MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-229B23
Chromosome	2 (Build37)
Map Location	18,639,815 - 18,783,502
singlet/doublet	doublet
Overlap gene	BC061194, LOC667493, LOC100041479, Pip5k2a
Upstream gene	Nebl, LOC100041319, LOC100041047, 1700113O17Rik, A930004D18Rik, 2810030E01Rik, Mllt10, LOC641254, Dnajc1, LOC100041388, LOC623325, LOC625815, Commd3, Bmi1, EG667477, LOC100041448
Downstream gene	4930426L09Rik, LOC667521, Armc3, Msrb2, LOC100041196, Ptf1a, LOC100041534, 4921504E06Rik, LOC100041244, Otud1, LOC667564
Link	Open Mouse BAC browser

Click to get alignment info.

name	Nebl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74103 MGI:1921353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041319 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041047 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	1700113O17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68231 MGI:1915481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930004D18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77940 MGI:1925190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 37 ESTs

name	2810030E01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72668 MGI:1919918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mllt10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17354 MGI:1329038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC641254 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 10 Proteins pseudo : _no_value

name	Dnajc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13418 MGI:103268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041388 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC623325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC625815 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625815
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins pseudo : _no_value

name	Commd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12238 MGI:88218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12151 MGI:88174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667477 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667477 MGI:3647210
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100041448 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	BC061194 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381350 MGI:3040687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667493 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041479 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Pip5k2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18718 MGI:1298206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930426L09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74629 MGI:1921879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC667521 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Armc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70882 MGI:1918132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Msrb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76467 MGI:1923717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041196 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Ptf1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19213 MGI:1328312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041534 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	4921504E06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70909 MGI:1918087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041244 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs

name	Otud1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71198 MGI:1918448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 47 ESTs, 1 Protein

name	LOC667564 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667564
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Nebl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365246 GeneID:74103 MGI:1921353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nebulette transcript_id : NM_028757.2

name	LOC100041319 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248924 GeneID:100041319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041319 transcript_id : XM_001476440.1

name	1700113O17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386111 GeneID:68231 MGI:1915481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700113O17 gene transcript_id : NM_026627.1

name	2810030E01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55926232 GeneID:72668 MGI:1919918
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810030E01 gene transcript_id : NM_028317.1

name	Mllt10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130146 GeneID:17354 MGI:1329038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid/lymphoid or mixed lineage-leukemia translocation to 10 homolog (Drosophila) transcript_id : NM_010804.3

name	Dnajc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131142 GeneID:13418 MGI:103268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 1 transcript_id : NM_007869.2

name	LOC100041388 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248932 GeneID:100041388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to ORF1 transcript_id : XM_001476627.1

name	Commd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348241 GeneID:12238 MGI:88218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COMM domain containing 3 transcript_id : NM_147778.3

name	Bmi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893249 GeneID:12151 MGI:88174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bmi1 polycomb ring finger oncogene transcript_id : NM_007552.4

name	EG667477 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366030 GeneID:667477 MGI:3647210
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG667477 transcript_id : XM_990768.1

name	LOC100041448 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248935 GeneID:100041448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041448 transcript_id : XM_001476752.1

name	BC061194 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625691 GeneID:381350 MGI:3040687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC061194 transcript_id : NM_001001334.2

name	LOC100041479 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248937 GeneID:100041479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100041479 transcript_id : XM_001476769.1

name	Pip5k2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012549 GeneID:18718 MGI:1298206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol-4-phosphate 5-kinase, type II, alpha transcript_id : NM_008845.4

name	Armc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487326 GeneID:70882 MGI:1918132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing 3 transcript_id : NM_001081083.1

name	Msrb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27753987 GeneID:76467 MGI:1923717
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methionine sulfoxide reductase B2 transcript_id : NM_029619.2

name	LOC100041196 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248909 GeneID:100041196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041196 transcript_id : XM_001475947.1

name	Ptf1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055317 GeneID:19213 MGI:1328312
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pancreas specific transcription factor, 1a transcript_id : NM_018809.1

name	LOC100041534 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248941 GeneID:100041534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : hypothetical protein LOC100041534 transcript_id : XM_001476886.1

name	4921504E06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801285 GeneID:70909 MGI:1918087
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921504E06 gene transcript_id : NM_027600.3

name	LOC100041244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248913 GeneID:100041244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs product : similar to even skipped homeotic gene 2 homolog transcript_id : XM_001476036.1

