MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-220I18
Chromosome	2 (Build37)
Map Location	92,269,408 - 92,392,360
singlet/doublet	doublet
Overlap gene	Cry2, Slc35c1, LOC100042775
Upstream gene	1110051M20Rik, Lrp4, LOC619941, Ckap5, F2, Zfp408, Arhgap1, D2Ertd391e, LOC100043179, D230010M03Rik, D030051N19Rik, Chrm4, Mdk, Dgkz, Creb3l1, Phf21a, Gyltl1b, Pex16, 1700029I15Rik, Mapk8ip1
Downstream gene	LOC100043205, Chst1, Syt13, LOC100042784, Trp53i11, C230071H18Rik, Tspan18, LOC100042789, LOC639658, Cd82
Link	Open Mouse BAC browser

Click to get alignment info.

name	1110051M20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228356 MGI:1915079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228357 MGI:2442252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC619941 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Ckap5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75786 MGI:1923036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14061 MGI:88380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp408 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381410 MGI:2685857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228359 MGI:2445003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D2Ertd391e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51897 MGI:1196429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043179 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	D230010M03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241547 MGI:2443194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D030051N19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228361 MGI:2443564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Chrm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12672 MGI:88399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mdk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17242 MGI:96949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Dgkz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104418 MGI:1278339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Creb3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26427 MGI:1347062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf21a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192285 MGI:2384756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gyltl1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228366 MGI:2443769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18633 MGI:1338829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700029I15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75641 MGI:1916742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapk8ip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19099 MGI:1309464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cry2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12953 MGI:1270859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc35c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228368 MGI:2443301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042775 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs

name	LOC100043205 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 8 Proteins pseudo : _no_value

name	Chst1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76969 MGI:1924219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syt13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80976 MGI:1933945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins

name	Trp53i11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277414 MGI:2670995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230071H18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399569 MGI:3026916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241556 MGI:1917186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042789 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	LOC639658 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:639658
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cd82 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12521 MGI:104651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110051M20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803506 GeneID:228356 MGI:1915079
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110051M20 gene transcript_id : NM_175123.3

name	Lrp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27883855 GeneID:228357 MGI:2442252
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : low density lipoprotein receptor-related protein 4 transcript_id : NM_172668.2

name	LOC619941 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367103 GeneID:619941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to CGI-140 protein transcript_id : XM_884324.2

name	Ckap5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66955861 GeneID:75786 MGI:1923036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytoskeleton associated protein 5 transcript_id : NM_029437.1

name	F2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129932 GeneID:14061 MGI:88380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coagulation factor II transcript_id : NM_010168.2

name	Zfp408 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364558 GeneID:381410 MGI:2685857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 408 transcript_id : NM_001033451.2

name	Arhgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803553 GeneID:228359 MGI:2445003
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 1 transcript_id : NM_146124.3

name	D2Ertd391e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130154 GeneID:51897 MGI:1196429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 2, ERATO Doi 391, expressed transcript_id : NM_145528.2

name	LOC100043179 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249943 GeneID:100043179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : hypothetical protein LOC100043179 transcript_id : XM_001479237.1

name	D230010M03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379648 GeneID:241547 MGI:2443194
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D230010M03 gene transcript_id : NM_178724.3

name	D030051N19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124053444 GeneID:228361 MGI:2443564
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D030051N19 gene transcript_id : NM_172669.3

name	D030051N19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124053442 GeneID:228361 MGI:2443564
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D030051N19 gene transcript_id : NM_001080754.1

name	Chrm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680939 GeneID:12672 MGI:88399
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, muscarinic 4 transcript_id : NM_007699.1

name	Mdk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59894793 GeneID:17242 MGI:96949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : midkine transcript_id : NM_010784.4

name	Mdk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59894787 GeneID:17242 MGI:96949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : midkine transcript_id : NM_001012336.1

name	Mdk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59894789 GeneID:17242 MGI:96949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : midkine transcript_id : NM_001012335.1

name	Dgkz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794243 GeneID:104418 MGI:1278339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol kinase zeta transcript_id : NM_138306.1

name	Creb3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606376 GeneID:26427 MGI:1347062
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cAMP responsive element binding protein 3-like 1 transcript_id : NM_011957.2

name	Phf21a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270290 GeneID:192285 MGI:2384756
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 21A transcript_id : NM_138755.1

name	Gyltl1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369973 GeneID:228366 MGI:2443769
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycosyltransferase-like 1B transcript_id : NM_172670.1

name	Pex16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553068 GeneID:18633 MGI:1338829
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome biogenesis factor 16 transcript_id : NM_145122.1

