MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-233C21
Chromosome	2 (Build37)
Map Location	37,455,792 - 37,640,506
singlet/doublet	doublet
Overlap gene	Strbp, LOC639491
Upstream gene	Olfr345, Olfr346, Olfr347, Olfr348, Olfr50, Rpl18p, Olfr3, Olfr349-ps1, Olfr350, Olfr351, Olfr352, Olfr353, Olfr354, Olfr355, Olfr356, Olfr357, Olfr358, Olfr359-ps1, Olfr360, Olfr361, Olfr362, Olfr364-ps1, Olfr365, Olfr366, Olfr367, Olfr368, Pdcl, Rc3h2, Zbtb6, Zbtb26, Rabgap1, Gpr21, 6430510M02Rik
Downstream gene	Dennd1a, LOC100040947, Lhx2, Nek6, Psmb7, LOC674251, Nr5a1, Nr6a1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr345 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258947 MGI:3030179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr346 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258940 MGI:3030180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258945 MGI:3030181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr348 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258946 MGI:3030182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18350 MGI:1333746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl18p (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624088
definition	note : similar to 60S ribosomal protein L18 pseudo : _no_value

name	Olfr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18328 MGI:102697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr349-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257999 MGI:3030183
definition	gene_synonym : MOR136-17P note : olfactory receptor 349, pseudogene 1 pseudo : _no_value

name	Olfr350 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258620 MGI:3030184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr351 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258944 MGI:3030185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr352 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258942 MGI:3030186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr353 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258943 MGI:3030187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr354 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258941 MGI:3030188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr355 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258618 MGI:3030189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr356 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258617 MGI:3030190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr357 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258616 MGI:3030191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr358 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227789 MGI:3030192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr359-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258091 MGI:3030193
definition	gene_synonym : MOR159-2P note : olfactory receptor 359, pseudogene 1 pseudo : _no_value

name	Olfr360 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258615 MGI:3030194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr361 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258365 MGI:3030195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr362 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259053 MGI:3030196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr364-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227794 MGI:3030198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2100 Proteins pseudo : _no_value

name	Olfr365 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258656 MGI:3030199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr366 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236509 MGI:3030200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr367 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545417 MGI:3030201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr368 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258371 MGI:3030202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdcl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67466 MGI:1914716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rc3h2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319817 MGI:2442789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 133 ESTs, 7 Proteins

name	Zbtb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241322 MGI:2442998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320633 MGI:2444402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabgap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227800 MGI:2385139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gpr21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338346 MGI:2441890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430510M02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319517 MGI:2442183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Strbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20744 MGI:104626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC639491 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:639491
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Dennd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227801 MGI:2442794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Lhx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16870 MGI:96785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59126 MGI:1891638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19177 MGI:107637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC674251 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Nr5a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26423 MGI:1346833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr6a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14536 MGI:1352459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr345 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239289 GeneID:258947 MGI:3030179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 345 transcript_id : NM_146945.1

name	Olfr346 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129032 GeneID:258940 MGI:3030180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 346 transcript_id : NM_146938.1

name	Olfr347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129026 GeneID:258945 MGI:3030181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 347 transcript_id : NM_146943.1

name	Olfr348 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239291 GeneID:258946 MGI:3030182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 348 transcript_id : NM_146944.1

name	Olfr50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170059 GeneID:18350 MGI:1333746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 50 transcript_id : NM_146946.1

name	Olfr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170067 GeneID:18328 MGI:102697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 3 transcript_id : NM_206903.1

name	Olfr350 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239295 GeneID:258620 MGI:3030184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 350 transcript_id : NM_146627.1

name	Olfr351 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129024 GeneID:258944 MGI:3030185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 351 transcript_id : NM_146942.1

name	Olfr352 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129028 GeneID:258942 MGI:3030186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 352 transcript_id : NM_146940.1

name	Olfr353 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129030 GeneID:258943 MGI:3030187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 353 transcript_id : NM_146941.1

name	Olfr354 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129034 GeneID:258941 MGI:3030188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 354 transcript_id : NM_146939.1

name	Olfr355 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239287 GeneID:258618 MGI:3030189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 355 transcript_id : NM_146625.1

name	Olfr356 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239307 GeneID:258617 MGI:3030190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 356 transcript_id : NM_146624.1