name	Otud1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149248915 GeneID:71198 MGI:1918448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 47 ESTs, 1 Protein product : OTU domain containing 1 transcript_id : XM_991213.2

name	Nebl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311871 CCDS:CCDS15706.1 GeneID:74103 MGI:1921353
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : nebulette protein_id : NP_083033.1

name	LOC100041319 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248925 GeneID:100041319
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476490.1

name	1700113O17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386112 GeneID:68231 MGI:1915481
definition	GO_component : GO:0005694 - chromosome [Evidence IEA] codon_start : 1 product : histone variant H2al2 protein_id : NP_080903.1

name	2810030E01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55926233 GeneID:72668 MGI:1919918
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC72668 protein_id : NP_082593.1

name	Mllt10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47271507 CCDS:CCDS15708.1 GeneID:17354 MGI:1329038
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : myeloid/lymphoid or mixed lineage-leukemia translocation to 10 homolog protein_id : NP_034934.2

name	Dnajc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106295 CCDS:CCDS15709.1 GeneID:13418 MGI:103268
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005788 - endoplasmic reticulum lumen [Evidence TAS]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence TAS] [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] [Evidence IEA] GO_function : GO:0001671 - ATPase stimulator activity [Evidence ISS]; GO:0051087 - chaperone binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0030192 - Hsp70/Hsc70 protein regulator activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0043022 - ribosome binding [Evidence IPI] [Evidence TAS]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0045861 - negative regulation of proteolysis [Evidence ISS]; GO:0006457 - protein folding [Evidence IDA]; GO:0050708 - regulation of protein secretion [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IDA] codon_start : 1 note : DnaJ-like protein 1 product : DnaJ (Hsp40) homolog, subfamily C, member 1 protein_id : NP_031895.1

name	LOC100041388 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248933 GeneID:100041388
definition	codon_start : 1 product : similar to ORF1 protein_id : XP_001476677.1

name	Commd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22296603 CCDS:CCDS15710.1 GeneID:12238 MGI:88218
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0000155 - two-component sensor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 note : Bmi1 upstream product : COMM domain containing 3 protein_id : NP_680087.1

name	Bmi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559391 CCDS:CCDS15711.1 GeneID:12151 MGI:88174
definition	GO_component : GO:0016604 - nuclear body [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0031519 - PcG protein complex [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0050875 - cellular physiological process [Evidence TAS]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0016573 - histone acetylation [Evidence IGI]; GO:0016574 - histone ubiquitination [Evidence IDA]; GO:0006959 - humoral immune response [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0048103 - somatic stem cell division [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : polycomb group ring finger 4 product : B lymphoma Mo-MLV insertion region 1 protein_id : NP_031578.2

name	EG667477 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366031 GeneID:667477 MGI:3647210
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995862.1

name	LOC100041448 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248936 GeneID:100041448
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476802.1

name	BC061194 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625692 GeneID:381350 MGI:3040687
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : likely ortholog of H. sapiens sperm associated antigen 6 (SPAG6) product : hypothetical protein LOC381350 protein_id : NP_001001334.2

name	LOC100041479 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248938 GeneID:100041479
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476819.1

name	Pip5k2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490368 CCDS:CCDS15712.1 GeneID:18718 MGI:1298206
definition	GO_function : GO:0016308 - 1-phosphatidylinositol-4-phosphate 5-kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : phosphatidylinositol-4-phosphate 5-kinase, type II, alpha protein_id : NP_032871.3

name	Armc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487327 GeneID:70882 MGI:1918132
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : armadillo repeat containing 3 protein_id : NP_001074552.1

name	Msrb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313208 CCDS:CCDS15714.1 GeneID:76467 MGI:1923717
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0000318 - protein-methionine-R-oxide reductase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IDA] GO_process : GO:0030091 - protein repair [Evidence IDA] codon_start : 1 product : pilin-like transcription factor protein_id : NP_083895.1

name	LOC100041196 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248910 GeneID:100041196
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475997.1