name	1700029I15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354381 GeneID:75641 MGI:1916742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700029I15 gene transcript_id : NM_183112.2

name	Mapk8ip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802210 GeneID:19099 MGI:1309464
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 8 interacting protein 1 transcript_id : NM_011162.3

name	Cry2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46048394 GeneID:12953 MGI:1270859
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cryptochrome 2 (photolyase-like) transcript_id : NM_009963.3

name	Slc35c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90962994 GeneID:228368 MGI:2443301
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member C1 transcript_id : NM_145832.3

name	Slc35c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90962993 GeneID:228368 MGI:2443301
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member C1 transcript_id : NM_211358.2

name	LOC100042775 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249896 GeneID:100042775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs product : hypothetical protein LOC100042775 transcript_id : XM_001478787.1

name	Chst1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963844 GeneID:76969 MGI:1924219
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 transcript_id : NM_023850.1

name	Syt13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370317 GeneID:80976 MGI:1933945
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin XIII transcript_id : NM_030725.3

name	LOC100042784 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249898 GeneID:100042784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to hCG1991368 transcript_id : XM_001478808.1

name	Trp53i11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480149 GeneID:277414 MGI:2670995
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 inducible protein 11 transcript_id : NM_001025246.1

name	C230071H18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803075 GeneID:399569 MGI:3026916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230071H18 gene transcript_id : NM_207265.2

name	Tspan18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147225 GeneID:241556 MGI:1917186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 18 transcript_id : NM_183180.1

name	LOC100042789 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249900 GeneID:100042789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : hypothetical protein LOC100042789 transcript_id : XM_001478824.1

name	LOC639658 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367111 GeneID:639658
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC639658 transcript_id : XM_001002949.1

name	Cd82 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366470 GeneID:12521 MGI:104651
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD82 antigen transcript_id : NM_007656.3

name	1110051M20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29126243 CCDS:CCDS16431.1 GeneID:228356 MGI:1915079
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC228356 protein_id : NP_780332.1

name	Lrp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27883856 CCDS:CCDS16432.1 GeneID:228357 MGI:2442252
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0042733 - embryonic digit morphogenesis [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0006897 - endocytosis [Evidence IEA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IDA] codon_start : 1 exception : mismatches in translation note : LDLR dan product : low density lipoprotein receptor-related protein 4 protein_id : NP_766256.2

name	LOC619941 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367104 GeneID:619941
definition	codon_start : 1 product : similar to CGI-140 protein protein_id : XP_889417.2

name	Ckap5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66955862 CCDS:CCDS16433.1 GeneID:75786 MGI:1923036
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0043021 - ribonucleoprotein binding [Evidence ISS] GO_process : GO:0051300 - spindle pole body organization and biogenesis [Evidence ISS] codon_start : 1 exception : mismatches in translation product : cytoskeleton associated protein 5 protein_id : NP_083713.1

name	F2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753798 CCDS:CCDS16434.1 GeneID:14061 MGI:88380
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0003809 - thrombin activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0007596 - blood coagulation [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : prothrombin product : coagulation factor II protein_id : NP_034298.1

name	Zfp408 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626129 CCDS:CCDS16436.1 GeneID:381410 MGI:2685857
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 408 protein_id : NP_001028623.1

name	Arhgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981892 CCDS:CCDS16437.1 GeneID:228359 MGI:2445003
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0030675 - Rac GTPase activator activity [Evidence IDA]; GO:0005100 - Rho GTPase activator activity [Evidence ISS] [Evidence IDA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence ISS] codon_start : 1 exception : mismatches in translation product : Rho GTPase activating protein 1 protein_id : NP_666236.2

name	D2Ertd391e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704040 CCDS:CCDS16438.1 GeneID:51897 MGI:1196429
definition	codon_start : 1 product : hypothetical protein LOC51897 protein_id : NP_663503.1

name	LOC100043179 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249944 GeneID:100043179
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479287.1

name	D230010M03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520149 GeneID:241547 MGI:2443194
definition	codon_start : 1 product : hypothetical protein LOC241547 protein_id : NP_848839.1

name	D030051N19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124053445 GeneID:228361 MGI:2443564
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC228361 isoform 1 protein_id : NP_766257.3

name	D030051N19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124053443 GeneID:228361 MGI:2443564
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC228361 isoform 2 protein_id : NP_001074223.1

name	Chrm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680940 CCDS:CCDS16439.1 GeneID:12672 MGI:88399
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : AChR M4; muscarinic acetylcholine receptor 4 product : cholinergic receptor, muscarinic 4 protein_id : NP_031725.1