name	Olfr357 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239281 GeneID:258616 MGI:3030191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 357 transcript_id : NM_146623.1

name	Olfr358 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402224 GeneID:227789 MGI:3030192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 358 transcript_id : NM_207235.1

name	Olfr360 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239255 GeneID:258615 MGI:3030194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 360 transcript_id : NM_146622.1

name	Olfr361 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129562 GeneID:258365 MGI:3030195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 361 transcript_id : NM_146368.1

name	Olfr362 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128848 GeneID:259053 MGI:3030196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 362 transcript_id : NM_147051.1

name	Olfr365 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239285 GeneID:258656 MGI:3030199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 365 transcript_id : NM_146662.1

name	Olfr366 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53933205 GeneID:236509 MGI:3030200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 366 transcript_id : NM_001005569.1

name	Olfr367 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486589 GeneID:545417 MGI:3030201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 367 transcript_id : NM_001081010.1

name	Olfr368 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129556 GeneID:258371 MGI:3030202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 368 transcript_id : NM_146374.1

name	Pdcl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475676 GeneID:67466 MGI:1914716
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosducin-like transcript_id : NM_026176.2

name	Rc3h2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249302 GeneID:319817 MGI:2442789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 132 ESTs, 7 Proteins product : ring finger and CCCH-type zinc finger domains 2, transcript variant 1 transcript_id : XM_130233.8

name	Zbtb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375919 GeneID:241322 MGI:2442998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 6 transcript_id : NM_146253.4

name	Zbtb26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037368 GeneID:320633 MGI:2444402
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 26 transcript_id : NM_199025.2

name	Rabgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76880488 GeneID:227800 MGI:2385139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB GTPase activating protein 1 transcript_id : NM_146121.2

name	Rabgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76880497 GeneID:227800 MGI:2385139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB GTPase activating protein 1 transcript_id : NM_001033960.1

name	Gpr21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387873 GeneID:338346 MGI:2441890
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 21 transcript_id : NM_177383.3

name	6430510M02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342413 GeneID:319517 MGI:2442183
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430510M02 gene transcript_id : NM_176932.2

name	Strbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842376 GeneID:20744 MGI:104626
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatid perinuclear RNA binding protein transcript_id : NM_009261.2

name	Dennd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542026 GeneID:227801 MGI:2442794
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DENN/MADD domain containing 1A transcript_id : NM_146122.2

name	LOC100040947 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249259 GeneID:100040947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040947 transcript_id : XM_001475545.1

name	Lhx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382898 GeneID:16870 MGI:96785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 2 transcript_id : NM_010710.3

name	Nek6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543319 GeneID:59126 MGI:1891638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 6 transcript_id : NM_021606.2

name	Psmb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755205 GeneID:19177 MGI:107637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 7 transcript_id : NM_011187.1

name	Nr5a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922643 GeneID:26423 MGI:1346833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 5, group A, member 1 transcript_id : NM_139051.3

name	Nr6a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380165 GeneID:14536 MGI:1352459
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 6, group A, member 1 transcript_id : NM_010264.3

name	Olfr345 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239290 CCDS:CCDS15977.1 GeneID:258947 MGI:3030179
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33334179-33335114; olfactory receptor MOR136-7 product : olfactory receptor 345 protein_id : NP_667156.1

name	Olfr346 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129033 CCDS:CCDS15978.1 GeneID:258940 MGI:3030180
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33382467-33383396; olfactory receptor MOR136-11 product : olfactory receptor 346 protein_id : NP_667149.1

name	Olfr347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129027 CCDS:CCDS15979.1 GeneID:258945 MGI:3030181
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33428755-33429693; olfactory receptor MOR136-9 product : olfactory receptor 347 protein_id : NP_667154.1

name	Olfr348 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239292 CCDS:CCDS15980.1 GeneID:258946 MGI:3030182
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33481050-33481991; olfactory receptor MOR136-8 product : olfactory receptor 348 protein_id : NP_667155.1

name	Olfr50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170060 CCDS:CCDS15981.1 GeneID:18350 MGI:1333746
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR136-6; GA_x6K02T2NLDC-33487752-33488690 product : olfactory receptor 50 protein_id : NP_667157.1

name	Olfr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170068 CCDS:CCDS15982.1 GeneID:18328 MGI:102697
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33507606-33506665; olfactory receptor MOR136-14 product : olfactory receptor 3 protein_id : NP_996786.1