name	Ptf1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055318 CCDS:CCDS15715.1 GeneID:19213 MGI:1328312
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence TAS] [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence TAS]; GO:0005515 - protein binding [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0045165 - cell fate commitment [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0009790 - embryonic development [Evidence ISS] [Evidence IMP]; GO:0031017 - exocrine pancreas development [Evidence ISS]; GO:0048699 - generation of neurons [Evidence ISS]; GO:0030902 - hindbrain development [Evidence ISS]; GO:0048663 - neuron fate commitment [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP] [Evidence ISS]; GO:0048384 - retinoic acid receptor signaling pathway [Evidence ISS]; GO:0009888 - tissue development [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : pancreas transcription factor1 p48 subunit product : pancreas specific transcription factor, 1a protein_id : NP_061279.1

name	LOC100041534 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248942 GeneID:100041534
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476936.1

name	4921504E06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328303 CCDS:CCDS15716.1 GeneID:70909 MGI:1918087
definition	codon_start : 1 product : hypothetical protein LOC70909 protein_id : NP_081876.2

name	LOC100041244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248914 GeneID:100041244
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476086.1

name	Otud1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149248916 GeneID:71198 MGI:1918448
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : OTU domain containing 1 protein_id : XP_996307.2 transl_except : (pos:19580167..19580169,aa:OTHER) transl_except : (pos:19580440..19580442,aa:OTHER) transl_except : (pos:19580476..19580478,aa:OTHER) transl_except : (pos:19580518..19580520,aa:OTHER) transl_except : (pos:19580623..19580625,aa:OTHER) transl_except : (pos:19580770..19580772,aa:OTHER) transl_except : (pos:19580776..19580778,aa:OTHER) transl_except : (pos:19580788..19580790,aa:OTHER) transl_except : (pos:19580830..19580832,aa:OTHER)

name	LOC100041047 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041047
definition	number : 1 pseudo : _no_value

name	LOC100041047 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041047
definition	number : 2 pseudo : _no_value

name	LOC623325 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623325
definition	number : 1 pseudo : _no_value

name	LOC667493 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667493
definition	number : 1 pseudo : _no_value

name	LOC667493 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667493
definition	number : 2 pseudo : _no_value

name	LOC667521 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667521
definition	number : 1 pseudo : _no_value

name	LOC667564 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667564
definition	number : 1 pseudo : _no_value

name	LOC667564 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667564
definition	number : 2 pseudo : _no_value

name	LOC667564 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667564
definition	number : 3 pseudo : _no_value

name	A930004D18Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149248929 GeneID:77940 MGI:1925190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 37 ESTs product : RIKEN cDNA A930004D18 gene transcript_id : XR_035303.1

name	LOC641254 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149248931 GeneID:641254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 10 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_032838.1

name	LOC625815 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149248934 GeneID:625815
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit f pseudo : _no_value transcript_id : XR_032861.1

name	4930426L09Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149248906 GeneID:74629 MGI:1921879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 4930426L09 gene transcript_id : XR_035673.1