name	Mdk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59894790 CCDS:CCDS16440.1 GeneID:17242 MGI:96949
definition	GO_function : GO:0008083 - growth factor activity [Evidence ISS] [Evidence IEA]; GO:0008201 - heparin binding [Evidence ISS] [Evidence IEA] GO_process : GO:0030325 - adrenal gland development [Evidence ISS]; GO:0030154 - cell differentiation [Evidence IEA] [Evidence ISS]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0009611 - response to wounding [Evidence IDA] codon_start : 1 product : midkine protein_id : NP_001012335.1

name	Mdk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59894788 CCDS:CCDS16440.1 GeneID:17242 MGI:96949
definition	GO_function : GO:0008083 - growth factor activity [Evidence ISS] [Evidence IEA]; GO:0008201 - heparin binding [Evidence ISS] [Evidence IEA] GO_process : GO:0030325 - adrenal gland development [Evidence ISS]; GO:0030154 - cell differentiation [Evidence IEA] [Evidence ISS]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0009611 - response to wounding [Evidence IDA] codon_start : 1 product : midkine protein_id : NP_001012336.1

name	Mdk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754668 CCDS:CCDS16440.1 GeneID:17242 MGI:96949
definition	GO_function : GO:0008083 - growth factor activity [Evidence ISS] [Evidence IEA]; GO:0008201 - heparin binding [Evidence ISS] [Evidence IEA] GO_process : GO:0030325 - adrenal gland development [Evidence ISS]; GO:0030154 - cell differentiation [Evidence IEA] [Evidence ISS]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0009611 - response to wounding [Evidence IDA] codon_start : 1 product : midkine protein_id : NP_034914.1

name	Dgkz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794244 CCDS:CCDS16441.1 GeneID:104418 MGI:1278339
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : diacylglycerol kinase zeta protein_id : NP_612179.1

name	Creb3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606377 GeneID:26427 MGI:1347062
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IEA] codon_start : 1 note : BBF-2 (drosophila) homolog; old astrocyte specifically induced substance product : cAMP responsive element binding protein 3-like 1 protein_id : NP_036087.2

name	Phf21a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270291 CCDS:CCDS16442.1 GeneID:192285 MGI:2384756
definition	GO_component : GO:0000118 - histone deacetylase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0001967 - suckling behavior [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; Braf35/HDAC complex (Bhc); BRAF35/HDAC2 complex product : PHD finger protein 21A isoform 1 protein_id : NP_620094.1

name	Gyltl1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369974 CCDS:CCDS16443.1 GeneID:228366 MGI:2443769
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glycoslytransferase-like 1B product : glycosyltransferase-like 1B protein_id : NP_766258.1

name	Pex16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553069 CCDS:CCDS16444.1 GeneID:18633 MGI:1338829
definition	GO_process : GO:0007031 - peroxisome organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : peroxin-16 product : peroxisome biogenesis factor 16 protein_id : NP_660104.1

name	1700029I15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147107 CCDS:CCDS16445.1 GeneID:75641 MGI:1916742
definition	codon_start : 1 product : hypothetical protein LOC75641 protein_id : NP_898935.1

name	Mapk8ip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328191 CCDS:CCDS16446.1 GeneID:19099 MGI:1309464
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEP] [Evidence IDA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0019894 - kinesin binding [Evidence IPI]; GO:0005078 - MAP-kinase scaffold activity [Evidence NAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IPI] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0007258 - JUN phosphorylation [Evidence IDA]; GO:0046328 - regulation of JNK cascade [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA]; GO:0016192 - vesicle-mediated transport [Evidence IDA] codon_start : 1 note : protein kinase, mitogen-activated 8 interacting protein product : mitogen activated protein kinase 8 interacting protein 1 protein_id : NP_035292.2

name	Cry2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27312016 CCDS:CCDS16447.1 GeneID:12953 MGI:1270859
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003913 - DNA photolyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence IMP]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006606 - protein import into nucleus [Evidence IPI] codon_start : 1 product : cryptochrome 2 (photolyase-like) protein_id : NP_034093.1

name	Slc35c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877098 CCDS:CCDS16448.1 GeneID:228368 MGI:2443301
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; multispan transmembrane protein fuct1 product : GDP-fucose transporter 1 isoform 1 protein_id : NP_997597.1

name	Slc35c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003876 CCDS:CCDS16449.1 GeneID:228368 MGI:2443301
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; multispan transmembrane protein fuct1 product : GDP-fucose transporter 1 isoform 2 protein_id : NP_665831.1

name	LOC100042775 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249897 GeneID:100042775
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478837.1

name	Chst1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963845 CCDS:CCDS16450.1 GeneID:76969 MGI:1924219
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0045130 - keratan sulfotransferase activity [Evidence IEA]; GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 product : carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 protein_id : NP_076339.1