name	Olfr350 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239296 CCDS:CCDS15983.1 GeneID:258620 MGI:3030184
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33544602-33545540; olfactory receptor MOR136-13 product : olfactory receptor 350 protein_id : NP_666838.1

name	Olfr351 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129025 CCDS:CCDS15984.1 GeneID:258944 MGI:3030185
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33554926-33553994; olfactory receptor MOR127-2 product : olfactory receptor 351 protein_id : NP_667153.1

name	Olfr352 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129029 CCDS:CCDS15985.1 GeneID:258942 MGI:3030186
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33564136-33565083; olfactory receptor MOR136-10 product : olfactory receptor 352 protein_id : NP_667151.1

name	Olfr353 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129031 CCDS:CCDS15986.1 GeneID:258943 MGI:3030187
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33585366-33584431; olfactory receptor MOR127-3 product : olfactory receptor 353 protein_id : NP_667152.1

name	Olfr354 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129035 CCDS:CCDS15987.1 GeneID:258941 MGI:3030188
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33601476-33602429; olfactory receptor MOR127-4 product : olfactory receptor 354 protein_id : NP_667150.1

name	Olfr355 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239288 CCDS:CCDS15988.1 GeneID:258618 MGI:3030189
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33622642-33621710; olfactory receptor MOR138-2 product : olfactory receptor 355 protein_id : NP_666836.1

name	Olfr356 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239308 CCDS:CCDS15989.1 GeneID:258617 MGI:3030190
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33631647-33632594; olfactory receptor MOR134-1 product : olfactory receptor 356 protein_id : NP_666835.1

name	Olfr357 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239282 CCDS:CCDS15990.1 GeneID:258616 MGI:3030191
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33688556-33689482; olfactory receptor MOR138-3 product : olfactory receptor 357 protein_id : NP_666834.1

name	Olfr358 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402225 CCDS:CCDS15991.1 GeneID:227789 MGI:3030192
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2NLDC-33697309-33696317 product : olfactory receptor 358 protein_id : NP_997118.1

name	Olfr360 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239256 CCDS:CCDS15992.1 GeneID:258615 MGI:3030194
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33760081-33761034; olfactory receptor MOR159-1 product : olfactory receptor 360 protein_id : NP_666833.1

name	Olfr361 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129563 CCDS:CCDS15993.1 GeneID:258365 MGI:3030195
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33777519-33776551; olfactory receptor MOR159-3 product : olfactory receptor 361 protein_id : NP_666480.1

name	Olfr362 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128849 CCDS:CCDS15994.1 GeneID:259053 MGI:3030196
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33797415-33796462; olfactory receptor MOR158-1 product : olfactory receptor 362 protein_id : NP_667262.1

name	Olfr365 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239286 CCDS:CCDS15995.1 GeneID:258656 MGI:3030199
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33885305-33886243; olfactory receptor MOR138-1 product : olfactory receptor 365 protein_id : NP_666873.1

name	Olfr366 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53933206 CCDS:CCDS15996.1 GeneID:236509 MGI:3030200
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33902472-33903401; olfactory receptor MOR138-5P product : olfactory receptor 366 protein_id : NP_001005569.1

name	Olfr367 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486590 GeneID:545417 MGI:3030201
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004984 - olfactory receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33954853-33955794; olfactory receptor MOR128-1 product : olfactory receptor 367 protein_id : NP_001074479.1

name	Olfr368 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129557 CCDS:CCDS15997.1 GeneID:258371 MGI:3030202
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-34015743-34016726; olfactory receptor MOR178-1 product : olfactory receptor 368 protein_id : NP_666486.1

name	Pdcl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18079230 CCDS:CCDS15998.1 GeneID:67466 MGI:1914716
definition	GO_process : GO:0050896 - response to stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosducin-like protein_id : NP_080452.1

name	Rc3h2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249303 GeneID:319817 MGI:2442789
definition	codon_start : 1 product : membrane-associated nucleic acid binding protein isoform 1 protein_id : XP_130233.7

name	Zbtb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122841 CCDS:CCDS16000.1 GeneID:241322 MGI:2442998
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 482 protein_id : NP_666365.1

name	Zbtb26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037369 CCDS:CCDS16001.1 GeneID:320633 MGI:2444402
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 483 protein_id : NP_950190.2

