MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-230K07
Chromosome	2 (Build37)
Map Location	126,332,139 - 126,457,169
singlet/doublet	doublet
Overlap gene	Slc27a2, Hdc, Gabpb1
Upstream gene	Fbn1, Cep152, Shc4, Eid1, 3110001I20Rik, Cops2, Galk2, Fgf7, Dtwd1, Atp8b4
Downstream gene	Usp8, LOC100043714, Usp50, Trpm7, 2010106G01Rik, Ap4e1, Blvra, Ncaph, 1700041B20Rik, 1810024B03Rik, LOC100043408, Ascc3l1, Ciao1, Tmem127, ENSMUSG00000074822, Stard7, Dusp2, Astl, Adra2b, A530057A03Rik, Fahd2a, Kcnip3, Prom2, Zfp661, Mrps5
Link	Open Mouse BAC browser

Click to get alignment info.

name	Fbn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14118 MGI:95489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cep152 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99100 MGI:2139083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271849 MGI:2655364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eid1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58521 MGI:1889651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110001I20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70354 MGI:1917604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cops2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12848 MGI:1330276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69976 MGI:1917226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14178 MGI:95521
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dtwd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69185 MGI:1916435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp8b4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241633 MGI:1859664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc27a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26458 MGI:1347099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15186 MGI:96062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabpb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14391 MGI:95611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Usp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84092 MGI:1934029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043714 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 119 ESTs, 4 Proteins

name	Usp50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75083 MGI:1922333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpm7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58800 MGI:1929996
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010106G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66552 MGI:1913802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap4e1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108011 MGI:1336993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Blvra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109778 MGI:88170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncaph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215387 MGI:2444777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700041B20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73338 MGI:1920588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 3 Proteins

name	1810024B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329509 MGI:1925560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 Proteins

name	LOC100043408 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043408
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ascc3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320632 MGI:2444401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ciao1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26371 MGI:1346998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69470 MGI:1916720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000074822 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545459 MGI:3642134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Stard7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99138 MGI:2139090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13537 MGI:101911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Astl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215095 MGI:3046414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adra2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11552 MGI:87935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A530057A03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215456 MGI:2684962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fahd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68126 MGI:1915376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56461 MGI:1929258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prom2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192212 MGI:2138997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72180 MGI:1919430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77721 MGI:1924971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118197276 GeneID:14118 MGI:95489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibrillin 1 transcript_id : NM_007993.2

name	Cep152 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487355 GeneID:99100 MGI:2139083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrosomal protein 152 transcript_id : NM_001081091.1

name	Shc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579887 GeneID:271849 MGI:2655364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SHC (Src homology 2 domain containing) family, member 4 transcript_id : NM_199022.2

name	Eid1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372222 GeneID:58521 MGI:1889651
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EP300 interacting inhibitor of differentiation 1 transcript_id : NM_025613.2

name	3110001I20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487340 GeneID:70354 MGI:1917604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110001I20 gene transcript_id : NM_177608.3

name	Cops2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909326 GeneID:12848 MGI:1330276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidopsis thaliana) transcript_id : NM_009939.2

name	Galk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341000 GeneID:69976 MGI:1917226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactokinase 2 transcript_id : NM_175154.2

name	Fgf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328444 GeneID:14178 MGI:95521
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 7 transcript_id : NM_008008.3

name	Dtwd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312231 GeneID:69185 MGI:1916435
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DTW domain containing 1 transcript_id : NM_026981.1

name	Atp8b4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803387 GeneID:241633 MGI:1859664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, class I, type 8B, member 4 transcript_id : NM_001080944.2

name	Slc27a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374153 GeneID:26458 MGI:1347099
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 27 (fatty acid transporter), member 2 transcript_id : NM_011978.2

name	Hdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385676 GeneID:15186 MGI:96062
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histidine decarboxylase transcript_id : NM_008230.5

name	Gabpb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575941 GeneID:14391 MGI:95611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GA repeat binding protein, beta 1 transcript_id : NM_207669.1

name	Gabpb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753933 GeneID:14391 MGI:95611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GA repeat binding protein, beta 1 transcript_id : NM_010249.1

name	Usp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981043 GeneID:84092 MGI:1934029
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 8 transcript_id : NM_019729.2