clone name	MSMg01-054L13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-351N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536P09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051D19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-121K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-342N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182A09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-155A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259D05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-229B23.b	B6Ng01-229B23.g
ACC	GA042356	GA042357
length	1,065	1,124
definition	B6Ng01-229B23.b	B6Ng01-229B23.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(18,782,349 - 18,783,502)	(18,639,815 - 18,640,953)
sequence	gaattccttataaaggcagttaaaactgatagtcaccgaagagagtatgg ctgctggagaggtggggtggggtggctccaccatctgcgagtttgctgat aatccagaaatactcaattacaaccagttaacggagtgtgctgccagagt tgaactctgacccccccacacacaccctttttttgttttagttgttgatt tttcttcccgtgatcaattaatagtttggactcttcttagaaagcctagc atgggaggttcatgaataaaaccataaaccccttcagaagagtcactggt accagttattgaaacactctatttcttctgtttagcctctgagaggagag ctagtaactatggctgtcattgctgtgcgtcactgccctgcgcagaatgg tcgcctttatgtagaccctccttccccgagactttccactggcgtggtta agttagtgatctcacctttgctggagtcattatttaatttcctgtacttt taacttgttgatgacaagttttgaaaactgtcattttcaatgtttagtga tataggtgcagacaagtcccattcccttggatttcaccttgacgtgtaat tagtgtggtttcatttagcataataatggagatggaactggaggaggtag ggcctagattctaacaataatggaatttaacttttatggcaacaagaatc agaacatgtatgtacagatgtctagatttttcttatgggagtccttccaa aaaaaaaaaattgtcaatttctgacagctgctatgacttcttgattcctt aattctttgctttttagtgggaagggcattcttccattcatgactccagc agtttcgccccctctaattgagacagaattcgaatcttcctgggtggtcg atcttttcacagcttcagtccaattccagtgtgacatcaaattactaatt attgctgagcagactgcctttaacaaattgacagccttcgcaactgtcag cttgccaatctccacagcaaggagtcttgaggatgctaaagaaaatgtac tggacttcgctctgc	gaattcccactgtaatataatatttcactgtagaggtctcaggtctagaa gctccccaaagagatctactgaattctcagaagtaaagggaactgctgtc tagtcccacagaaatcacccgtcacaaccaaatctcagacagtggaatat ttgccctcaaataactggtctgtttctcagtgttttcctaaaagtggaac atactgagatcacttgggaacacccattcatcattctcttcttgacattt atgctaaggcaggagagggttttaaaatgttttagacctcaggtgaaatg ccaggggagttttaccttatttaagggcaataggaaggttggaagtctga ggtcggcttttttctgcccccccaccccccatggtttcttcttccttctt tccttgttagtctttcccactctgctaactggtcagtcacaaacaggtta gctaacgcaatcttcagggcctcatttgcttttggagaccaaagttcctg agcagaggcatgaaggattaggaagaaagggcagtaggactgtaggccct gggcaatggttcaagcaggcacagagatgcctcatgagcactccaggttg cagcctcagggcctcaggtgacctaacctaaccagacgtgcggactgagg caaaggccagaaatgacttgatattttgagggaaacctctctatagctag gctcaaaaataagttttaaatgttgaatgctttagttaaaaatcagctat ctatgtggtaagctttggttgacttagtctaacaaagatgaggacatttg atcagatattctacaactcatgcatgattctgggccagagtccagctgag aaagtgtgatggcactgctggtcacctgcagcttccgatgggactcatgg acaaccaatagcttctcagccccgcctctgtgtaagaagaggatgtctag gatactatcctcgtattgttcaagctcctcatgattattattctacttag actgttgtttcccagggcagttatttgctgctcatcaatgttcaatagtt agaagttcactgggattctgttgtgtacctagcattcagtaaatcatctg attttttttattaccaaagattta
quality values	Open. Hide. 58 36 13 28 58 58 58 58 46 52 52 53 58 49 58 49 52 42 58 62 54 62 62 62 62 54 62 62 47 62 62 56 62 47 32 54 62 32 37 62 56 62 56 62 62 62 51 44 62 54 54 62 62 62 62 62 62 47 47 62 59 59 62 62 62 62 62 62 62 62 49 62 62 62 59 59 62 62 62 30 62 43 44 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 44 59 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 54 51 54 54 62 62 51 62 62 62 62 62 62 62 62 62 54 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 54 62 62 56 62 47 62 62 62 62 62 62 62 62 54 62 52 62 47 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 47 62 54 47 62 62 52 62 47 47 62 62 62 42 54 62 62 43 62 62 62 62 54 54 52 54 62 47 39 58 58 54 50 58 58 46 58 52 58 58 58 58 54 58 47 58 52 52 54 54 58 54 58 38 40 58 41 58 58 58 58 58 58 54 50 58 58 58 58 54 54 54 58 58 58 58 58 54 54 45 41 52 36 42 21 54 54 54 58 58 58 58 54 58 54 58 54 52 54 52 52 52 58 58 58 58 54 52 54 58 58 54 58 52 58 54 47 58 47 35 47 54 58 58 