MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-228K10
Chromosome	2 (Build37)
Map Location	162,948,840 - 163,092,297
singlet/doublet	doublet
Overlap gene	LOC269389
Upstream gene	Ptprt, LOC100043895, LOC100043896, LOC100043696, LOC497655, LOC668947, Sfrs6, L3mbtl, LOC241765, Sgk2, Ift52, Mybl2, 2410116G06Rik
Downstream gene	Jph2, 3230401D17Rik, LOC100043708, Gdap1l1, D930001I22Rik, LOC100043899, Hnf4a, 5830472M02Rik, Serinc3, Pkig, Ada, Wisp2, Kcnk15, Rims4, Ywhab, LOC381404, Tomm34, Stk4, Kcns1, Wfdc5, Wfdc12, Wfdc15a, Wfdc15b, Svs2, Svs3b
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ptprt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19281 MGI:1321152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043895 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100043896 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043896
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC100043696 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043696
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 79 ESTs, 5 Proteins

name	LOC497655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:497655
definition	note : protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a pseudogene pseudo : _no_value

name	LOC668947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Sfrs6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67996 MGI:1915246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	L3mbtl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241764 MGI:2676663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC241765 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:241765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 69 ESTs, 23 Proteins pseudo : _no_value

name	Sgk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27219 MGI:1351318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ift52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245866 MGI:2387217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mybl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17865 MGI:101785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410116G06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68236 MGI:1915486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC269389 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:269389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 4 Proteins

name	Jph2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59091 MGI:1891496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3230401D17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66680 MGI:1913930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043708 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gdap1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228858 MGI:2385163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D930001I22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228859 MGI:2444508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043899 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 8 Proteins

name	Hnf4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15378 MGI:109128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830472M02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76080 MGI:1923330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Serinc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26943 MGI:1349457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkig (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18769 MGI:1343086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ada (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11486 MGI:87916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wisp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22403 MGI:1328326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnk15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241769 MGI:2675209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rims4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241770 MGI:2674366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ywhab (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54401 MGI:1891917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC381404 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 7 Proteins

name	Tomm34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67145 MGI:1914395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58231 MGI:1929004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcns1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16538 MGI:1197019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209232 MGI:2384800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192200 MGI:2183434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc15a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68221 MGI:1915471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc15b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192201 MGI:2445041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Svs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53878 MGI:1858275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Svs3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329557 MGI:3583778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptprt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371259 GeneID:19281 MGI:1321152
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, T transcript_id : NM_021464.2

name	LOC100043895 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250243 GeneID:100043895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100043895 transcript_id : XM_001481185.1

name	LOC100043896 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250245 GeneID:100043896
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100043896 transcript_id : XM_001481186.1

name	LOC100043696 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250100 GeneID:100043696
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 79 ESTs, 5 Proteins product : similar to ribosomal protein L10 transcript_id : XM_001480756.1

name	Sfrs6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366948 GeneID:67996 MGI:1915246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 6 transcript_id : NM_026499.3

name	L3mbtl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486778 GeneID:241764 MGI:2676663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : l(3)mbt-like (Drosophila) transcript_id : NM_001081338.1

name	Sgk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305482 GeneID:27219 MGI:1351318
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum/glucocorticoid regulated kinase 2 transcript_id : NM_013731.1

name	Ift52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381777 GeneID:245866 MGI:2387217
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intraflagellar transport 52 homolog (Chlamydomonas) transcript_id : NM_172150.3

name	Mybl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543275 GeneID:17865 MGI:101785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloblastosis oncogene-like 2 transcript_id : NM_008652.2

name	2410116G06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802654 GeneID:68236 MGI:1915486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410116G06 gene transcript_id : NM_026630.2

name	LOC269389 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250248 GeneID:269389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 4 Proteins product : similar to granulosa cell HMG-box protein-1 transcript_id : XM_001481188.1

name	Jph2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10947009 GeneID:59091 MGI:1891496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : junctophilin 2 transcript_id : NM_021566.1

name	3230401D17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981222 GeneID:66680 MGI:1913930
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3230401D17 gene transcript_id : NM_025699.2

name	LOC100043708 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250106 GeneID:100043708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043708 transcript_id : XM_001480769.1

name	Gdap1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450260 GeneID:228858 MGI:2385163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ganglioside-induced differentiation-associated protein 1-like 1 transcript_id : NM_144891.1

name	D930001I22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376308 GeneID:228859 MGI:2444508
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D930001I22 gene transcript_id : NM_173397.3

name	LOC100043899 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250250 GeneID:100043899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 8 Proteins product : similar to novel SCP-like extracellular protein domain containing protein transcript_id : XM_001481189.1

name	Hnf4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575915 GeneID:15378 MGI:109128
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepatic nuclear factor 4, alpha transcript_id : NM_008261.2

name	5830472M02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821701 GeneID:76080 MGI:1923330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830472M02 gene transcript_id : NM_029512.2

