22 37 16 48 19 24 29 25 25 27 16 26 20 25 10 33 32 19 30 29 17 13 25 30 24 33 43 31 19 27 31 25 7 10 13 43 33 11 19 22 24 7 15 13 16 13 32 15 25 28 28 34 13 39 24 7 13 16 47 22 13 9 27 40 34 9 8 13 28 21 14 6 29 30 18 10 28 15 8 27 24 16 34 47 14 6 4 7 30 27 14 14 10 33 6 5 5 5 6 10 29 34 6 14 24 28 13 28 10 14 6 10 21 5 3 4 6 4 9 5 6 8 1 3 3 27 23 7 12 5 16 10	Open. Hide. 62 44 51 47 62 62 62 62 59 59 59 41 30 16 18 24 25 23 27 32 29 40 54 62 62 62 59 59 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 59 59 62 62 59 62 62 62 59 59 59 59 59 49 34 35 31 33 36 56 62 54 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 56 59 59 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 54 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 46 62 62 62 47 62 62 52 62 62 62 52 47 46 62 54 54 62 35 62 62 62 54 62 62 62 58 54 58 58 58 58 58 58 58 58 52 54 54 58 54 54 49 54 52 54 46 58 58 58 58 52 54 58 58 49 58 45 48 58 52 58 58 45 42 58 58 54 58 58 58 58 46 54 54 58 48 54 52 54 52 58 24 54 58 22 54 35 58 52 52 54 58 54 58 58 47 45 34 11 29 37 58 58 58 58 58 49 53 53 49 46 46 51 58 49 51 51 42 50 58 46 51 50 58 50 54 49 50 40 50 53 54 42 39 13 49 51 41 40 58 49 52 46 58 50 50 52 50 49 39 40 54 53 51 49 48 37 51 58 49 26 58 21 58 50 58 15 58 42 54 58 52 41 17 50 28 18 52 53 31 52 58 29 17 21 12 9 22 19 49 37 52 52 38 54 51 39 49 54 54 32 45 37 40 53 50 50 42 51 51 32 32 49 39 46 32 52 39 53 34 53 52 43 49 35 40 29 32 49 52 37 26 33 37 54 54 42 53 34 52 40 31 51 32 45 37 51 51 24 29 51 33 45 45 26 54 42 21 9 32 19 32 51 32 48 25 53 23 32 32 32 30 28 34 46 24 28 31 34 28 27 31 51 46 28 24 42 18 31 32 51 38 33 51 33 34 51 34 27 21 40 19 27 8 11 36 40 40 45 37 21 12 10 13 33 46 13 43 42 33 46 25 27 46 20 34 17 46 46 29 24 18 31 31 10 13 25 12 34 28 23 27 42 28 8 46 46 24 16 21 29 18 31 21 32 36 31 25 29 20 16 13 5 14 15 15 21 43 33 18 28 20 20 31 30 30 37 31 38 44 31 25 25 31 25 42 28 28 35 33 20 9 22 30 18 11 24 31 26 9 8 12 18 48 31 24 14 24 32 25 31 31 4 12 15 27 8 7 9 23 31 22 10 8 14 10 15 43 17 13 13 6 7 12 19 48 24 4 7 14 6 7 19 16 16 32 10 32 31 19 20 27 12 20 14 8 13 11 13 7 3 15 10 5 6 10 30 16 18 30 7 17 7 15 16 7 9 27 18 10 20 11 27 16 23 7 30 5 16 12 15 6 6 20 26 18 21 28 40 24 7 28 16 11 15 28 17 22 17 26 25 11 6 5 14 25 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_167679514_167680631
seq2: B6Ng01-219K15.b_45_1148 (reverse)

seq1  TCCGCAAAATACATGAGTAACAAACACATCTTCAAAAGACACTTTGTAAA  50
      ||||| |||||| |||||   | ||||||||||||||||||| |||||||
seq2  TCCGC-AAATACTTGAGT---ACACACATCTTCAAAAGACAC-TTGTAAA  45

seq1  ATAAAAGCAGGGAAAACAAAACAAAACAAAACAAATCATATTGTGTCCCT  100
        ||||||||||||||||||  ||| |||| ||||||||||||||| |||
seq2  TAAAAAGCAGGGAAAACAAACAAAACCAAACCAAATCATATTGTGT-CCT  94

seq1  TAAAGGCCAGTTTTACCTTGAGTCACCTTCTCCAGTTTGAATTTAAAAAC  150
      |||||||||| |||||||||||||| |||||||||||||||||| |||||
seq2  TAAAGGCCAG-TTTACCTTGAGTCA-CTTCTCCAGTTTGAATTT-AAAAC  141

seq1  TTTAAAAATTTTTCTTATGTGTTTGGGGTGTTTTGCCTGCTTGTGTGTCT  200
      ||  |||| ||||||||||||||||||||||||   ||||||||||||||
seq2  TT--AAAAATTTTCTTATGTGTTTGGGGTGTTT--GCTGCTTGTGTGTCT  187