54 42 54 54 47 50 58 42 35 45 47 51 51 58 45 38 58 58 51 50 58 51 42 58 47 45 31 51 58 41 33 58 58 53 51 47 26 28 34 47 58 37 35 47 51 54 51 46 50 58 32 58 46 25 46 29 41 22 7 50 40 49 32 51 41 53 47 38 46 52 44 42 51 36 44 31 42 35 49 48 58 32 40 42 51 54 48 27 43 41 10 39 40 52 50 54 51 23 58 39 39 20 42 39 39 49 39 32 22 42 26 45 50 31 37 32 54 15 13 12 9 58 21 14 46 32 13 58 58 46 40 37 51 50 21 28 32 27 5 43 31 49 39 53 39 40 18 44 30 39 18 36 52 41 24 39 45 29 20 52 25 39 42 31 35 26 29 39 31 37 18 9 53 51 49 50 21 13 31 30 39 34 20 18 49 30 34 42 16 9 17 54 19 12 54 52 53 50 49 54 52 51 54 52 25 15 24 27 26 37 52 21 8 52 22 39 33 35 37 30 32 31 47 23 22 33 21 32 27 35 20 17 40 24 33 29 9 6 28 33 37 46 40 35 40 25 28 18 47 34 28 53 53 53 21 13 54 44 46 6 18 16 10 12 31 8 15 24 27 51 29 19 16 24 7 9 11 31 28 24 18 21 31 32 18 21 29 32 16 24 7 33 9 9 15 23 23 39 53 32 22 14 16 27 21 17 14 12 12 18 30 15 9 17 11 11 9 30 25 32 24 27 6 9 22 15 6 17 10 17 11 13 10 12 22 8 7 45 19 17 30 22 6 20 19 34 12 12 34 48 48 30 13 16 14 12 11 13 31 12 29 17 12 12 21 14 12 10 25 24 21 29 20 22 25 30 10 20 17 16 5 18 21 16 31 23 19 26 13 22 34 31 15 31 15 16 8 11 6 11 21 19 28 6 12 10 14 30 15 35 31 14 25 19 21 36 6 12 10 13 29 13 9 11 11 28 13 20 18 38 33 42 16 24 9 8 11 8 17 10 13 5 24 7 7 12 6 8 12 7 14 7 10 6 19 21 21 22 6 12 9 8 7 5 6 29 14 16 9 11 12 14 6 22 9 6 5 16 10 9 11 10 21 34 26 5 20 31 25 21 31 10 4 4 9 20 18 14 8 6 14 6 7 9 27 16 14 7 6 6	Open. Hide. 58 29 46 41 58 58 58 41 30 45 42 18 12 19 24 31 42 52 45 62 62 62 54 62 62 47 54 49 62 49 47 62 62 62 62 49 62 62 62 62 62 51 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 46 46 62 62 62 47 54 62 54 62 54 62 62 49 62 62 62 62 62 62 54 62 62 62 62 49 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 47 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 52 54 62 62 62 62 62 36 54 58 58 58 58 58 58 58 58 58 58 58 52 54 49 58 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 31 58 58 58 58 58 58 54 58 58 58 54 54 58 58 58 54 58 52 58 46 54 41 54 47 41 52 52 41 52 52 58 58 58 58 35 58 54 50 58 34 58 51 50 58 54 58 58 41 58 29 22 51 53 49 58 58 58 46 58 49 45 50 58 49 50 58 49 54 51 37 58 18 27 49 58 51 53 51 58 42 58 58 51 58 54 58 52 52 46 47 54 46 49 53 53 40 39 58 51 37 46 58 52 39 50 52 53 58 49 47 47 49 58 53 53 53 53 51 58 49 33 51 41 49 53 52 41 31 35 58 58 58 50 52 35 30 46 51 50 52 30 22 51 35 28 41 31 50 35 14 58 38 49 38 32 52 40 47 39 49 39 37 51 42 52 53 27 35 46 31 32 45 53 49 50 54 35 30 40 49 39 29 51 37 31 54 39 14 39 21 49 32 28 54 54 34 37 52 37 24 33 32 40 37 40 34 31 54 54 49 28 45 37 54 34 42 54 33 17 53 53 40 44 47 33 24 34 31 31 53 41 33 45 45 32 33 32 28 51 47 51 32 34 19 33 28 46 53 53 32 31 49 32 35 53 39 36 31 39 41 37 45 35 43 53 45 39 24 53 40 33 53 47 52 26 25 31 7 7 13 30 31 36 31 28 29 30 32 38 45 31 26 29 30 28 32 43 51 43 31 42 30 35 31 30 17 33 37 31 25 20 30 34 28 32 30 27 46 30 33 34 24 31 46 13 25 22 20 12 9 47 34 33 32 34 26 18 18 31 22 25 23 36 36 32 31 30 20 27 31 31 30 23 33 38 34 29 32 33 19 18 37 31 30 31 46 38 22 31 26 18 31 10 30 28 30 23 16 27 36 32 43 11 35 48 12 6 9 31 21 24 21 24 36 30 19 16 27 34 32 25 36 38 30 19 32 14 9 33 32 35 31 25 19 31 26 25 14 26 12 31 24 32 38 20 7 9 30 17 11 26 37 24 32 32 14 36 22 22 18 21 29 34 21 32 36 32 18 5 14 24 19 33 31 27 30 7 14 8 32 21 17 11 10 17 20 21 17 15 17 14 8 37 10 19 15 9 28 24 32 32 20 17 11 21 11 14 21 8 7 29 32 22 31 32 17 6 6 11 21 29 14 20 21 18 18 17 31 28 16 21 22 16 10 13 24 20 8 4 4 19 16 27 13 26 19 11 18 26 16 13 14 5 12 6 15 16 9 5 4 10 40 24 10 22 17 6 7 40 14 10 13 12 19 10 18 5 34 12 3 6 26 13 10 15 11 6 16 23 9 4 3 4 7 9 5 4 3 6 6 13 4 5 25 8 23 23 5 7 11 19 9 8 6 12 16 17 20 13 7 3 3 9 4 11 13 5 4 5 7 8 14 9 24 8 24 5 13 14 20 13 4 4 22 25 11 5 9 4 1 3 5 17 14 17 17 17 17 17 28 17 10 6 10 21 4 5 5 6 17 17 4 3 2 20 5 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_18782349_18783502
seq2: B6Ng01-229B23.b_47_1111 (reverse)