name	5830472M02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821695 GeneID:76080 MGI:1923330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830472M02 gene transcript_id : NM_181734.3

name	Serinc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801816 GeneID:26943 MGI:1349457
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine incorporator 3 transcript_id : NM_012032.3

name	Pkig (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476071 GeneID:18769 MGI:1343086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase inhibitor, gamma transcript_id : NM_001039390.1

name	Pkig (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476075 GeneID:18769 MGI:1343086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase inhibitor, gamma transcript_id : NM_011106.2

name	Pkig (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476073 GeneID:18769 MGI:1343086
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase inhibitor, gamma transcript_id : NM_001039391.1

name	Ada (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353155 GeneID:11486 MGI:87916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase transcript_id : NM_007398.3

name	Wisp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8394540 GeneID:22403 MGI:1328326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WNT1 inducible signaling pathway protein 2 transcript_id : NM_016873.1

name	Kcnk15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71892415 GeneID:241769 MGI:2675209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel, subfamily K, member 15 transcript_id : NM_001030292.1

name	Rims4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942096 GeneID:241770 MGI:2674366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulating synaptic membrane exocytosis 4 transcript_id : NM_183023.1

name	Ywhab (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803142 GeneID:54401 MGI:1891917
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide transcript_id : NM_018753.4

name	LOC381404 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250108 GeneID:381404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 7 Proteins product : similar to orthologue of H. sapiens chromosome 20 open reading frame 119 (C20orf119) transcript_id : XM_001480780.1

name	Tomm34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378078 GeneID:67145 MGI:1914395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of outer mitochondrial membrane 34 transcript_id : NM_025996.2

name	Stk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361509 GeneID:58231 MGI:1929004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 4 transcript_id : NM_021420.3

name	Kcns1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821678 GeneID:16538 MGI:1197019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : K+ voltage-gated channel, subfamily S, 1 transcript_id : NM_008435.2

name	Wfdc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778836 GeneID:209232 MGI:2384800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 5 transcript_id : NM_145369.2

name	Wfdc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981675 GeneID:192200 MGI:2183434
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 12 transcript_id : NM_138684.2

name	Wfdc15a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802871 GeneID:68221 MGI:1915471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 15A transcript_id : NM_183271.2

name	Wfdc15b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930766 GeneID:192201 MGI:2445041
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 15B transcript_id : NM_001045554.1

name	Wfdc15b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930763 GeneID:192201 MGI:2445041
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 15B transcript_id : NM_138685.2

name	Svs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802212 GeneID:53878 MGI:1858275
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle secretory protein 2 transcript_id : NM_017390.3

name	Svs3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378040 GeneID:329557 MGI:3583778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle secretory protein 3B transcript_id : NM_173377.2

name	Ptprt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946856 CCDS:CCDS17001.1 GeneID:19281 MGI:1321152
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 note : receptor protein tyrosine phosphatase-rho product : protein tyrosine phosphatase, receptor type, T protein_id : NP_067439.1

name	LOC100043895 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250244 GeneID:100043895
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481235.1

name	LOC100043896 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250246 GeneID:100043896
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481236.1

name	LOC100043696 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250101 GeneID:100043696
definition	codon_start : 1 product : similar to ribosomal protein L10 protein_id : XP_001480806.1

name	Sfrs6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543689 CCDS:CCDS17002.1 GeneID:67996 MGI:1915246
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : arginine/serine-rich splicing factor 6 protein_id : NP_080775.2

name	L3mbtl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486779 GeneID:241764 MGI:2676663
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Lethal(3)malignant brain tumor-like protein product : l(3)mbt-like protein_id : NP_001074807.1

name	Sgk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305483 CCDS:CCDS17004.1 GeneID:27219 MGI:1351318
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0015459 - potassium channel regulator activity [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004682 - protein kinase CK2 activity [Evidence ISS]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0017080 - sodium channel regulator activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence ISS] [Evidence IEA] codon_start : 1 note : serum/glucocorticoid regulated kinase-like product : serum/glucocorticoid regulated kinase 2 protein_id : NP_038759.1

name	Ift52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981999 CCDS:CCDS17005.1 GeneID:245866 MGI:2387217
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0042733 - embryonic digit morphogenesis [Evidence IMP]; GO:0001947 - heart looping [Evidence IMP]; GO:0001841 - neural tube formation [Evidence IMP]; GO:0045862 - positive regulation of proteolysis [Evidence IMP]; GO:0007224 - smoothened signaling pathway [Evidence IMP] codon_start : 1 product : intraflagellar transport 52 homolog protein_id : NP_742162.2

name	Mybl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678974 CCDS:CCDS17006.1 GeneID:17865 MGI:101785
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : myeloblastosis oncogene-like 2 protein_id : NP_032678.1

name	2410116G06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386118 CCDS:CCDS17007.1 GeneID:68236 MGI:1915486
definition	codon_start : 1 product : hypothetical protein LOC68236 protein_id : NP_080906.1