name	Syt13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14140242 CCDS:CCDS16451.1 GeneID:80976 MGI:1933945
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA] GO_process : GO:0016192 - vesicle-mediated transport [Evidence IPI] codon_start : 1 note : synaptotagmin 13 product : synaptotagmin XIII protein_id : NP_109650.1

name	LOC100042784 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249899 GeneID:100042784
definition	codon_start : 1 product : similar to hCG1991368 protein_id : XP_001478858.1

name	C230071H18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402287 GeneID:399569 MGI:3026916
definition	codon_start : 1 product : hypothetical protein LOC399569 protein_id : NP_997148.1

name	Trp53i11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480150 CCDS:CCDS16452.1 GeneID:277414 MGI:2670995
definition	codon_start : 1 note : tumor protein p53 inducible protein 11; Trp53 inducible protein 11 (Trp53i11) product : Trp53 inducible protein 11 protein_id : NP_001020417.1

name	Tspan18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147226 GeneID:241556 MGI:1917186
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : tetraspanin 18 protein_id : NP_899003.1

name	LOC100042789 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249901 GeneID:100042789
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478874.1

name	LOC639658 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367112 GeneID:639658
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001002949.1

name	Cd82 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671718 CCDS:CCDS16454.1 GeneID:12521 MGI:104651
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] codon_start : 1 product : kangai 1 (suppression of tumorigenicity 6, prostate) protein_id : NP_031682.1

name	LOC100043205 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249945 GeneID:100043205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 8 Proteins product : similar to ribosomal protein S27a pseudo : _no_value transcript_id : XR_034204.1