seq1  GCAGAGCGATGTACAAAATGCATCTCTGTATAAATGCCTGGAACTCTCTC  50
                                                        
seq2  --------------------------------------------------  0

seq1  TCAAGAACACTGGCTTTTTAGAGAGTCAGGTCAAATCCCCCAGAGAGCGA  100
                                                 |||||||
seq2  -----------------------------------------GCAGAGCGA  9

seq1  GCGAGTCCAGTTACATTTTCTTTTGC-TCCTCCAGACTCCCTGCTGTGGA  149
         ||||||| |||||||||||| || ||||| ||||||| |||||||||
seq2  ---AGTCCAG-TACATTTTCTTTAGCATCCTCAAGACTCCTTGCTGTGGA  55

seq1  G-CTGGCCGGCTGGCAGTTTGCGAAGGCTGTC-ATTTGTAAAAGGCAGTC  197
      |  ||||  |||| ||| |||||||||||||| |||||| ||||||||||
seq2  GATTGGCAAGCTGACAG-TTGCGAAGGCTGTCAATTTGTTAAAGGCAGTC  104

seq1  TGCTCAGCTATAATTAGTAATTTGATGTCACACTGGAATTGGACTGAAGC  247
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCAGCAATAATTAGTAATTTGATGTCACACTGGAATTGGACTGAAGC  154

seq1  TGTGAAAAGATCGACCA-CCAGGGAGATTCGAATTTCTGTCTCATTTAGA  296
      ||||||||||||||||| ||||| ||||||||| |||||||||| |||||
seq2  TGTGAAAAGATCGACCACCCAGGAAGATTCGAA-TTCTGTCTCAATTAGA  203

seq1  GGGGGCGAAACTGCTGGAGTCATGAATGGAAG-ATGCCCTT-CCACTAAA  344
      |||||||||||||||||||||||||||||||| |||||||| ||||||||
seq2  GGGGGCGAAACTGCTGGAGTCATGAATGGAAGAATGCCCTTCCCACTAAA  253

seq1  AAGCAAAGAATTAAGGAATCAAAGAAGTCATAGCAGCTGTCAGAATTTGA  394
      |||||||||||||||||||| |||||||||||||||||||||||| ||||
seq2  AAGCAAAGAATTAAGGAATC-AAGAAGTCATAGCAGCTGTCAGAAATTGA  302

seq1  CAA-TTTTTTTTTTTGGAAGGACTCCCATAAGAAAAATCTAGACATCTGT  443
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATTTTTTTTTTTTGGAAGGACTCCCATAAGAAAAATCTAGACATCTGT  352

seq1  ACATACATGTTCTGATTCTTGTTGCCATAAAAGTT-AATTCCATTATTGT  492
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  ACATACATGTTCTGATTCTTGTTGCCATAAAAGTTAAATTCCATTATTGT  402

seq1  TAGAATCTAGGCCCTACCTCCTCCAGTTCCATCTCCATTATTATGCT-AA  541
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  TAGAATCTAGGCCCTACCTCCTCCAGTTCCATCTCCATTATTATGCTAAA  452

seq1  TGAAACCACACTAATTACACGTCAAGGTGAAATCCAAGGGAATGGGACTT  591
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAACCACACTAATTACACGTCAAGGTGAAATCCAAGGGAATGGGACTT  502