name	LOC269389 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250249 GeneID:269389
definition	codon_start : 1 product : similar to granulosa cell HMG-box protein-1 protein_id : XP_001481238.1

name	Jph2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10947010 CCDS:CCDS17008.1 GeneID:59091 MGI:1891496
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005792 - microsome [Evidence IDA]; GO:0016529 - sarcoplasmic reticulum [Evidence IDA] [Evidence TAS]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007204 - elevation of cytosolic calcium ion concentration [Evidence IMP] codon_start : 1 product : junctophilin 2 protein_id : NP_067541.1

name	3230401D17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981223 CCDS:CCDS17009.1 GeneID:66680 MGI:1913930
definition	codon_start : 1 product : oxidative stress responsive 1 protein_id : NP_079975.2

name	LOC100043708 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250107 GeneID:100043708
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480819.1

name	Gdap1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450261 GeneID:228858 MGI:2385163
definition	codon_start : 1 product : ganglioside-induced differentiation-associated protein 1-like 1 protein_id : NP_659140.1

name	D930001I22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734174 GeneID:228859 MGI:2444508
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC228859 protein_id : NP_775573.1

name	LOC100043899 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250251 GeneID:100043899
definition	codon_start : 1 product : similar to novel SCP-like extracellular protein domain containing protein protein_id : XP_001481239.1

name	Hnf4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575916 CCDS:CCDS17012.1 GeneID:15378 MGI:109128
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : HNF4 alpha; Nuclear receptor 2A1 product : hepatic nuclear factor 4, alpha protein_id : NP_032287.2

name	5830472M02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821702 GeneID:76080 MGI:1923330
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76080 protein_id : NP_083788.2

name	5830472M02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821696 GeneID:76080 MGI:1923330
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76080 protein_id : NP_859423.2

name	Serinc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543853 CCDS:CCDS17013.1 GeneID:26943 MGI:1349457
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0006917 - induction of apoptosis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : tumor differentially expressed 1 product : tumor differentially expressed protein 1 protein_id : NP_036162.2

name	Pkig (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476072 CCDS:CCDS17014.1 GeneID:18769 MGI:1343086
definition	GO_function : GO:0004862 - cAMP-dependent protein kinase inhibitor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA] GO_process : GO:0006469 - negative regulation of protein kinase activity [Evidence IEA] codon_start : 1 product : cAMP-dependent protein kinase inhibitor gamma protein_id : NP_001034479.1

name	Pkig (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476074 CCDS:CCDS17014.1 GeneID:18769 MGI:1343086
definition	GO_function : GO:0004862 - cAMP-dependent protein kinase inhibitor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA] GO_process : GO:0006469 - negative regulation of protein kinase activity [Evidence IEA] codon_start : 1 product : cAMP-dependent protein kinase inhibitor gamma protein_id : NP_001034480.1

name	Pkig (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755088 CCDS:CCDS17014.1 GeneID:18769 MGI:1343086
definition	GO_function : GO:0004862 - cAMP-dependent protein kinase inhibitor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA] GO_process : GO:0006469 - negative regulation of protein kinase activity [Evidence IEA] codon_start : 1 product : cAMP-dependent protein kinase inhibitor gamma protein_id : NP_035236.1

name	Ada (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680636 CCDS:CCDS17015.1 GeneID:11486 MGI:87916
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0004000 - adenosine deaminase activity [Evidence IDA] [Evidence IMP]; GO:0019239 - deaminase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IMP]; GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0006163 - purine nucleotide metabolism [Evidence IMP]; GO:0009168 - purine ribonucleoside monophosphate biosynthesis [Evidence IEA] codon_start : 1 product : adenosine deaminase protein_id : NP_031424.1

name	Wisp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394541 CCDS:CCDS17016.1 GeneID:22403 MGI:1328326
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence ISS]; GO:0005520 - insulin-like growth factor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IDA] codon_start : 1 exception : mismatches in translation product : WNT1 inducible signaling pathway protein 2 protein_id : NP_058569.1

name	Kcnk15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71892416 CCDS:CCDS17017.1 GeneID:241769 MGI:2675209
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005267 - potassium channel activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 product : potassium channel, subfamily K, member 15 protein_id : NP_001025463.1

name	Rims4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942097 CCDS:CCDS17018.1 GeneID:241770 MGI:2674366
definition	GO_component : GO:0045202 - synapse [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : RIM4 gamma product : regulating synaptic membrane exocytosis 4 protein_id : NP_898844.1

name	Ywhab (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543974 CCDS:CCDS17019.1 GeneID:54401 MGI:1891917
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0019904 - protein domain specific binding [Evidence IDA] GO_process : GO:0006605 - protein targeting [Evidence IDA] codon_start : 1 note : 14-3-3 protein beta; tyrosine 3/tryptophan 5 -monooxygenase activation protein, beta polypeptide product : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide protein_id : NP_061223.2