clone name	MSMg01-475F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535N21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-349J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-095I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047O08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-220I18.b	B6Ng01-220I18.g
ACC	GA036077	GA036078
length	1,151	993
definition	B6Ng01-220I18.b	B6Ng01-220I18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(92,391,212 - 92,392,360)	(92,269,408 - 92,270,411)
sequence	gaattctcttttctccccactccagtattatcacctttccatcttcacct taagctctaccagtgattcctgtcccacattaaccctaagccatgacatc ccaagagtgcaccagcaatgctggtttgtccatgtcctcaaggttccagt ttacctagttcctcgggagctcatctatggctcatcgacaacttaattcc ttttcagttggcaactggttcagcctcagccacctccacagggcacattc atcttggccaaacaatttgatgaagacaacagaatacaacattgctcggt aaacacagaatcagaaaagagaaagtagtggctttcccaggaggttttgc caacaaaaagacaagtgttgggacatctgtccaggtggttggttatccca tcacagggtcatcccacactcaagtcacctgttttgattgaatgactaag aaccagaagccccaggcaaattttgtcgatatgatgggcctcataacact catgtccaatgggtgtgtgtgcaggctggtgggacagttgataaactgtg gctgtgtgatttgccctggccctattccaacaggctccatgtcattcatc cctgtttaaatggtgggaaacaggacaaaaggtagtgccctttgatggac actaatagcagaaaatagagaaagtcaattcatatagcctggtcaggatc aggactcagaatgcatctaaaaagactgatgcagcaggcagggctgagat ttactaaggagactcccatccatcctgctcttagatcactttccctgagt ggactgccttgctccataacagggcagatttctagaaacaaaaataccag atgactgagattttctctgtctacagcttcctaggactgtgttcataact aaattacaatgtccaggaaatgagtgatttaattctacatactgtcagag atattgatgacttcttgcaagcccaaagagaggcaagcaggagtaggggg agttcaacacacagagcggaaagggtgtgtgttgggggttacctggaagg accgaaggaggaatacagtcattgcaggagcttgctggctgctttgtgaa gagagatttagattttcgaattccaatgggttactgaagacctaaactag a	gaattcacttgttcataaaaactcaagaagttccactgtggcatgcactt caacttgacctcaatattggtactctgtacatttttgtttcaactttgct tttactgggttctacctcaacccctaagaaacttttaactagtggggtgg tagtggcccttgcctttaatcccagcccttgggaggcagaggcaggcgga tctctatgagccagcatggtctatagcgtgagtttcaggacagacaaact acagtgaaaccatctcaagctccaaccaccaccacgaaagggcaatgctg agctacttccaccatggtccccaggatggacccagaacagcttcccagga ggcaataggaaggagacagggagatccctgagtagtttccagcccccagg cagccacagacagggaggccactgccatgacatcaccttttgtatctgct gctctgcaaagcaccgaaagaactggagctagctgctcctggagagtgcc caccagacaggcctaggctgtcttagccagggagaactggcctttccctc tgtgctcccttcgagccctcctctgcccctgctcacttctctttacttaa ggaggggggaacgcaaaggaaaacaggtgagcactggaagggttggcgtc ggggctgatcgtcacgcttgctccaaggggagatcacagggccacagtgc agagcacaccccctgagggagcagtcaccagaccctaaggtgcggccaga gctccaccttttgaatagtccttgctcagaattacgtaagttccctggag ccaggggagacagactgagaaaacaaattgggattccaaaaatacaggga aacttgttcatccagcacttctaggaggcgatcccttcagacaagtggag ttcattactttccactcagaagatctttggggacgattggctggttgaga aacacttgaattatctgttatggatggaaggtaggagtgggtt
quality values	Open. Hide. 58 31 24 26 58 62 62 62 62 62 62 62 62 62 62 62 62 47 25 62 62 62 44 44 62 47 62 47 54 62 59 59 62 62 62 49 62 62 62 44 36 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 49 58 54 41 58 58 46 58 58 58 52 58 58 58 58 58 58 58 58 58 54 58 58 52 58 58 58 54 30 58 58 54 54 58 58 58 58 54 54 58 58 58 58 58 58 52 46 42 58 58 52 43 58 58 58 58 49 48 54 58 58 51 52 51 58 58 50 54 49 47 58 54 58 58 58 48 50 58 58 52 58 45 46 58 58 58 42 48 49 50 48 48 49 35 38 58 58 58 53 49 58 37 58 50 58 58 50 44 43 49 58 54 51 35 33 58 58 41 50 50 49 51 41 58 53 58 50 51 50 37 49 31 38 46 50 53 50 58 53 58 58 50 40 52 49 28 50 49 51 53 39 51 42 49 51 42 53 51 50 58 41 43 50 50 47 58 31 30 41 52 35 54 39 30 54 45 53 29 49 37 39 49 40 37 52 53 52 49 54 54 54 52 42 53 37 53 53 51 40 49 53 39 32 53 29 12 39 38 45 30 54 51 45 53 53 34 15 37 35 54 52 32 53 40 39 44 32 51 53 33 37 30 41 25 44 39 32 37 22 46 30 35 31 54 31 52 31 32 32 31 45 33 18 28 29 35 36 32 52 53 32 40 52 40 31 34 35 21 36 47 32 34 32 40 52 33 47 31 27 42 40 39 25 43 28 30 28 30 31 31 43 47 46 32 31 21 37 36 51 30 30 34 37 28 45 51 30 30 24 51 51 46 26 31 19 19 18 21 28 37 24 36 31 22 31 35 43 16 16 12 47 47 31 38 36 43 38 43 33 31 27 26 30 18 31 38 38 33 10 22 23 31 18 46 16 15 31 31 26 31 31 27 38 33 29 30 21 30 30 18 33 22 36 25 26 27 17 21 30 37 32 33 31 25 32 13 25 46 29 23 36 28 13 23 30 13 12 47 31 13 29 33 38 32 24 27 36 16 26 16 32 30 35 23 31 35 23 39 7 24 23 26 31 24 26 20 17 25 27 14 7 17 33 21 19 33 35 17 23 31 27 37 31 16 39 24 19 27 7 21 18 34 21 19 17 20 24 12 12 10 30 16 32 5 4 29 43 32 9 11 4 6 21 12 19 6 10 7 11 13 22 14 16 24 15 30 12 9 28 40 4 3 31 11 11 14 7 7 5 14 9 9 28 33 34 29 22 13 11 13 21 15 14 14 21 8 10 27 8 20 5 20 8 16 22 13 6 11 17 21 7 5 6 6 23 9 19 16 32 20 28 20 13 16 11 13 21 9 6 14 12 8 7 13 16 11 15 8 7 5 9 16 25 15 10 10 12 16 11 3 3 3 10 4 7 12 22 3 2 3 22 10 26 21 3 1 3 5 6 4 17 4 10 11 11 6 6 14 4 1 4 7 18 11 6 8 16 7 12 5 11 13 8 23 17 11 8 4 4 11	Open. Hide. 62 47 56 47 62 44 42 49 62 62 62 62 62 43 19 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 59 59 59 62 59 59 59 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 33 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 49 56 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 47 49 54 62 62 62 54 47 47 47 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 58 58 58 58 58 58 54 58 58 58 54 58 58 52 58 54 45 45 54 54 58 58 54 34 42 58 48 58 52 45 58 58 58 45 54 58 54 49 52 58 58 58 52 58 58 58 58 58 58 58 49 52 49 58 58 58 54 58 58 58 54 58 58 58 58 54 58 58 50 50 47 42 47 47 49 58 58 51 58 40 42 58 58 58 58 34 58 49 54 58 58 58 58 51 51 46 49 51 58 58 58 36 47 50 47 58 33 58 50 50 40 50 50 46 58 49 50 49 58 50 54 49 49 29 58 42 52 58 42 53 53 40 40 30 52 52 32 49 58 49 39 31 58 50 39 51 58 49 33 42 50 58 39 39 53 50 51 37 38 42 45 52 45 41 32 54 42 49 52 45 23 38 26 49 54 54 40 41 54 49 41 35 52 32 54 46 42 27 45 45 46 37 30 33 53 53 39 41 52 45 54 53 37 42 45 51 32 37 34 54 38 21 54 54 54 54 44 47 51 31 30 34 29 47 47 12 40 35 53 53 32 32 25 32 53 39 31 53 22 34 25 34 34 32 33 32 35 17 52 26 9 15 18 26 23 21 31 32 28 51 51 31 31 35 36 38 33 34 31 30 34 26 30 26 31 32 11 31 30 32 32 27 27 31 31 48 47 27 33 21 29 21 29 29 31 10 31 46 31 43 31 21 31 31 20 26 31 31 21 7 46 9 33 18 25 17 27 31 31 31 31 21 28 37 14 48 25 33 13 31 27 23 21 33 10 11 14 19 20 30 23 39 34 26 23 17 10 10 10 29 11 15 15 30 26 13 15 31 14 38 42 37 21 16 25 25 28 48 48 31 31 31 23 18 21 17 19 32 35 24 25 33 21 19 14 8 22 34 32 14 24 24 34 13 29 23 20 11 24 14 23 39 24 14 22 17 6 5 19 16 16 31 48 37 22 30 6 6 6 16 17 16 4 5 13 4 6 32 39 48 12 20 3 28 24 9 16 15 33 18 9 21 29 10 18 24 40 34 34 12 19 20 17 7 14 38 18 18 28 24 7 10 7 12 5 7 20 8 5 12 28 12 24 27 29 10 12 6 6 18 13 25 7 9 9 9 13 12 26 13 14 34 9 11 12 24 13 11 33 11 6 17 16 16 13 4 4 4 11 10 24 6 5 5 10 20 10 26 8 21 4 4 5 7 4 2 1 5 5 5 20 16 10 6 17 13 8 26 17 9 6 4 3 2 1 1 4 11 13 17 17 7 4 20 5 7 6 14 17 13 6 8 11 10 11 20 7 5 22 11 7 17 13 9 13 11 8 25 5 11 6 9 4 10 22 8 5 25 21 5 15 9 8 7 4 5 9 9 6 20 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_92391212_92392360
seq2: B6Ng01-220I18.b_44_1194 (reverse)