name	LOC100043714 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250110 GeneID:100043714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 119 ESTs, 4 Proteins product : similar to RNA polymerase II subunit transcript_id : XM_001480774.1

name	Usp50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802313 GeneID:75083 MGI:1922333
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 50 transcript_id : NM_029163.2

name	Trpm7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946829 GeneID:58800 MGI:1929996
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily M, member 7 transcript_id : NM_021450.1

name	2010106G01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963584 GeneID:66552 MGI:1913802
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010106G01 gene transcript_id : NM_023220.1

name	Ap4e1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487334 GeneID:108011 MGI:1336993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex AP-4, epsilon 1 transcript_id : NM_175550.3

name	Blvra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487330 GeneID:109778 MGI:88170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : biliverdin reductase A transcript_id : NM_026678.4

name	Ncaph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384708 GeneID:215387 MGI:2444777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : non-SMC condensin I complex, subunit H transcript_id : NM_144818.2

name	1700041B20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367223 GeneID:73338 MGI:1920588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 3 Proteins product : RIKEN cDNA 1700041B20 gene, transcript variant 1 transcript_id : XM_485065.3

name	Ascc3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130349 GeneID:320632 MGI:2444401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating signal cointegrator 1 complex subunit 3-like 1 transcript_id : NM_177214.4

name	Ciao1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372685 GeneID:26371 MGI:1346998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) transcript_id : NM_025296.3

name	Tmem127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360306 GeneID:69470 MGI:1916720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 127 transcript_id : NM_175145.3

name	ENSMUSG00000074822 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249998 GeneID:545459 MGI:3642134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, ENSMUSG00000074822 transcript_id : XM_001480101.1

name	Stard7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314859 GeneID:99138 MGI:2139090
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : START domain containing 7 transcript_id : NM_139308.1

name	Dusp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46560572 GeneID:13537 MGI:101911
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 2 transcript_id : NM_010090.2

name	Astl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130015 GeneID:215095 MGI:3046414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : astacin-like metalloendopeptidase (M12 family) transcript_id : NM_172539.2

name	Adra2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111548655 GeneID:11552 MGI:87935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor, alpha 2b transcript_id : NM_009633.3

name	A530057A03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487336 GeneID:215456 MGI:2684962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530057A03 gene transcript_id : NM_001081089.1

name	Fahd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29366813 GeneID:68126 MGI:1915376
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fumarylacetoacetate hydrolase domain containing 2A transcript_id : NM_029629.1

name	Kcnip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981036 GeneID:56461 MGI:1929258
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kv channel interacting protein 3, calsenilin transcript_id : NM_019789.2

name	Prom2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349738 GeneID:192212 MGI:2138997
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prominin 2 transcript_id : NM_178047.3

name	Prom2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270282 GeneID:192212 MGI:2138997
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prominin 2 transcript_id : NM_138750.1

name	Zfp661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328309 GeneID:72180 MGI:1919430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 661 transcript_id : NM_028141.2

name	Mrps5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21914844 GeneID:77721 MGI:1924971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S5 transcript_id : NM_029963.2

name	Cep152 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487356 GeneID:99100 MGI:2139083
definition	codon_start : 1 product : centrosomal protein 152 protein_id : NP_001074560.1

name	Shc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39841043 CCDS:CCDS16678.1 GeneID:271849 MGI:2655364
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : rai-like protein; novel phosphotyrosine interaction domain (PTB/PID) and SH2 domains containing protein product : rai-like protein RaLP protein_id : NP_950187.1

name	Eid1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385068 GeneID:58521 MGI:1889651
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016566 - specific transcriptional repressor activity [Evidence ISS] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy note : E1A-like inhibitor of differentiation product : CREBBP/EP300 inhibitory protein 1 protein_id : NP_079889.1

name	3110001I20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487341 GeneID:70354 MGI:1917604
definition	codon_start : 1 product : hypothetical protein LOC70354 protein_id : NP_808276.2

name	Cops2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909327 CCDS:CCDS16679.1 GeneID:12848 MGI:1330276
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA]; GO:0008180 - signalosome complex [Evidence IDA] [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence ISS]; GO:0003714 - transcription corepressor activity [Evidence IDA] GO_process : GO:0008283 - cell proliferation [Evidence IMP]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0007165 - signal transduction [Evidence ISS]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : alien homologue; COP9 (constitutive photomorphogenic, subunit 2 product : COP9 (constitutive photomorphogenic) homolog, subunit 2 protein_id : NP_034069.2