seq1  GTGTGCTGCATGTGTGCCTGATGTCTCCAGAGGCCAGAGAGAGCAGCAGG  250
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  GTGTGCTGCATGTGTG-CTGATGTCTCCAGAGGCCAGAGAGAGCAGCAGG  236

seq1  TCCCCTGGGACTAGAGGGAGTTTCAGAAGGCTGTGAGCTGACACCTGGGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCTGGGACTAGAGGGAGTTTCAGAAGGCTGTGAGCTGACACCTGGGT  286

seq1  GCTGGAAAGTCAACTCGGAGCCTCTATAACAGCAGCCAGTGTTCTTACCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGAAAGTCAACTCGGAGCCTCTATAACAGCAGCCAGTGTTCTTACCA  336

seq1  CTGAGCCACCCTCTGTCCAGACCCTATTTTGAAATTTTATTAGAAAGTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGCCACCCTCTGTCCAGACCCTATTTTGAAATTTTATTAGAAAGTTA  386

seq1  CAATCATGTTTATATGGATCTCCAAGCCCTTCTTCTGTTCCCCACATTGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATCATGTTTATATGGATCTCCAAGCCCTTCTTCTGTTCCCCACATTGT  436

seq1  ACAGTGGTACCCTGTGACTGAAGACTCTTCTTAGATTGTTGTTTTCATTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTGGTACCCTGTGACTGAAGACTCTTCTTAGATTGTTGTTTTCATTG  486

seq1  TTACTAATTTTATTAAGGTCCCTGCTGTCCCTCCCTGCTGCTTTGCTCTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACTAATTTTATTAAGGTCCCTGCTGTCCCTCCCTGCTGCTTTGCTCTC  536

seq1  TCTCTGTCTCTGTCTCTGTCTCTGTTTCTGTCTCTGTCTCTGTCTGTCTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGTCTCTGTCTCTGTCTCTGTTTCTGTCTCTGTCTCTGTCTGTCTG  586

seq1  TCTGTCTGTCTCTCTCTCTCTCTTCTTTCACAATAGGAATCCCAAACTTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTCTGTCTCTCTCTCTCTCTTCTTTCACAATAGGAATCCCAAACTTT  636

seq1  TGCTAGATTATGGGTCAGTCGGAGGCAGGGGGTGGGATGGGGTGGGGAAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTAGATTATGGGTCAGTCGGAGGCAGGGGGTGGGATGGGGTGGGGAAC  686

seq1  ACTACACTTTCCTGACTCCCTTGCAGCTATGTGTGGCCATGTGACTAAAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTACACTTTCCTGACTCCCTTGCAGCTATGTGTGGCCATGTGACTAAAT  736

seq1  TCTGGGCAATAGCATCTGAGTAACTGCTAAGACATGTCTATAGAGAAGGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGGCAATAGCATCTGAGTAACTGCTAAGACATGTCTATAGAGAAGGG  786

seq1  TGTCTCTTCCTACCAACTTCCTTCTGGTTGTTTGGAAAGCAGATGTGATG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTCTTCCTACCAACTTCCTTCTGGTTGTTTGGAAAGCAGATGTGATG  836

seq1  GCTAGAATCTGTGTGACTATCTTGGGCCAAAGAGGAGCAATAGAGAAAAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAGAATCTGTGTGACTATCTTGGGCCAAAGAGGAGCAATAGAGAAAAG  886

seq1  GGTGGCCAGTACCTAATGAACTCATGAAGCCATTCTGCCAGCCCAGGTAC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGCCAGTACCTAATGAACTCATGAAGCCATTCTGCCAGCCCAGGTAC  936

seq1  CGCTCCTCCACTTTATGGAAGAGAGGAGCAGGGTTCATTTCATCTATTTA  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCTCCTCCACTTTATGGAAGAGAGGAGCAGGGTTCATTTCATCTATTTA  986

seq1  TTGGGGATTTTCTGACTGAGTGGTGACCTGAGTCCTGTGTTTTGCTGTTA  1050
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGGATTTTCTGACTGAGTGGTGACCTGAGTCCTGTGTTTTGCTGTTA  1036

seq1  CACTGTGAAGATCTGTCTTTACCATGACAGTTACCCATGTGGGGTGTGCA  1100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGTGAAGATCTGTCTTTACCATGACAGTTACCCATGTGGGGTGTGCA  1086

seq1  GGTAGCTGTAATGAATTC  1118
      ||||||||||||||||||
seq2  GGTAGCTGTAATGAATTC  1104

seq1: chr2_167472130_167473185
seq2: B6Ng01-219K15.g_69_1114

seq1  GAATTCTCTAGGCAGACAGGAGTGGAGGCCTGAACTCAGCAGGGAAGGCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTAGGCAGACAGGAGTGGAGGCCTGAACTCAGCAGGGAAGGCA  50

seq1  GAGACTAGAGATGGAATGCCCATTCTGAAAAGGTGGCTGCCCTGGCTTTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACTAGAGATGGAATGCCCATTCTGAAAAGGTGGCTGCCCTGGCTTTA  100