seq1  TCTAGTTTA-GTCTTCAGTACCCCATT-GAAATCCAAAATCAAAATCTCT  48
      ||||||||| |||||||||| |||||| ||| || |||||| ||||||||
seq2  TCTAGTTTAGGTCTTCAGTAACCCATTGGAATTCGAAAATCTAAATCTCT  50

seq1  CCTTCACAAAGCAAGCCAGC-AGCTCCTGCAATGACTGTATCCCTCCTTC  97
       ||||||||||| ||||||| |||||||||||||||||||| ||||||||
seq2  -CTTCACAAAGC-AGCCAGCAAGCTCCTGCAATGACTGTATTCCTCCTTC  98

seq1  GTTCC-TCCAGGTAACCCCC-ACACACACCCTTTTCCGCTCTGTGTGTTG  145
      | ||| |||||||||||||| |||||||||| ||||||||||||||||||
seq2  GGTCCTTCCAGGTAACCCCCAACACACACCC-TTTCCGCTCTGTGTGTTG  147

seq1  AACTCCCCCTACTCCTGCTTGCCTCTCTTTGGGCTTGCAAGAAGTCATCA  195
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCCCCCTACTCCTGCTTGCCTCTCTTTGGGCTTGCAAGAAGTCATCA  197

seq1  ATATCTCTGACAGTATGTAGAATTAAATCACTCATTTCCTGGACATTGTA  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATCTCTGACAGTATGTAGAATTAAATCACTCATTTCCTGGACATTGTA  247

seq1  ATTTAGTTATGAACACAGTCCTAGGAAGCTGTAGACAGAGAAAATCTCAG  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAGTTATGAACACAGTCCTAGGAAGCTGTAGACAGAGAAAATCTCAG  297

seq1  TCATCTGGTATTTTTGTTTCTAGAAATCTGCCCTGTTATGGAGCAAGGCA  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCTGGTATTTTTGTTTCTAGAAATCTGCCCTGTTATGGAGCAAGGCA  347