name	Rabgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76880489 CCDS:CCDS16002.1 GeneID:227800 MGI:2385139
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1; rab6 GTPase activating protein (GAP and centrosome-associated) product : RAB GTPase activating protein 1 isoform a protein_id : NP_666233.2

name	Rabgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76880498 CCDS:CCDS16003.1 GeneID:227800 MGI:2385139
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2; rab6 GTPase activating protein (GAP and centrosome-associated) product : RAB GTPase activating protein 1 isoform b protein_id : NP_001029132.1

name	Gpr21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893547 CCDS:CCDS16004.1 GeneID:338346 MGI:2441890
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor GPR21 product : G protein-coupled receptor 21 protein_id : NP_796357.1

name	6430510M02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892735 GeneID:319517 MGI:2442183
definition	codon_start : 1 product : hypothetical protein LOC319517 protein_id : NP_795906.1

name	Strbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842377 GeneID:20744 MGI:104626
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003725 - double-stranded RNA binding [Evidence IDA]; GO:0003727 - single-stranded RNA binding [Evidence IDA] GO_process : GO:0006928 - cell motility [Evidence IMP]; GO:0007638 - mechanosensory behavior [Evidence IMP]; GO:0007286 - spermatid development [Evidence IMP] codon_start : 1 product : spermatid perinuclear RNA-binding protein protein_id : NP_033287.2

name	Dennd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542027 CCDS:CCDS16007.1 GeneID:227801 MGI:2442794
definition	codon_start : 1 exception : mismatches in translation product : DENN/MADD domain containing 1A protein_id : NP_666234.2

name	LOC100040947 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249260 GeneID:100040947
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475595.1

name	Lhx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754538 CCDS:CCDS16008.1 GeneID:16870 MGI:96785
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0007498 - mesoderm development [Evidence IMP]; GO:0007399 - nervous system development [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : LIM homeo box protein 2 product : LIM homeobox protein 2 protein_id : NP_034840.1

name	Nek6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11037794 CCDS:CCDS16009.1 GeneID:59126 MGI:1891638
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007059 - chromosome segregation [Evidence ISS] [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0030071 - regulation of mitotic metaphase/anaphase transition [Evidence ISS] codon_start : 1 note : NIMA-related expressed kinase 6 product : NIMA (never in mitosis gene a)-related expressed kinase 6 protein_id : NP_067619.1

name	Psmb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755206 CCDS:CCDS16010.1 GeneID:19177 MGI:107637
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : proteasome (prosome, macropain) subunit, beta type 7 protein_id : NP_035317.1

name	Nr5a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20522231 CCDS:CCDS16011.1 GeneID:26423 MGI:1346833
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030325 - adrenal gland development [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IGI]; GO:0001553 - luteinization [Evidence IMP]; GO:0008584 - male gonad development [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0009888 - tissue development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : steroidogenic factor 1; adrenal 4-binding protein; fushi tarazu 1 factor homolog product : nuclear receptor subfamily 5, group A, member 1 protein_id : NP_620639.1

name	Nr6a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753956 CCDS:CCDS16012.1 GeneID:14536 MGI:1352459
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IMP] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : germ cell nuclear factor product : nuclear receptor subfamily 6, group A, member 1 protein_id : NP_034394.1

name	Olfr364-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:227794
definition	number : 1 pseudo : _no_value

name	Olfr364-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:227794
definition	number : 2 pseudo : _no_value

name	Olfr364-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:227794
definition	number : 3 pseudo : _no_value

name	LOC639491 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639491
definition	number : 1 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 1 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 2 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 3 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 4 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 5 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 6 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 7 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 8 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 9 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 10 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 11 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 12 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 13 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 14 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 15 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 16 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 17 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 18 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 19 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 20 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 21 pseudo : _no_value