name	LOC381404 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250109 GeneID:381404
definition	codon_start : 1 product : similar to orthologue of H. sapiens chromosome 20 open reading frame 119 (C20orf119) protein_id : XP_001480830.1

name	Tomm34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385500 CCDS:CCDS17020.1 GeneID:67145 MGI:1914395
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : translocase of outer mitochondrial membrane 34a; Tom34a, translocase of outer mitochondrial membrane 34a; translocase of outer mitochondrial membrane 34b; Tom34b, translocase of outer mitochondrial membrane 34b product : translocase of outer mitochondrial membrane 34 protein_id : NP_080272.1

name	Stk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12328814 CCDS:CCDS17021.1 GeneID:58231 MGI:1929004
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0000902 - cell morphogenesis [Evidence ISS]; GO:0046777 - protein amino acid autophosphorylation [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS] codon_start : 1 note : STE20-like kinase MST1; Yeast Sps1/Ste20-related kinase 3 product : serine/threonine kinase 4 protein_id : NP_067395.1

name	Kcns1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821679 CCDS:CCDS17022.1 GeneID:16538 MGI:1197019
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0008076 - voltage-gated potassium channel complex [Evidence ISS] [Evidence IEA] GO_function : GO:0005251 - delayed rectifier potassium channel activity [Evidence ISS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0015459 - potassium channel regulator activity [Evidence ISS]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : K+ voltage-gated channel, subfamily S, 1 protein_id : NP_032461.2

name	Wfdc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778837 CCDS:CCDS17023.1 GeneID:209232 MGI:2384800
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : WAP four-disulfide core domain 5 protein_id : NP_663344.2

name	Wfdc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149778 GeneID:192200 MGI:2183434
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0042742 - defense response to bacterium [Evidence IDA] [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : elafin-like protein II; single WAP motif protein 2 product : WAP four-disulfide core domain 12 protein_id : NP_619625.1

name	Wfdc15a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304062 GeneID:68221 MGI:1915471
definition	codon_start : 1 note : novel protein containing a WAP-type (Whey Acidic Protein) 'four-disulfide core' domain product : WAP four-disulfide core domain-like 1 protein_id : NP_899094.1

name	Wfdc15b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930767 GeneID:192201 MGI:2445041
definition	GO_process : GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : single WAP motif protein 1; elafin-like protein I product : WAP four-disulfide core domain 15 protein_id : NP_001039019.1

name	Wfdc15b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149780 GeneID:192201 MGI:2445041
definition	GO_process : GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : single WAP motif protein 1; elafin-like protein I product : WAP four-disulfide core domain 15 protein_id : NP_619626.1

name	Svs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980848 CCDS:CCDS17027.1 GeneID:53878 MGI:1858275
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0030141 - secretory granule [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0019953 - sexual reproduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : semenoclotin; seminal vesicle protein, secretion 2; SVS II product : seminal vesicle secretory protein 2 protein_id : NP_059086.2

name	Svs3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27881417 GeneID:329557 MGI:3583778
definition	codon_start : 1 note : SVS III; novel protein similar to seminal vesicle secretion 3 (Svs3) product : seminal vesicle secretion 3 beta protein_id : NP_775553.1

name	LOC668947 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668947
definition	number : 1 pseudo : _no_value

name	LOC241765 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250247 GeneID:241765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 69 ESTs, 23 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_035035.1