name	Galk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424748 CCDS:CCDS16680.1 GeneID:69976 MGI:1917226
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046835 - carbohydrate phosphorylation [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0016310 - phosphorylation [Evidence IEA] codon_start : 1 product : galactokinase 2 protein_id : NP_780363.1

name	Fgf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679785 CCDS:CCDS16681.1 GeneID:14178 MGI:95521
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Keratinocyte growth factor product : fibroblast growth factor 7 protein_id : NP_032034.1

name	Dtwd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312232 CCDS:CCDS16682.1 GeneID:69185 MGI:1916435
definition	codon_start : 1 product : DTW domain containing 1 protein_id : NP_081257.1

name	Atp8b4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301186 GeneID:241633 MGI:1859664
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0031177 - phosphopantetheine binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006812 - cation transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : ATPase 8B4, p type; ATPase B4, class I product : ATPase, class I, type 8B, member 4 protein_id : NP_001074413.1

name	Slc27a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374154 CCDS:CCDS16683.1 GeneID:26458 MGI:1347099
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence TAS] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence TAS] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0001676 - long-chain fatty acid metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : very long-chain acyl-Coenzyme A dehydrogenase synthase product : solute carrier family 27 (fatty acid transporter), member 2 protein_id : NP_036108.2

name	Hdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28173556 CCDS:CCDS16684.1 GeneID:15186 MGI:96062
definition	EC_number : 4.1.1.22 codon_start : 1 note : L-histidine decarboxylase product : histidine decarboxylase protein_id : NP_032256.3

name	Gabpb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575942 CCDS:CCDS16685.1 GeneID:14391 MGI:95611
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; GA binding protein subunit beta1 product : GA repeat binding protein, beta 1 isoform a protein_id : NP_997552.1

name	Gabpb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753934 CCDS:CCDS16686.1 GeneID:14391 MGI:95611
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; GA binding protein subunit beta1 product : GA repeat binding protein, beta 1 isoform b protein_id : NP_034379.1

name	LOC100043714 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250111 GeneID:100043714
definition	codon_start : 1 product : similar to RNA polymerase II subunit protein_id : XP_001480824.1

name	Usp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981044 CCDS:CCDS16687.1 GeneID:84092 MGI:1934029
definition	GO_component : GO:0005622 - intracellular [Evidence IDA] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004843 - ubiquitin-specific protease activity [Evidence IDA] GO_process : GO:0007265 - Ras protein signal transduction [Evidence IPI]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : putative deubiquitinating enzyme product : ubiquitin specific protease 8 protein_id : NP_062703.2

name	Usp50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312902 CCDS:CCDS16688.1 GeneID:75083 MGI:1922333
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin specific protease 50 protein_id : NP_083439.1

name	Trpm7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946830 CCDS:CCDS16689.1 GeneID:58800 MGI:1929996
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005262 - calcium channel activity [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017022 - myosin binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0031032 - actomyosin structure organization and biogenesis [Evidence IDA]; GO:0006816 - calcium ion transport [Evidence IDA]; GO:0016340 - calcium-dependent cell-matrix adhesion [Evidence IDA]; GO:0006811 - ion transport [Evidence IEA]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : protein kinase note : transient receptor potential-related protein, ChaK; transient receptor potential M7 product : transient receptor potential cation channel, subfamily M, member 7 protein_id : NP_067425.1

name	2010106G01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963585 CCDS:CCDS16690.1 GeneID:66552 MGI:1913802
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008717 - D-alanyl-D-alanine endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : signal peptide peptidase-like 2A protein_id : NP_075709.1

name	Ap4e1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487335 GeneID:108011 MGI:1336993
definition	GO_component : GO:0005905 - coated pit [Evidence IEA]; GO:0030126 - COPI vesicle coat [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 product : adaptor-related protein complex AP-4, epsilon 1 protein_id : NP_780759.2

name	Blvra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487331 CCDS:CCDS16692.1 GeneID:109778 MGI:88170
definition	GO_component : GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0004074 - biliverdin reductase activity [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0042167 - heme catabolism [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : biliverdin reductase A protein_id : NP_080954.4