clone name	MSMg01-436O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362H01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-453G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249F23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-233C21.b	B6Ng01-233C21.g
ACC	GA045316	GA045317
length	1,176	1,124
definition	B6Ng01-233C21.b	B6Ng01-233C21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(37,639,326 - 37,640,506)	(37,455,792 - 37,456,903)
sequence	gaattcccatgcctctggggaaacccagagtacatgttggccctcccctg gataggggtagagacagagggagatggagaatctccaggtgtggggattt atgaggcaggtcctgtcagtgtaggcgtccacagcctttcccctgccacc taagtaggttttgtcatgggggctcaggagccagctgaccccagctggag ccctccctacttccctgtccagccagccccaggactcctccttcccatga ccctcctgccccactcctatcctctgtgccagggagagccaggcccaggc ggcctggaatcccaactcccccaccctgctgggagcaggagggaaatgag tcacgcaaagctgcctgctcacatcacattcggaggactgctgcatagac agtgctcacttgcctgctgacagacacacagacaattcccacagaagcat acaccgattatgacacaagcaaggactcagagcacccttagagcaaccat atatatgcaaatggctgggacaagaagtctcacctgcacagatattcaga taccaagagggcaaagatgcagagaccggtgtcttaaccaactctcatcc cacggtgccatctcatccctccatgtccttcctgaacttgccccccagtc tgtatcatttgctcagagggaacttgaaactgcctcacggtttgagagca atgcctgaattcagggttggtggagatcccagtgtctatactgcagattc cagactgcactaaattaaacatcctttgaagatctgtccccagctgtccc ctccctcctgacatgaggcagctctagaaagcagatgtgaggagtaggaa gtgaccggggtgaggtgtcccctggaagagagagacatgtgtgtccatgc cggtcgtgcttctgagcatgtgtgtctacatcattcctcctctggggaac aaggatggcgagggactcattccccatcacaaacagggaaagattcccag tggctagatcagatgcccagagactgaggtccaaattacatcctgagcct tgccagggcccatcaggtgagccatacaggaatacaccggcagccttgac catgttctagacctgagatgcctagagattaccccttgggccatcctcga aagctaacaggcaagtgtgccctgca	gaattcagtaaaagaagatcaagatgaaaagctacatgaaaatgattgtc tttataaatatattcagaaataaatctaacacaattaaggtcgaacatcc aaatgtggcaatgctcctataatcccagcatttggaaggtggaagcagga gggttactagttcaatgtcaacctccaccacacagggaattggaggaggc cagcctgaaaaactagaagctcaatctcaaaaacaaaacaaaacaaaaca aaacaaaaaagtaatcagagagttccaactgtgactcagtggtgtagtgt ttgcctaatgtgcacaagatctagggtttgataccaagcaccatccaaag aaataaggcagaaaattagtaatatatgcctctatgtgaaagagcttatt ttttccacatctctaaggttttccatagcactcacactactttattctca agaagaaaaatttacaagtatacctctaaggtactggaggtctcagttgt agaatttccagtattattgcttgagtttgaagatactgtatcatttttgc tttcattatctgatttttcatcggaactgatacattcaatatctgcatca aaacctgttgggtatcccattgcctgtaaaacctgtacaaattccattaa aacatttttattgggttaccaaatatgaaaaaggatagctgaaattctga gataaaaagtttcagaatctgtaacagtttactaaaacccctatgaagaa caagaatggtgctacaaatgtaaaagcttggttttagtccagtccacact tcaaggtagcactacatgaaaatgggaacacatactcagagtacctagcc taagactttaagaaatacaagcctaaaggtactgctacttcatttaatct ggaggtgaatgaaagagaacgtacagctacagtcaagctcatccaacgaa aaatagcacctgaaaaaaaaaaaattaaactagaaagaaagacttgaaag cctattactattcacttcgcctttggttctcaattttttgcaactggaaa aagatgaagattagatcagccttgaatctcttaaatctattgaccacaac catggagaaatattaggccaagaa