seq1  ACTTAGCACTGACTGACTCGGAATCCTTGCCTGATGGAACTGGTTTGAAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTAGCACTGACTGACTCGGAATCCTTGCCTGATGGAACTGGTTTGAAT  150

seq1  TCAATCTTCTGCCTAAGCCCGAAAGCCTCACCGACAGCTTACATGCGAGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATCTTCTGCCTAAGCCCGAAAGCCTCACCGACAGCTTACATGCGAGC  200

seq1  ACGGGATTGGCCCTGACTTGAGGGAAGACTCCAGGAGGCTCTCCGACCCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGGGATTGGCCCTGACTTGAGGGAAGACTCCAGGAGGCTCTCCGACCCA  250

seq1  CCCTCCTGTGCTGTTACCAACCTCGGGGATCCTCAGTCCAGTCTTAGGGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCCTGTGCTGTTACCAACCTCGGGGATCCTCAGTCCAGTCTTAGGGG  300

seq1  ACTGACCCCGGGACAGTCACACAGCCCGGCATACGCACCTTCCCGACAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGACCCCGGGACAGTCACACAGCCCGGCATACGCACCTTCCCGACAAT  350

seq1  GGGCAGGTCCACAGAACCCCATGTATCAGCACCCCAATGTACCAGGCCGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCAGGTCCACAGAACCCCATGTATCAGCACCCCAATGTACCAGGCCGG  400

seq1  ACAGGAAGTCAGCGACGAGAGCCCCTGCAACTGTGGGCAACAAGAATGTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGAAGTCAGCGACGAGAGCCCCTGCAACTGTGGGCAACAAGAATGTA  450

seq1  AGCCAGGGCAGGGGCACTCAGAGACGTCCTCGCCCCTCCTGTTGGGGACC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCAGGGCAGGGGCACTCAGAGACGTCCTCGCCCCTCCTGTTGGGGACC  500

seq1  ATTCCCCGCTCCACAATCTTGACTGTTTATTCATTATGAGATCGGAGCAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCCCGCTCCACAATCTTGACTGTTTATTCATTATGAGATCGGAGCAT  550

seq1  CCGGGCCCCTGCCCAGTGCACAGAGTCTCACGCAACATCCCTGGTTCTGG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGGGCCCCTGCCCAGTGCACAGAGTCTCACGCAACATCCCTGGTTCTGG  600

seq1  TCTGCACAGAGCAGACTCACTCCCTGAGGTGGGGGCATCACTGCCTTCCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCACAGAGCAGACTCACTCCCTGAGGTGGGGGCATCACTGCCTTCCT  650

seq1  AGGCCTCAGCTGAGCTGCCTAGAATCCCAGCACCTGGGAGGCTGAGGTGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCTCAGCTGAGCTGCCTAGAATCCCAGCACCTGGGAGGCTGAGGTGG  700

seq1  GAGGATCCAGAGTTAGAGGCTAGCCTGGGCTACAGCAAACATAAGCAATT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGATCCAGAGTTAGAGGCTAGCCTGGGCTACAGCAAACATAAGCAATT  750

seq1  CCTTACTTGCAATTTTGTCTCCATCCCACCTATCCCACCTGGCTTGTATC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTACTTGCAATTTTGTCTCCATCCCACCTATCCCACCTGGCTTGTATC  800

seq1  ATGGACTCAGTTTTGAGCTTTCCCTTTGTTTAGTTTTTTTGTTTTGTTTT  850
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  ATGGACTCAGTTTTGAGCTTTCCCTTTGTTTAGTTTTTTTG-TTTGTTTT  849

seq1  GTTTTGTTTTGTTTTTCAAGACAGGG-TTTCTCTGTATAGCCCTGGCTGT  899
      |||||||||||||||   |||||||| |||||||||||||||   |||||
seq2  GTTTTGTTTTGTTTT--CAGACAGGGTTTTCTCTGTATAGCC--TGCTGT  895

seq1  CCTGGAACTTACTTTGTAGACCAGGCTGGCCTCGAACCCAGAAATCCGCC  949
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  CCTGGAACTTACTTTGTAGACCAGGCTGGCCTCGAACCCAGAAAT-CGCC  944

seq1  TGCCTCTGC-CTCCCAAGGCTGGGATTAAAGGTGTGCGCCACCACAGCCG  998
      || |||||| ||||||| ||||||||| ||||||||||||||||||||  
seq2  TG-CTCTGCTCTCCCAA-GCTGGGATT-AAGGTGTGCGCCACCACAGC--  989

seq1  GGCTCTTTGTTTACTTTCAACCTGCTCAGAACTAGCTT-GGGGTAG-CCC  1046
      ||||| |||||||||| ||  |||||||||   ||||| ||||||| |||
seq2  GGCTC-TTGTTTACTTCCA--CTGCTCAGACTAAGCTTGGGGGTAGCCCC  1036

seq1  TCCCCTCCCC  1056
      ||||||||||
seq2  TCCCCTCCCC  1046

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information