clone name	MSMg01-474B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320D06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-363P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520J22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-049P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379B22
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-073K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234J22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-228K10.b	B6Ng01-228K10.g
ACC	GA042012	GA042013
length	1,184	893
definition	B6Ng01-228K10.b	B6Ng01-228K10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(162,948,840 - 162,949,985)	(163,091,578 - 163,092,297)
sequence	gaattcttgttccttgtgtgtgtgtgtgtgtgtgtgtatgtacacatgtg catgcattcatgcagatgcaaaaatacaagttctggtgtcatctttagga atgttgtccacctcctttaggcaggctctctctttggcccaaagctcacc aactaggctgggttggctggccaagccccaggagtctttacctgtcacaa tagtgcaggactataagcacacaccacaatgcctgcctttttaaatgtgg cttatggaggtgattggacttaggccctcctgtttttaaggcgggtgctt tatagacttagctggttttgtttgtttggttttgtttagtttcgaacaaa atctcaatcatttatatttaccagtgaagattcgggagccagatgttggg gcgaaagcctgctacttcagagacagagaaagcacccagctgaccttcct cttcagccgacatcccagaaggaatccaccctcacatcagctcaaaaaac ctccttcaaactgaatgtccccctcttctacttcctgtgagcctctctat ccatccccctgactccctcttcctctctatggtttcatcttaatcctatg ttcacttcctgtcagctggttgctcgctctgtcttctgacctatggttgg acttatttaatcctgcttacgatattcaagtagaaggctctttgggttaa aggtatgtgttaaagctgaggcccaccacaactaaaaacagggttttcca gtaaataaacacaagcccggggttcacagtgtgatgatcaaatatcctgc aacacctggctggaggtgctctctaggagagactagatcacagggattct gaccccatcagtgaacaagtccattgaatgagtgcgcacctgactgggat gctaggggcagtattcaagctggaaggaagtcaccggggtacaagccttt gaagggccacacctttgtcttgggaatcccttccctctcacgccgttgtt ctagcttccttgcaacaacagaagcaatcctctgctcctgctgtctggtt tcccaccatgtttttggccttctctgttgggccgggtcttcaccctcaat aggtcttcaggtccccttttattttgacatctgttaacattttcattgta gaaaaccttttccatttccctccggctcggttta	gaattccaggggctagcctaggctatataagcccccatttaaacaaataa acaaatatcaggacaggggagaaaaacaggctaaaaccataaacaaagga agacacttgaacacatctcatcaggaactgacaagtcaaccaggaacaaa tgaataaggaagacgggacgatggctcagtgattagggaagatggctcag tggttagggaagattgctcagtggctagggaagataggtcagtggttaag agcacttattgatcttgtagaagacccagattaggttttcagcacccaca tggtttcacaaccatccctagccatcagtccctgggatcaaccctcttct gactatataaacattaccttagcaaaagctgagatgcgaacaatgggaaa ttaataccttttacttaaataactttcttagaagataagaaaggcgccgg gcagtggtggcacacgcctttaatcccagcactagggaggcagaggcagg cagatttctgagttcgaggccagcctggtctacagagtgagttccaggac agccagggctatacagggaaaccctgtctcgaaacaaaacaaacaaccaa acaaaaacagaagataagaaaggtaaaaccggggctggtgagatggctca gtgggtaagagcacccgactgctctttccgaaggtccgggagttcaaatc ccagcaactacatggtggctcacaaccatctgtaacaagatctgatgccc ttcttcttggagtgtctgaagacagctacatgtacttacatattataaat taaataaatcttttaaaaaaaaaaaaagaaaggtaaaaccatgtaatcag cactcttgttgaagaagcagaaacaggaaaaactaaattaaag
quality values	Open. Hide. 41 22 27 15 47 58 54 54 38 52 58 58 58 62 62 62 54 62 62 54 47 49 47 54 54 54 62 62 62 31 23 19 14 19 20 19 21 31 20 28 25 26 51 43 59 59 62 62 62 62 46 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 49 41 43 28 33 50 49 38 34 34 28 48 50 51 59 62 62 62 62 59 59 51 62 59 62 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 59 62 56 62 59 59 59 62 59 62 62 62 62 54 59 62 62 62 59 54 62 62 62 59 59 56 56 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 50 62 59 59 62 59 62 59 59 56 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 54 59 59 62 62 59 62 62 62 62 56 62 59 62 62 62 59 59 59 62 56 56 62 59 59 56 59 50 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 50 54 29 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 56 62 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 59 50 62 59 62 59 59 62 62 62 62 51 43 59 56 59 62 62 62 62 62 62 59 62 62 62 62 59 59 46 59 59 62 59 50 50 62 43 59 62 62 59 59 59 59 59 59 50 43 56 46 46 59 59 56 56 59 59 59 59 59 56 62 62 59 51 59 62 56 62 62 62 62 62 62 62 59 51 62 62 51 62 44 59 59 59 62 59 59 62 62 59 56 51 59 43 56 56 62 50 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 54 62 62 62 62 33 47 62 62 62 56 56 51 56 51 56 47 56 62 62 62 62 62 62 37 