seq1  GTCCACTCAGGGAAAGTGATCTAAGAGCAGGATGGATGGGAGTCTCCTTA  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCACTCAGGGAAAGTGATCTAAGAGCAGGATGGATGGGAGTCTCCTTA  397

seq1  GTAAATCTCAGCCCTGCCTGCTGCATCAGTCTTTTTAGATGCATTCTGAG  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAATCTCAGCCCTGCCTGCTGCATCAGTCTTTTTAGATGCATTCTGAG  447

seq1  TCCTGATCCTGACCAGGCTATATGAATTGACTTTCTCTATTTTCTGCTAT  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGATCCTGACCAGGCTATATGAATTGACTTTCTCTATTTTCTGCTAT  497

seq1  TAGTGTCCATCAAAGGGCACTACCTTTTGTCCTGTTTCCCACCATTTAAA  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTGTCCATCAAAGGGCACTACCTTTTGTCCTGTTTCCCACCATTTAAA  547

seq1  CAGGGATGAATGACATGGAGCCTGTTGGAATAGGGCCAGGGCAAATCACA  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGATGAATGACATGGAGCCTGTTGGAATAGGGCCAGGGCAAATCACA  597

seq1  CAGCCACAGTTTATCAACTGTCCCACCAGCCTGCACACACACCCATTGGA  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCACAGTTTATCAACTGTCCCACCAGCCTGCACACACACCCATTGGA  647

seq1  CATGAGTGTTATGAGGCCCATCATATCGACAAAATTTGCCTGGGGCTTCT  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGAGTGTTATGAGGCCCATCATATCGACAAAATTTGCCTGGGGCTTCT  697

seq1  GGTTCTTAGTCATTCAATCAAAACAGGTGACTTGAGTGTGGGATGACCCT  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTCTTAGTCATTCAATCAAAACAGGTGACTTGAGTGTGGGATGACCCT  747

seq1  GTGATGGGATAACCAACCACCTGGACAGATGTCCCAACACTTGTCTTTTT  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGATGGGATAACCAACCACCTGGACAGATGTCCCAACACTTGTCTTTTT  797

seq1  GTTGGCAAAACCTCCTGGGAAAGCCACTACTTTCTCTTTTCTGATTCTGT  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGCAAAACCTCCTGGGAAAGCCACTACTTTCTCTTTTCTGATTCTGT  847

seq1  GTTTACCGAGCAATGTTGTATTCTGTTGTCTTCATCAAATTGTTTGGCCA  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTACCGAGCAATGTTGTATTCTGTTGTCTTCATCAAATTGTTTGGCCA  897

seq1  AGATGAATGTGCCCTGTGGAGGTGGCTGAGGCTGAACCAGTTGCCAACTG  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGAATGTGCCCTGTGGAGGTGGCTGAGGCTGAACCAGTTGCCAACTG  947

seq1  AAAAGGAATTAAGTTGTCGATGAGCCATAGATGAGCTCCCGAGGAACTAG  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGAATTAAGTTGTCGATGAGCCATAGATGAGCTCCCGAGGAACTAG  997

seq1  GTAAACTGGAACCTTGAGGACATGGACAAACCAGCATTGCTGGTGCACTC  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAACTGGAACCTTGAGGACATGGACAAACCAGCATTGCTGGTGCACTC  1047

seq1  TTGGGATGTCATGGCTTAGGGTTAATGTGGGACAGGAATCACTGGTAGAG  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGATGTCATGGCTTAGGGTTAATGTGGGACAGGAATCACTGGTAGAG  1097

seq1  CTTAAGGTGAAGATGGAAAGGTGATAATACTGGAGTGGGGAGAAAAGAGA  1145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAAGGTGAAGATGGAAAGGTGATAATACTGGAGTGGGGAGAAAAGAGA  1147

seq1  ATTC  1149
      ||||
seq2  ATTC  1151

seq1: chr2_92269408_92270411
seq2: B6Ng01-220I18.g_67_1058

seq1  GAATTCACTTGTTCATAAAAACTCAAGAAGTTCCACTGTGGCATGCACTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTTGTTCATAAAAACTCAAGAAGTTCCACTGTGGCATGCACTT  50

seq1  CAACTTGACCTCAATATTGGTACTCTGTACATTTTTGTTTCAACTTTGCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTTGACCTCAATATTGGTACTCTGTACATTTTTGTTTCAACTTTGCT  100

seq1  TTTACTGGGTTCTACCTCAACCCCTAAGAAACTTTTAACTAGTGGGGTGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACTGGGTTCTACCTCAACCCCTAAGAAACTTTTAACTAGTGGGGTGG  150