seq1  GTCTGCACCTATATCACTAAACATTGAAAATGACAGTTTTCAAAACTTGT  641
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGCACCTATATCACTAAACATTGAAAATGACAGTTTTCAAAACTTGT  552

seq1  CATCAACAAGTTAAAAGTACAGGAAATTAAATAATGACTCCAGCAAAGGT  691
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCAACAAGTTAAAAGTACAGGAAATTAAATAATGACTCCAGCAAAGGT  602

seq1  GAGATCACTAACTTAACCACGCCAGTGGAAAGTCTCGGGGAAGGAGGGTC  741
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGATCACTAACTTAACCACGCCAGTGGAAAGTCTCGGGGAAGGAGGGTC  652

seq1  TACATAAAGGCGACCATTCTGCGCAGGGCAGTGACGCACAGCAATGACAG  791
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATAAAGGCGACCATTCTGCGCAGGGCAGTGACGCACAGCAATGACAG  702

seq1  CCATAGTTACTAGCTCTCCTCTCAGAGGCTAAACAGAAGAAATAGAGTGT  841
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATAGTTACTAGCTCTCCTCTCAGAGGCTAAACAGAAGAAATAGAGTGT  752

seq1  TTCAATAACTGGTACCAGTGACTCTTCTGAAGGGGTTTATGGTTTTATTC  891
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAATAACTGGTACCAGTGACTCTTCTGAAGGGGTTTATGGTTTTATTC  802

seq1  ATGAACCTCCCATGCTAGGCTTTCTAAGAAGAGTCCAAACTATTAATTGA  941
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAACCTCCCATGCTAGGCTTTCTAAGAAGAGTCCAAACTATTAATTGA  852

seq1  TCACGGGAAGAAAAATCAACAACTAAAACAAAAAAAGGGTGTGTGTGGGG  991
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACGGGAAGAAAAATCAACAACTAAAACAAAAAAAGGGTGTGTGTGGGG  902

seq1  GGGTCAGAGTTCAACTCTGGCAGCACACTCCGTTAACTGGTTGTAATTGA  1041
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTCAGAGTTCAACTCTGGCAGCACACTCCGTTAACTGGTTGTAATTGA  952

seq1  GTATTTCTGGATTATCAGCAAACTCGCAGATGGTGGAGCCACCCCACCCC  1091
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATTTCTGGATTATCAGCAAACTCGCAGATGGTGGAGCCACCCCACCCC  1002

seq1  ACCTCTCCAGCAGCCATACTCTCTTCGGTGACTATCAGTTTTAACTGCCT  1141
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTCTCCAGCAGCCATACTCTCTTCGGTGACTATCAGTTTTAACTGCCT  1052

seq1  TTATAAGGAATTC  1154
      |||||||||||||
seq2  TTATAAGGAATTC  1065

seq1: chr2_18639815_18640953
seq2: B6Ng01-229B23.g_69_1192

seq1  GAATTCCCACTGTAATATAATATTTCACTGTAGAGGTCTCAGGTCTAGAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCACTGTAATATAATATTTCACTGTAGAGGTCTCAGGTCTAGAA  50

seq1  GCTCCCCAAAGAGATCTACTGAATTCTCAGAAGTAAAGGGAACTGCTGTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCCCCAAAGAGATCTACTGAATTCTCAGAAGTAAAGGGAACTGCTGTC  100

seq1  TAGTCCCACAGAAATCACCCGTCACAACCAAATCTCAGACAGTGGAATAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTCCCACAGAAATCACCCGTCACAACCAAATCTCAGACAGTGGAATAT  150

seq1  TTGCCCTCAAATAACTGGTCTGTTTCTCAGTGTTTTCCTAAAAGTGGAAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCCTCAAATAACTGGTCTGTTTCTCAGTGTTTTCCTAAAAGTGGAAC  200

seq1  ATACTGAGATCACTTGGGAACACCCATTCATCATTCTCTTCTTGACATTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACTGAGATCACTTGGGAACACCCATTCATCATTCTCTTCTTGACATTT  250

seq1  ATGCTAAGGCAGGAGAGGGTTTTAAAATGTTTTAGACCTCAGGTGAAATG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTAAGGCAGGAGAGGGTTTTAAAATGTTTTAGACCTCAGGTGAAATG  300