42 56 56 43 56 56 47 62 62 62 62 62 62 54 62 56 56 62 62 47 62 62 62 62 62 10 16 10 13 10 18 56 62 54 41 62 62 62 47 56 62 62 62 62 62 62 54 62 62 54 42 54 52 44 52 43 62 62 47 62 62 62 62 52 62 43 34 43 43 38 41 38 41 62 47 62 48 31 58 58 52 58 58 54 52 54 54 54 50 54 54 52 52 54 35 54 54 38 34 36 58 52 41 39 42 47 17 15 39 42 26 52 41 42 54 54 52 54 58 46 46 45 15 54 52 54 54 37 42 45 52 42 47 42 19 52 52 24 39 50 53 31 10 54 16 25 39 45 41 43 34 52 52 33 33 27 16 17 20 12 39 13 28 22 27 28 25 51 54 39 51 21 47 46 50 48 34 32 50 35 37 22 20 50 40 50 58 35 47 34 50 40 21 36 50 28 58 50 50 21 32 25 37 49 26 15 22 16 15 28 15 28 50 34 15 20 23 26 24 30 21 58 58 32 35 29 30 28 32 37 26 17 50 29 40 54 31 41 37 32 25 19 25 32 34 34 53 28 11 17 41 39 50 18 33 32 26 39 34 50 21 23 33 50 40 41 15 33 6 29 26 14 15 24 28 28 28 19 13 52 13 38 16 37 22 29 25 8 24 25 19 32 27 23 11 40 17 18 32 30 25 13 15 33 10 44 40 47 16 41 38 13 11 32 27 17 27 42 24 35 23 31 24 32 30 39 28 26 10 18 19 26 41 9 30 31 18 14 35 23 29 30 17 26 40 26 18 14 10 13 7 9 10 16 32 29 33 40 41 10 9 32 14 22 34 22 18 16 25 25 28 25 26 27 32 8 20 21 12 41 22 14 9 15 9 15 31 8 34 40 22 5 25 15 30 34 21 34 31 31 29 33 21 11 11 13 40 26 10 8 15 11 11 16 19 16 31 23 29 7 15 13 6 7 41 20 21 14 7 41 51 32 12 13 7 25 30 19 16 6 9 6 8 5 7 26 8 16 6 29 8 8 16 9 7 9 30 42 26 29 43 14 11 13 14 12 14 46 14 9 17 29 15 28 36 9 10 21 11 11 6 9 7 16 31 32 24 16 14 9 6 9 25 24 14 6 8 9 18 20 18 41 8 31 41 14 11 21 29 11 13 29 23 31 31 29 22 10 9 26 11 18 10 24 13 10 6 12 21 18 9 27 29 9 7 13 38 9 6 21 11 31 10 7 9 32 25 11 21 10 11 9 12 13 32 11 29 15 15 19 11 9 6 28 28 34 34 22 34 34 17 13 6 10 17 8 9 5 5 11 30 10 14 5 4 5 5 6 12 13 4 10 13 10 8 16 15 17 21 11 7 4 3 3 8 24 12 6 6 5 29 32 19 9 3 3 17 28 13 16 11 7 9 11 5 10 6 5 5 5 20 18 3 21 28 8	Open. Hide. 47 47 39 47 62 62 47 30 62 62 62 22 20 16 9 10 13 20 21 21 24 30 31 44 50 56 56 62 59 56 50 62 62 62 62 62 59 62 62 59 59 59 59 59 59 62 62 62 62 56 59 62 59 56 54 62 59 43 39 28 23 43 40 46 35 37 48 28 32 33 35 54 54 62 62 62 59 59 59 62 56 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 59 62 62 59 62 62 59 54 62 62 59 62 50 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 59 59 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 56 62 62 62 62 62 62 59 62 62 62 62 59 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 56 56 62 59 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 56 49 49 62 59 51 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 54 59 62 54 56 59 62 62 56 62 59 59 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 46 46 62 62 62 45 59 59 59 50 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 45 45 45 44 44 44 50 59 51 62 62 62 62 62 56 62 62 44 47 54 62 62 50 62 56 62 62 62 62 62 62 62 51 62 62 62 62 47 47 54 62 56 62 47 56 56 62 51 51 50 56 56 56 62 62 62 56 62 62 62 62 38 56 62 56 62 62 62 62 62 62 62 62 54 62 62 56 62 36 43 40 39 42 62 56 50 46 47 62 56 62 47 47 56 62 38 47 62 54 43 62 62 62 56 62 39 46 56 56 56 62 62 62 62 62 52 62 52 43 54 43 33 43 52 52 47 19 47 45 41 52 62 62 52 43 48 62 62 62 49 48 62 52 62 31 54 42 52 43 47 62 48 52 58 48 58 58 44 45 58 58 54 54 54 52 54 54 30 52 34 24 40 32 42 30 37 52 52 52 52 48 45 35 52 50 52 37 46 46 40 47 48 27 25 47 29 19 32 35 50 34 27 52 35 47 52 54 31 22 33 33 23 33 37 31 52 47 43 48 42 52 54 47 52 27 23 25 20 23 27 35 54 41 42 32 49 58 43 58 34 46 38 46 54 31 52 40 52 46 58 32 52 46 52 58 52 58 30 8 50 27 38 48 23 51 29 19 47 25 39 34 7 33 28 44 19 29 50 52 31 33 43 36 41 58 50 46 25 37 32 33 42 32 31 50 24 49 48 58 21 29 33 32 51 37 37 35 11 49 37 58 36 51 50 39 37 25 19 32 19 7 58 40 31 32 39 46 30 35 18 34 22 54 53 23 7 15 54 22 32 6 6 16 50 50 25 31 52 18 40 29 38 39 26 22 23 21 32 30 35 53 28 16 10 10 54 14 41 45 33 51 32 45 23 39 25 25 14 54 31 49 54 18 11 6 13 54 8 15 44 54 17 33 18 10 53 53 37 40 52 53 53 51 54 46 54 51 46 47 47 42 28 42 33 24 25 37 13 12 21 35 15 11 9 13 32 22 17 10 8 32 18 30 35 33 23 23 53 9 5 9 14 28 39 35 34 19 15 33 25 13 28 7 21 47 47 13 30 12 6 6 8 40 40 41 18 32 10 31 51 10 29 18 22 42 26 24