quality values	Open. Hide. 54 36 15 22 58 47 58 33 22 58 58 58 58 58 58 58 58 58 58 58 36 58 52 42 62 42 41 62 49 62 54 42 46 39 21 32 41 50 56 31 43 62 62 62 62 62 62 62 62 49 62 26 51 62 62 49 62 62 62 62 62 62 62 47 51 62 62 54 47 62 62 47 59 59 43 62 62 59 44 37 37 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 47 62 49 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 54 62 62 46 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 54 41 62 47 42 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 45 52 54 54 58 52 58 58 54 58 58 54 54 58 58 58 58 58 58 58 43 58 58 58 54 58 58 52 58 52 58 54 58 54 54 58 58 54 58 58 52 54 58 54 54 54 58 54 58 58 58 54 58 53 58 42 41 58 54 54 52 58 46 54 54 47 58 58 58 58 58 49 58 52 54 52 54 54 58 52 58 54 58 58 58 54 58 58 51 54 58 49 54 58 58 49 58 58 41 41 46 50 50 58 50 58 58 46 58 53 58 53 50 38 58 58 54 58 49 52 50 43 45 52 52 53 54 53 41 50 54 46 52 51 46 40 58 50 58 40 58 58 50 58 58 58 52 58 50 51 51 51 40 58 32 49 31 48 54 58 37 53 53 53 51 41 48 46 52 46 50 58 49 58 53 51 51 50 51 58 58 58 50 49 40 54 31 54 53 58 31 53 53 53 58 42 53 53 58 58 51 50 58 24 41 49 43 40 50 40 44 39 39 44 51 49 26 39 41 54 52 32 58 58 58 58 50 52 39 39 42 52 51 35 40 42 50 37 26 54 49 52 37 53 42 40 28 53 24 54 51 37 42 37 39 53 52 32 54 32 38 39 42 30 44 47 42 39 42 38 53 39 54 42 42 45 33 51 28 41 23 41 40 52 37 54 39 41 36 35 32 51 41 24 21 54 51 32 37 42 44 26 46 39 47 29 29 32 28 54 53 40 34 31 45 32 40 31 33 45 32 45 40 52 31 32 26 45 31 38 34 40 21 13 45 19 32 36 31 26 28 31 25 52 33 33 34 33 52 37 33 25 40 37 40 45 53 53 33 31 32 19 31 21 31 45 40 31 35 53 51 31 31 31 37 33 31 31 30 46 46 30 31 31 51 36 31 33 33 31 28 27 18 13 33 31 33 18 45 23 30 24 31 42 36 38 29 32 33 48 31 31 32 31 20 32 21 20 24 6 4 6 17 42 23 32 26 30 30 22 31 31 34 31 31 31 33 26 46 46 34 21 31 42 19 28 16 31 31 38 46 46 28 31 31 32 28 33 12 39 11 37 19 31 13 29 22 28 32 31 23 27 30 32 29 29 28 24 35 38 25 32 21 32 29 32 24 23 31 31 32 31 21 20 18 42 21 34 28 33 37 14 30 20 15 19 31 24 21 32 21 36 27 33 26 22 26 26 15 12 10 25 10 29 9 43 36 9 38 22 23 9 28 25 24 22 17 32 32 11 6 21 24 43 24 15 10 20 22 21 21 20 18 31 31 17 18 26 22 15 17 14 36 24 17 10 14 33 10 37 39 10 5 15 8 13 32 39 33 22 6 9 16 18 7 17 16 8 13 4 3 3 3 4 16 20 13 32 14 16 6 8 26 9 10 28 9 11 8 29 15 20 26 20 47 8 14 15 11 20 16 27 8 9 9 16 26 7 15 9 15 9 13 11 14 12 15 29 15 3 11 6 8 7 12 15 13 6 4 9 17 5 14 22 9 16 13 9 8 21 7 3 4 10 16 16 7 7 6 7 20 10 23 16 20 8 25 10 6 6 5 3 5 20 16 16 6 3 3 4 5 19 7 8 16 8 21 13 3 1 6 9 5 13 18 5 12 4 6 8 5 14 5 21 11 6 4 1 7 25 9 3 4 16 7 7 4 5 3 1 3 26 17 5 3 2 12 8 9 3 2 3 15 10 6 16 4 5 7 5 9 13 5 7 6 6 3	Open. Hide. 58 31 40 39 58 42 31 62 62 62 34 35 27 19 24 19 19 15 33 35 27 40 50 47 47 62 54 62 62 62 62 54 54 62 62 56 62 62 49 62 62 62 54 62 49 47 62 62 62 62 62 62 49 62 62 56 