name	Ncaph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450193 CCDS:CCDS16693.1 GeneID:215387 MGI:2444777
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0000278 - mitotic cell cycle [Evidence IEA]; GO:0007076 - mitotic chromosome condensation [Evidence IEA] codon_start : 1 product : barren homolog protein_id : NP_659067.1

name	1700041B20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94367224 GeneID:73338 MGI:1920588
definition	codon_start : 1 product : hypothetical protein LOC73338 isoform 1 protein_id : XP_485065.3

name	Ascc3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40018610 CCDS:CCDS16695.1 GeneID:320632 MGI:2444401
definition	GO_function : GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : U5 snRNP-specific protein, 200 kDa (DEXH RNA helicase family) product : U5 snRNP-specific protein, 200 kDa protein_id : NP_796188.2

name	Ciao1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542399 CCDS:CCDS16696.1 GeneID:26371 MGI:1346998
definition	GO_function : GO:0005515 - protein binding [Evidence TAS]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence TAS] codon_start : 1 note : WD repeat domain 39 product : WD40 protein Ciao1 protein_id : NP_079572.2

name	Tmem127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28201995 CCDS:CCDS16697.1 GeneID:69470 MGI:1916720
definition	codon_start : 1 product : hypothetical protein LOC69470 protein_id : NP_780354.1

name	ENSMUSG00000074822 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249999 GeneID:545459 MGI:3642134
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480151.1

name	Stard7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314860 CCDS:CCDS16698.1 GeneID:99138 MGI:2139090
definition	codon_start : 1 note : GTT1-like product : START domain containing 7 protein_id : NP_647469.1

name	Dusp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46560573 CCDS:CCDS16699.1 GeneID:13537 MGI:101911
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017017 - MAP kinase phosphatase activity [Evidence IEA]; GO:0051019 - mitogen-activated protein kinase binding [Evidence IPI]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IDA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 product : dual specificity phosphatase 2 protein_id : NP_034220.2

name	Astl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369754 CCDS:CCDS16700.1 GeneID:215095 MGI:3046414
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008533 - astacin activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 product : astacin-like metalloendopeptidase protein_id : NP_766127.1

name	Adra2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575786 CCDS:CCDS16701.1 GeneID:11552 MGI:87935
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004935 - adrenoceptor activity [Evidence IMP]; GO:0004938 - alpha2-adrenergic receptor activity [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0000165 - MAPKKK cascade [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : subtype alpha2-C2 product : adrenergic receptor, alpha 2b protein_id : NP_033763.2

name	A530057A03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487337 GeneID:215456 MGI:2684962
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glycerol-3-phosphate acyltransferase-like 1 product : hypothetical protein LOC215456 protein_id : NP_001074558.1

name	Fahd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29366814 CCDS:CCDS16702.1 GeneID:68126 MGI:1915376
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : fumarylacetoacetate hydrolase domain containing 2A protein_id : NP_083905.1

name	Kcnip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981037 CCDS:CCDS16703.1 GeneID:56461 MGI:1929258
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence TAS]; GO:0016566 - specific transcriptional repressor activity [Evidence IMP]; GO:0016564 - transcriptional repressor activity [Evidence TAS]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007610 - behavior [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0016481 - negative regulation of transcription [Evidence TAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IMP]; GO:0006813 - potassium ion transport [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048265 - response to pain [Evidence IMP]; GO:0019233 - sensory perception of pain [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium channel interacting protein 3; calsenilin, presenilin binding protein, EF hand transcription factor product : calsenilin, presenilin-binding protein, EF hand transcription factor protein_id : NP_062763.2

name	Prom2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270283 CCDS:CCDS16704.1 GeneID:192212 MGI:2138997
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; prominin-related protein product : prominin 2 isoform 1 protein_id : NP_620089.1

name	Prom2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017333 GeneID:192212 MGI:2138997
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; prominin-related protein product : prominin 2 isoform 2 protein_id : NP_835148.1

name	Zfp661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328310 CCDS:CCDS16705.1 GeneID:72180 MGI:1919430
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 2 (A1-5) protein_id : NP_082417.2

name	Mrps5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17157985 CCDS:CCDS16706.1 GeneID:77721 MGI:1924971
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S5 protein_id : NP_084239.1

name	LOC100043408 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043408
definition	number : 1 pseudo : _no_value

name	LOC100043408 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043408
definition	number : 2 pseudo : _no_value