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_162948840_162949985
seq2: B6Ng01-228K10.b_46_1229

seq1  GAATTCTTGTTCCTTGTGTGTGTGTGTGTGTGTGTGTGTATGTACACATG  50
      ||||||||||||||  ||||||||||||||||||||||||||||||||||
seq2  GAATTCTTGTTCCT--TGTGTGTGTGTGTGTGTGTGTGTATGTACACATG  48

seq1  TGCATGCATTCATGCAGATGCAAAAATACAAGTTCTGGTGTCATCTTTAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATGCATTCATGCAGATGCAAAAATACAAGTTCTGGTGTCATCTTTAG  98

seq1  GAATGTTGTCCACCTCCTTTAGGCAGGCTCTCTCTTTGGCCCAAAGCTCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATGTTGTCCACCTCCTTTAGGCAGGCTCTCTCTTTGGCCCAAAGCTCA  148

seq1  CCAACTAGGCTGGGTTGGCTGGCCAAGCCCCAGGAGTCTTTACCTGTCAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAACTAGGCTGGGTTGGCTGGCCAAGCCCCAGGAGTCTTTACCTGTCAC  198

seq1  AATAGTGCAGGACTATAAGCACACACCACAATGCCTGCCTTTTTAAATGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAGTGCAGGACTATAAGCACACACCACAATGCCTGCCTTTTTAAATGT  248

seq1  GGCTTATGGAGGTGATTGGACTTAGGCCCTCCTGTTTTTAAGGCGGGTGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTATGGAGGTGATTGGACTTAGGCCCTCCTGTTTTTAAGGCGGGTGC  298

seq1  TTTATAGACTTAGCTGGTTTTGTTTGTTTGGTTTTGTTTAGTTTCGAACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATAGACTTAGCTGGTTTTGTTTGTTTGGTTTTGTTTAGTTTCGAACA  348

seq1  AAATCTCAATCATTTATATTTACCAGTGAAGATTCGGGAGCCAGATGTTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCTCAATCATTTATATTTACCAGTGAAGATTCGGGAGCCAGATGTTG  398

seq1  GGGCGAAAGCCTGCTACTTCAGAGACAGAGAAAGCACCCAGCTGACCTTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCGAAAGCCTGCTACTTCAGAGACAGAGAAAGCACCCAGCTGACCTTC  448

seq1  CTCTTCAGCCGACATCCCAGAAGGAATCCACCCTCACATCAGCTCAAAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTCAGCCGACATCCCAGAAGGAATCCACCCTCACATCAGCTCAAAAA  498

seq1  ACCTCCTTCAAACTGAATGTCCCCCTCTTCTACTTCCTGTGAGCCTCTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTCCTTCAAACTGAATGTCCCCCTCTTCTACTTCCTGTGAGCCTCTCT  548

seq1  ATCCATCCCCCTGACTCCCTCTTCCTCTCTATGGTTTCATCTTAATCCTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCATCCCCCTGACTCCCTCTTCCTCTCTATGGTTTCATCTTAATCCTA  598

seq1  TGTTCACTTCCTGTCAGCTGGTTGCTCGCTCTGTCTTCTGACCTATGGTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCACTTCCTGTCAGCTGGTTGCTCGCTCTGTCTTCTGACCTATGGTT  648

seq1  GGACTTATTTAATCCTGCTTACGATATTCAAGTAGAAGGCTC-TTGGGTT  699
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  GGACTTATTTAATCCTGCTTACGATATTCAAGTAGAAGGCTCTTTGGGTT  698

seq1  AAAGGTATGTGTTAAAGCTGAGGCCCACCACAACTAAAAACAGGGTTTTC  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGTATGTGTTAAAGCTGAGGCCCACCACAACTAAAAACAGGGTTTTC  748

seq1  CAGTAAAT-AACACAAGCCCGGGGTTCACAGTGTGATGATCAAATATCCT  798
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  CAGTAAATAAACACAAGCCCGGGGTTCACAGTGTGATGATCAAATATCCT  798

seq1  GCAACACCTGGCTGGAGGTGCTCTCTAGGAGAGACTAGATCACAGGGATT  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAACACCTGGCTGGAGGTGCTCTCTAGGAGAGACTAGATCACAGGGATT  848

seq1  CTGACCCCATCAGTGAACAAGTCCATTG-ATGAGTGCGCACCTGACTGGG  897
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  CTGACCCCATCAGTGAACAAGTCCATTGAATGAGTGCGCACCTGACTGGG  898

seq1  ATGCTAGGGGCAGTA-TCAAGCTGG-AGGAAGTCACCGGGG-ACAAGCCT  944
      ||||||||||||||| ||||||||| ||||||||||||||| ||||||||
seq2  ATGCTAGGGGCAGTATTCAAGCTGGAAGGAAGTCACCGGGGTACAAGCCT  948

seq1  TTGAAGGG-CACACC-TTGTC-TGGGAA-CCCTT-CCTCTCACGCCGT--  987
      |||||||| |||||| ||||| |||||| ||||| |||||||||||||  
seq2  TTGAAGGGCCACACCTTTGTCTTGGGAATCCCTTCCCTCTCACGCCGTTG  998