seq1  CCAGGGGAGTTTTACCTTATTTAAGGGCAATAGGAAGGTTGGAAGTCTGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGGGAGTTTTACCTTATTTAAGGGCAATAGGAAGGTTGGAAGTCTGA  350

seq1  GGTCGGCTTTTTTCTGCCCCCCCACCCCCCATGGTTTCTTCTTCCTTCTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCGGCTTTTTTCTGCCCCCCCACCCCCCATGGTTTCTTCTTCCTTCTT  400

seq1  TCCTTGTTAGTCTTTCCCACTCTGCTAACTGGTCAGTCACAAACAGGTTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTGTTAGTCTTTCCCACTCTGCTAACTGGTCAGTCACAAACAGGTTA  450

seq1  GCTAACGCAATCTTCAGGGCCTCATTTGCTTTTGGAGACCAAAGTTCCTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAACGCAATCTTCAGGGCCTCATTTGCTTTTGGAGACCAAAGTTCCTG  500

seq1  AGCAGAGGCATGAAGGATTAGGAAGAAAGGGCAGTAGGACTGTAGGCCCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGAGGCATGAAGGATTAGGAAGAAAGGGCAGTAGGACTGTAGGCCCT  550

seq1  GGGCAATGGTTCAAGCAGGCACAGAGATGCCTCATGAGCACTCCAGGTTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCAATGGTTCAAGCAGGCACAGAGATGCCTCATGAGCACTCCAGGTTG  600

seq1  CAGCCTCAGGGCCTCAGGTGACCTAACCTAACCAGACGTGCGGACTGAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCTCAGGGCCTCAGGTGACCTAACCTAACCAGACGTGCGGACTGAGG  650

seq1  CAAAGGCCAGAAATGACTTGATATTTTGAGGGAAACCTCTCTATAGCTAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGGCCAGAAATGACTTGATATTTTGAGGGAAACCTCTCTATAGCTAG  700

seq1  GCTCAAAAATAAGTTTTAAATGTTGAATGCTTTAGTTAAAAATCAGGCTA  750
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  GCTCAAAAATAAGTTTTAAATGTTGAATGCTTTAGTTAAAAATCA-GCTA  749

seq1  TCTATGTGGTAAGCTTTGGTTGACTTAGTCTAACAAAGATGAGGACATTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATGTGGTAAGCTTTGGTTGACTTAGTCTAACAAAGATGAGGACATTT  799

seq1  GATCAGATATTCTACAACTCATGCATGATTCTGGGCCAGAGTCCAGCTGA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCAGATATTCTACAACTCATGCATGATTCTGGGCCAGAGTCCAGCTGA  849

seq1  GAAAGGTGTGATGGCACTGCTGGTCACCTGCAGCTTCCGATGGGACTCAT  900
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAA-GTGTGATGGCACTGCTGGTCACCTGCAGCTTCCGATGGGACTCAT  898

seq1  GGACAACCAATAGCTTCTCAGCCCCGCCTCTGTGTAAGGAAGAGGATGTC  950
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  GGACAACCAATAGCTTCTCAGCCCCGCCTCTGTGTAA-GAAGAGGATGTC  947

seq1  TAGGATACTATCCTCGTATTGTTCAAGCTCCTCATGA-TATTATTCTACT  999
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  TAGGATACTATCCTCGTATTGTTCAAGCTCCTCATGATTATTATTCTACT  997

seq1  TAGAACTG-TGTTTCCCAGGGCAGTTATTTTGCTGCTCATCAGTGTTCAC  1048
      ||| |||| |||||||||||||||||| |||||||||||||| |||||| 
seq2  TAG-ACTGTTGTTTCCCAGGGCAGTTA-TTTGCTGCTCATCAATGTTCA-  1044

seq1  ATAGGTAAGAAGTTCACTGGGATTTTCCTGTTGTTGTTACTAAGCATTCA  1098
      ||| || |||||||||||||||||   |||||||   |||  ||||||||
seq2  ATA-GTTAGAAGTTCACTGGGATT---CTGTTGT--GTACCTAGCATTCA  1088

seq1  GTAAATACAATCTGATTTTTTTTTATTACAAAAAGAATTTA  1139
      ||||||   |||||| ||||||||||||| |||   |||||
seq2  GTAAAT--CATCTGA-TTTTTTTTATTACCAAA--GATTTA  1124

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information