name	LOC100043408 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043408
definition	number : 3 pseudo : _no_value

name	1810024B03Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149250112 GeneID:329509 MGI:1925560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 Proteins product : RIKEN cDNA 1810024B03 gene transcript_id : XR_035468.1

clone name	MSMg01-372A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318L13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128P24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-230K07.b	B6Ng01-230K07.g
ACC	GA043453	GA043454
length	344	1,021
definition	B6Ng01-230K07.b	B6Ng01-230K07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(126,332,139 - 126,332,482)	(126,456,159 - 126,457,169)
sequence	aaagtaatagaattgagactgtaaagtatttaggacacatgaagtcacag aaagtagactttagccaaaggtgctgccttcaaaacacgtgaacagtaag tactgtgctgaccacgcctgctagagctaagcaaaatttagcgtgctagg atgctagataggatggtatattctcatttatcaagattcactgaccatta ggcttcattcccataacaaaggagacaaaacagggtgggggcactgtgat gtaaagtgagtgaagaaagagagggagagagacaaaggaaggaaggaagg aaggaaggaaggaaggaaggaaggaaggaagggagagagagaga	gaattcatagttgtattctgtcccctacctcactagcacatcatgggtct ttgtgatgagattacgtcatccctgagcctgggcctgtggggatcatctt ttctctatacacttactagcggttgattttttctttttaataaaagagct tttgaaagcattcgttccttgttccttttaactgagcagaggcagaatga agagacgaagtcagcagactgtcttcattggacagcctccggatatatgg gttggttttttggtttttggtttttttcgagagccctggctgttctggaa ctcactctgtagaccaggctggcctcgaactcagaaatccacctgcctct gcctcccaagtgctgggattaaaggcgtgtgccaccaccacccagctata tgggttcttaataactgagaatttaaaacgttttatgcccgtttaacggt agaagcttgtttgagtagctgactttgcaagtctaggccagcacccttcg tggtggagttcaggtattgcgcctggtatgtagaggaatggggctcttgt tggaattagtgacatttgaatgctgtgagcccatcctcatggtgctcatc atctttgaggatcagttttcgcattcgtagcctggcatggagaggcaagt tgtggagtcacctttgctcagtcatatggtgggtggcggctgtgtgactg tcatctgagggaactcatttctgaggagagatgagggctgtgttttgaag cttgcgtttatgtctttctataacttccttcagtatataaagaagtaccg gtgtgcgttttgtgttttattaattcatattttctaatttagaacatttt ccttggaattaatgaacagtcctccatctcataatttcagacgagaactg gggggtttacgtgtgtcttggttggaaagattaagtgtcttagaagggcc ataggcagctgccgtactccttgcaaagccatggttctttttgatgggac ccatgattatgtgatgtattc
quality values	Open. Hide. 18 36 58 58 58 62 52 62 47 47 62 39 47 54 49 62 62 62 56 62 62 62 62 62 62 26 25 20 19 22 25 19 25 28 43 50 43 59 44 59 62 59 62 62 62 59 59 62 59 62 62 62 62 62 62 59 62 59 59 62 62 59 62 62 62 59 59 62 62 49 59 51 59 56 43 34 32 34 43 49 54 56 59 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 59 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 44 44 43 56 62 56 26 13 17	Open. Hide. 62 47 39 47 62 44 44 62 59 62 26 24 27 23 18 34 30 28 23 27 43 43 38 59 62 59 62 62 62 62 59 59 62 59 59 62 59 62 62 59 62 54 62 62 62 62 62 62 62 62 62 49 54 62 51 49 38 32 38 28 33 46 59 59 54 43 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 56 54 62 62 54 47 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 44 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 47 54 54 56 62 62 62 62 51 54 62 62 62 62 62 51 62 62 62 62 62 62 62 62 47 62 62 44 47 62 62 62 62 56 56 62 62 62 62 62 62 62 56 62 62 56 62 54 62 62 62 56 62 56 62 39 42 33 62 62 62 62 62 62 47 18 52 52 47 39 42 14 20 25 22 62 62 62 62 38 44 43 42 62 54 52 10 48 28 62 47 54 62 52 62 54 62 62 62 62 47 48 54 52 50 48 33 33 31 22 47 50 54 37 42 39 32 50 42 52 54 42 58 58 28 58 58 58 35 58 58 33 52 52 50 42 52 40 48 52 52 41 39 50 52 26 32 25 52 42 46 52 26 8 23 52 54 15 17 39 34 35 27 58 19 26 27 41 45 11 52 48 24 52 24 34 20 29 52 10 34 33 27 36 36 50 26 27 21 47 37 31 35 29 24 31 35 33 34 34 18 17 47 10 23 46 43 37 32 7 34 24 46 37 24 34 29 32 24 14 50 30 30 46 34 35 12 11 10 27 22 19 25 34 36 46 27 19 26 21 40 29 20 27 15 44 11 38 31 54 50 36 39 40 31 18 15 10 46 24 37 32 28 9 6 25 9 15 25 29 39 18 40 20 16 40 35 11 37 6 21 23 6 9 8 14 14 38 27 13 14 26 50 51 35 39 18 31 21 33 9 24 16 15 16 31 26 19 34 31 28 32 26 19 26 13 12 28 31 33 29 31 22 23 19 17 31 37 16 26 51 22 13 10 9 47 12 21 52 11 27 21 16 12 18 30 27 13 36 18 17 23 21 21 30 18 23 35 27 14 8 18 13 24 17 19 10 31 27 18 25 40 23 11 24 9 8 14 25 7 24 15 15 12 8 12 10 6 7 9 12 32 27 29 18 29 15 24 9 21 16 10 19 32 24 28 20 9 6 9 27 20 15 30 17 10 11 18 21 13 16 30 12 27 19 15 7 17 19 21 10 13 10 11 12 11 8 21 23 12 15 25 13 23 9 9 8 6 8 6 13 10 11 9 9 11 11 10 9 13 11 9 13 6 19 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_126332139_126332482
seq2: B6Ng01-230K07.b_51_394