seq1  TAGTGGCCCTTGCCTTTAATCCCAGCCCTTGGGAGGCAGAGGCAGGCGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTGGCCCTTGCCTTTAATCCCAGCCCTTGGGAGGCAGAGGCAGGCGGA  200

seq1  TCTCTATGAGCCAGCATGGTCTATAGCGTGAGTTTCAGGACAGACAAACT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTATGAGCCAGCATGGTCTATAGCGTGAGTTTCAGGACAGACAAACT  250

seq1  ACAGTGAAACCATCTCAAGCTCCAACCACCACCACGAAAGGGCAATGCTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTGAAACCATCTCAAGCTCCAACCACCACCACGAAAGGGCAATGCTG  300

seq1  AGCTACTTCCACCATGGTCCCCAGGATGGACCCAGAACAGCTTCCCAGGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTACTTCCACCATGGTCCCCAGGATGGACCCAGAACAGCTTCCCAGGA  350

seq1  GGCAATAGGAAGGAGACAGGGAGATCCCTGAGTAGTTTCCAGCCCCCAGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAATAGGAAGGAGACAGGGAGATCCCTGAGTAGTTTCCAGCCCCCAGG  400

seq1  CAGCCACAGACAGGGAGGCCACTGCCATGACATCACCTTTTGTATCTGCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCACAGACAGGGAGGCCACTGCCATGACATCACCTTTTGTATCTGCT  450

seq1  GCTCTGCAAAGCACCGAAAGAACTGGAGCTAGCTGCTCCTGGAGAGTGCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTGCAAAGCACCGAAAGAACTGGAGCTAGCTGCTCCTGGAGAGTGCC  500

seq1  CACCAGACAGGCCTAGGCTGTCTTAGCCAGGGAGAACTGGCCTTTCCCTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCAGACAGGCCTAGGCTGTCTTAGCCAGGGAGAACTGGCCTTTCCCTC  550

seq1  TGTGCTCCCTTCGAGCCCTCCTCTGCCCCTGCTCACTTCTCTTTACTTAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCTCCCTTCGAGCCCTCCTCTGCCCCTGCTCACTTCTCTTTACTTAA  600

seq1  GGAGGGGGGAACGCAAAGGAAAACAGGTGAGCACTGGAAGGGTTGGCGTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGGGGGAACGCAAAGGAAAACAGGTGAGCACTGGAAGGGTTGGCGTC  650

seq1  GGGGCTGATCGTCACGCTTGCTCCAAGGGGAGATCACAGGGCCACAGTGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGCTGATCGTCACGCTTGCTCCAAGGGGAGATCACAGGGCCACAGTGC  700

seq1  AGAGCACACCCCCTGAGGGAGCAGTCA-CAGACCCTAAGGGTGCGGCCAG  749
      ||||||||||||||||||||||||||| |||||||||| |||||||||||
seq2  AGAGCACACCCCCTGAGGGAGCAGTCACCAGACCCTAA-GGTGCGGCCAG  749

seq1  AGCTCCACCTTTTGAATAGTCCTTGCTCCAGAATTACGTAAGTTCCCTGG  799
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  AGCTCCACCTTTTGAATAGTCCTTGCT-CAGAATTACGTAAGTTCCCTGG  798

seq1  AGCCAGGGGAGACAGAACTGGAGAAAACCAAATTGGGATTTCCAAAAATA  849
      ||||||||||||||| ||| ||||||| |||||||||| |||||||||||
seq2  AGCCAGGGGAGACAG-ACT-GAGAAAA-CAAATTGGGA-TTCCAAAAATA  844

seq1  CAGGGAAAACTG-TCATCCAGCAACTCTAGGAGGCGATCCCTTCAGAACA  898
      ||||||||  || ||||||||||  ||||||||||||||||||||| |||
seq2  CAGGGAAACTTGTTCATCCAGCACTTCTAGGAGGCGATCCCTTCAG-ACA  893

seq1  AGT-GAGTTCCATAC-TTCCACTCAGAGAGATCTTTTGGGGGGACAGAAG  946
      ||| ||||||  ||| ||||||||||| ||||||||   ||||||   | 
seq2  AGTGGAGTTCATTACTTTCCACTCAGA-AGATCTTT---GGGGAC--GAT  937

seq1  TGGCTGTGTTGAGAAACACTTGATTTATCTGTTAATGGAGTGGAGGGTAG  996
      |||||| |||||||||||||||| ||||||||| ||||| |||| |||||
seq2  TGGCTG-GTTGAGAAACACTTGAATTATCTGTT-ATGGA-TGGAAGGTAG  984

seq1  GAGTGGGT  1004
      ||||||||
seq2  GAGTGGGT  992

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information