seq1  GTCT-GCTTCCTTGC-ACCACAG-AGCA--TCTCTGCT-CTGCTGTCTG-  1030
       ||| |||||||||| || |||| ||||   ||||||| |||||||||| 
seq2  TTCTAGCTTCCTTGCAACAACAGAAGCAATCCTCTGCTCCTGCTGTCTGG  1048

seq1  -TTCCCACCATGTTTT--GCC-TCTCTG-TGGGC--GGTCTTCA-CCTC-  1071
       |||||||||||||||  ||| |||||| |||||  |||||||| |||| 
seq2  TTTCCCACCATGTTTTTGGCCTTCTCTGTTGGGCCGGGTCTTCACCCTCA  1098

seq1  ATAGGTCTTCA-GTCTC--TTTATTTAG-CATCAG-TAACATTTTCATTG  1116
      ||||||||||| ||| |  ||||||| | |||| | ||||||||||||||
seq2  ATAGGTCTTCAGGTCCCCTTTTATTTTGACATCTGTTAACATTTTCATTG  1148

seq1  TAG--AACCTTT--CACTT-CCTCCGGCT-GGTTTA  1146
      |||  |||||||  || || ||||||||| ||||||
seq2  TAGAAAACCTTTTCCATTTCCCTCCGGCTCGGTTTA  1184

seq1: chr2_163091578_163092297
seq2: B6Ng01-228K10.g_67_788 (reverse)

seq1  TGAGCCACCATGTAGTTGCTGGGATTTGAACT-CCGGACCTTCGG-AAGA  48
      |||||||||||||||||||||||||||||||| |||||||||||| ||||
seq2  TGAGCCACCATGTAGTTGCTGGGATTTGAACTCCCGGACCTTCGGAAAGA  50

seq1  GCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCCGGTTTTAC  98
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCCGGTTTTAC  100

seq1  CTTTCTTATCTTCTGTTTTTGTTTGGTTGTTTGTTTTGTTTCGAGACAGG  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCTTATCTTCTGTTTTTGTTTGGTTGTTTGTTTTGTTTCGAGACAGG  150

seq1  GTTTCCCTGTATAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGC  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCCCTGTATAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGC  200

seq1  TGGCCTCGAACTCAGAAATCTGCCTGCCTCTGCCTCCCTAGTGCTGGGAT  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCTCGAACTCAGAAATCTGCCTGCCTCTGCCTCCCTAGTGCTGGGAT  250

seq1  TAAAGGCGTGTGCCACCACTGCCCGGCGCCTTTCTTATCTTCTAAGAAAG  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGGCGTGTGCCACCACTGCCCGGCGCCTTTCTTATCTTCTAAGAAAG  300

seq1  TTATTTAAGTAAAAGGTATTAATTTCCCATTGTTCGCATCTCAGCTTTTG  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTTAAGTAAAAGGTATTAATTTCCCATTGTTCGCATCTCAGCTTTTG  350

seq1  CTAAGGTAATGTTTATATAGTCAGAAGAGGGTTGATCCCAGGGACTGATG  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAGGTAATGTTTATATAGTCAGAAGAGGGTTGATCCCAGGGACTGATG  400

seq1  GCTAGGGATGGTTGTGAAACCATGTGGGTGCTGAAAACCTAATCTGGGTC  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAGGGATGGTTGTGAAACCATGTGGGTGCTGAAAACCTAATCTGGGTC  450

seq1  TTCTACAAGATCAATAAGTGCTCTTAACCACTGACCTATCTTCCCTAGCC  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTACAAGATCAATAAGTGCTCTTAACCACTGACCTATCTTCCCTAGCC  500

seq1  ACTGAGCAATCTTCCCTAACCACTGAGCCATCTTCCCTAATCACTGAGCC  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAGCAATCTTCCCTAACCACTGAGCCATCTTCCCTAATCACTGAGCC  550

seq1  ATCGTCCCGTCTTCCTTATTCATTTGTTCCTGGTTGACTTGTCAGTTCCT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCGTCCCGTCTTCCTTATTCATTTGTTCCTGGTTGACTTGTCAGTTCCT  600

seq1  GATGAGATGTGTTCAAGTGTCTTCCTTTGTTTATGGTTTTAGCCTGTTTT  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGAGATGTGTTCAAGTGTCTTCCTTTGTTTATGGTTTTAGCCTGTTTT  650

seq1  TCTCCCCTGTCCTGATATTTGTTTATTTGTTTAAATGGGGGCTTATATAG  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCCTGTCCTGATATTTGTTTATTTGTTTAAATGGGGGCTTATATAG  700

seq1  CCTAGGCTAGCCCCTGGAATTC  720
      ||||||||||||||||||||||
seq2  CCTAGGCTAGCCCCTGGAATTC  722

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information