seq1  AAAGTAATAGAATTGAGACTGTAAAGTATTTAGGACACATGAAGTCACAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTAATAGAATTGAGACTGTAAAGTATTTAGGACACATGAAGTCACAG  50

seq1  AAAGTAGACTTTAGCCAAAGGTGCTGCCTTCAAAACACGTGAACAGTAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTAGACTTTAGCCAAAGGTGCTGCCTTCAAAACACGTGAACAGTAAG  100

seq1  TACTGTGCTGACCACGCCTGCTAGAGCTAAGCAAAATTTAGCGTGCTAGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGTGCTGACCACGCCTGCTAGAGCTAAGCAAAATTTAGCGTGCTAGG  150

seq1  ATGCTAGATAGGATGGTATATTCTCATTTATCAAGATTCACTGACCATTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTAGATAGGATGGTATATTCTCATTTATCAAGATTCACTGACCATTA  200

seq1  GGCTTCATTCCCATAACAAAGGAGACAAAACAGGGTGGGGGCACTGTGAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTCATTCCCATAACAAAGGAGACAAAACAGGGTGGGGGCACTGTGAT  250

seq1  GTAAAGTGAGTGAAGAAAGAGAGGGAGAGAGACAAAGGAAGGAAGGAAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAAGTGAGTGAAGAAAGAGAGGGAGAGAGACAAAGGAAGGAAGGAAGG  300

seq1  AAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGGAGAGAGAGAGA  344
      ||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGGAGAGAGAGAGA  344

seq1: chr2_126456159_126457169
seq2: B6Ng01-230K07.g_67_1086 (reverse)

seq1  AATACATTCACATAATCATGTGT-CCATC-AAAAGAA-CATGGCTCTGCA  47
      |||||| ||||||||||||| || ||||| ||||||| ||||||| ||||
seq2  AATACA-TCACATAATCATGGGTCCCATCAAAAAGAACCATGGCTTTGCA  49

seq1  GTGAGTACGGCAGCTGCCTATGGCCCCTCTGAGACACTTTATCTTTCCAA  97
        |||||||||||||||||||||||| ||| |||||||| ||||||||||
seq2  AGGAGTACGGCAGCTGCCTATGGCCCTTCTAAGACACTTAATCTTTCCAA  99

seq1  CCAAGACACACGTAAA-CCCCCAGTTCTCGTCTG-AATTATGAGATGGA-  144
      |||||||||||||||| ||||||||||||||||| |||||||||||||| 
seq2  CCAAGACACACGTAAACCCCCCAGTTCTCGTCTGAAATTATGAGATGGAG  149

seq1  GACTGTTCATTAATTCCAAGGAAAATGTTTCTAATTTAG-AAATATGAA-  192
      ||||||||||||||||||||||||||| |||||| |||| ||||||||| 
seq2  GACTGTTCATTAATTCCAAGGAAAATG-TTCTAAATTAGAAAATATGAAT  198

seq1  TAATAAAACACAAAACGCACACCGGTACTTCTTTATATACTGAAGGAAGT  242
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATAAAACACAAAACGCACACCGGTACTTCTTTATATACTGAAGGAAGT  248

seq1  TATAG-AAGACATAAACGCAAGCTTC-AAACACAGCCCTCATCTCTCCTC  290
      ||||| |||||||||||||||||||| |||||||||||||||||||||||
seq2  TATAGAAAGACATAAACGCAAGCTTCAAAACACAGCCCTCATCTCTCCTC  298

seq1  AG-AATGAGTTCCCTCAGATGACAGTCACACAGCCGCCACCCACCATATG  339
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAATGAGTTCCCTCAGATGACAGTCACACAGCCGCCACCCACCATATG  348

seq1  ACTGAGCAAAGGTGACTCCACAACTTGCCTCTCCATGCCAGGCTACGAAT  389
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAGCAAAGGTGACTCCACAACTTGCCTCTCCATGCCAGGCTACGAAT  398

seq1  GCGAAAACTGATCCTCAAAGATGATGAGCACCATGAGGATGGGCTCACAG  439
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGAAAACTGATCCTCAAAGATGATGAGCACCATGAGGATGGGCTCACAG  448

seq1  CATTCAAATGTCACTAATTCCAACAAGAGCCCCATTCCTCTACATACCAG  489
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCAAATGTCACTAATTCCAACAAGAGCCCCATTCCTCTACATACCAG  498

seq1  GCGCAATACCTGAACTCCACCACGAAGGGTGCTGGCCTAGACTTGCAAAG  539
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGCAATACCTGAACTCCACCACGAAGGGTGCTGGCCTAGACTTGCAAAG  548

seq1  TCAGCTACTCAAACAAGCTTCTACCGTTAAACGGGCATAAAACGTTTTAA  589
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCTACTCAAACAAGCTTCTACCGTTAAACGGGCATAAAACGTTTTAA  598

seq1  ATTCTCAGTTATTAAGAACCCATATAGCTGGGTGGTGGTGGCACACGCCT  639
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTCAGTTATTAAGAACCCATATAGCTGGGTGGTGGTGGCACACGCCT  648

seq1  TTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGAGG  689
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGAGG  698

seq1  CCAGCCTGGTCTACAGAGTGAGTTCCAGAACAGCCAGGGCTCTCGAAAAA  739
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCCTGGTCTACAGAGTGAGTTCCAGAACAGCCAGGGCTCTCGAAAAA  748

seq1  AACCAAAAACCAAAAAACCAACCCATATATCCGGAGGCTGTCCAATGAAG  789
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCAAAAACCAAAAAACCAACCCATATATCCGGAGGCTGTCCAATGAAG  798

seq1  ACAGTCTGCTGACTTCGTCTCTTCATTCTGCCTCTGCTCAGTTAAAAGGA  839
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTCTGCTGACTTCGTCTCTTCATTCTGCCTCTGCTCAGTTAAAAGGA  848

seq1  ACAAGGAACGAATGCTTTCAAAAGCTCTTTTATTAAAAAGAAAAAATCAA  889
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGGAACGAATGCTTTCAAAAGCTCTTTTATTAAAAAGAAAAAATCAA  898

seq1  CCGCTAGTAAGTGTATAGAGAAAAGATGATCCCCACAGGCCCAGGCTCAG  939
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGCTAGTAAGTGTATAGAGAAAAGATGATCCCCACAGGCCCAGGCTCAG  948

seq1  GGATGACGTAATCTCATCACAAAGACCCATGATGTGCTAGTGAGGTAGGG  989
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGACGTAATCTCATCACAAAGACCCATGATGTGCTAGTGAGGTAGGG  998

seq1  GACAGAATACAACTATGAATTC  1011
      ||||||||||||||||||||||
seq2  GACAGAATACAACTATGAATTC  1020

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information