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 47 62 62 62 62 62 49 54 54 58 58 58 58 58 58 58 43 58 58 58 58 54 58 58 58 54 58 54 58 58 54 58 58 58 54 54 58 58 58 58 58 52 58 58 58 58 52 58 54 52 58 44 45 58 58 54 58 46 58 58 58 54 58 52 58 58 58 58 45 49 58 45 58 52 54 54 58 58 58 54 41 58 52 58 58 58 58 54 58 58 58 49 54 48 58 48 58 58 58 58 41 41 58 58 51 51 42 52 51 58 58 58 58 54 58 58 51 58 54 50 50 58 58 50 51 34 53 58 58 58 49 58 58 49 51 47 58 58 58 58 58 54 51 58 58 53 39 58 49 53 58 58 58 58 41 58 58 58 58 50 54 46 53 58 53 36 58 58 52 51 58 54 39 39 52 50 58 51 52 31 58 51 53 51 54 53 58 53 50 53 42 53 38 58 51 50 54 40 58 52 41 58 58 58 23 41 40 58 58 51 39 52 47 58 40 51 52 54 38 34 54 54 49 52 54 49 54 41 37 45 31 54 32 41 51 54 39 34 41 53 52 54 54 42 49 37 37 54 54 54 52 52 52 31 53 54 52 32 36 32 38 45 33 54 51 41 42 37 33 47 54 54 54 41 40 54 37 30 47 40 42 53 42 51 51 45 40 53 52 45 40 34 18 31 30 39 54 54 54 45 35 29 45 27 21 18 8 54 17 21 43 34 42 34 32 33 33 30 25 32 49 31 32 40 36 41 53 40 32 32 53 53 44 26 29 29 29 49 40 15 46 32 29 18 46 40 25 21 25 49 52 23 45 29 42 22 31 22 51 31 31 45 27 29 46 51 38 26 31 30 31 24 28 22 51 51 8 9 16 33 31 11 11 26 36 39 31 27 30 31 31 43 21 32 22 26 20 36 27 39 32 31 25 29 31 23 43 18 31 32 32 48 46 31 30 32 48 42 29 27 31 24 30 23 30 23 31 31 31 28 16 31 14 30 30 35 32 34 36 26 33 32 31 31 25 15 21 12 7 39 21 20 21 16 41 41 30 29 17 21 18 28 22 32 18 18 22 41 31 17 44 16 22 31 27 43 34 11 11 32 30 32 28 27 19 47 41 32 9 18 36 32 34 21 29 10 20 12 18 33 27 26 31 23 48 33 23 31 19 33 20 21 31 35 21 32 26 14 19 7 13 14 25 17 25 32 18 28 31 32 32 32 22 33 19 21 11 19 31 26 31 44 44 44 20 18 16 14 17 6 11 26 10 22 22 43 43 43 43 33 33 36 27 36 30 12 7 19 17 29 14 25 14 9 7 9 43 24 7 6 36 12 6 13 9 21 32 16 23 36 21 10 6 28 15 31 7 11 14 23 10 13 12 6 6 5 10 8 7 23 13 27 23 10 11 15 7 21 9 7 8 16 4 9 15 18 47 28 34 32 20 27 24 11 15 19 17 20 18 5 40 28 31 19 16 16 11 14 14 8 5 27 11 8 3 6 13 28 28 13 19 11 20 20 7 10 9 16 11 15 8 8 9 6 27 47 26 16 17 6 8 12 4 7 3 4 10 5 17 7 6 9 9 8 23 9 6 21 4 5 30 5 2 3 4 8 5 11 16 5 6 11 15 10 9 22

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_37639326_37640506
seq2: B6Ng01-233C21.b_45_1220 (reverse)

seq1  TGCAGGGCACACCTGCCTGGTTTGGCTTTCTGGAGGAT-GCCCAGAGGGT  49
      |||||||||||| ||||||  || ||||||  |||||| |||||  ||||
seq2  TGCAGGGCACACTTGCCTG--TTAGCTTTC--GAGGATGGCCCAAGGGGT  46

seq1  TATCTCTA-GCATTCCTTCAGTCTAG-ACATGTGTCAA-GCTGCC-GTGT  95
       ||||||| ||||  ||   |||||| ||||| ||||| |||||| ||||
seq2  AATCTCTAGGCAT--CTCAGGTCTAGAACATG-GTCAAGGCTGCCGGTGT  93

seq1  ATTCCCTGTATGGCTCACCTGATGGGCCCTGGCAAGGCTCAGGATGTAAT  145
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATT-CCTGTATGGCTCACCTGATGGGCCCTGGCAAGGCTCAGGATGTAAT  142

seq1  TTGGACCTCAGTCCTCTGGGCATCCTGAATTCTAGCCCACTGGGATTCTT  195
      |||||||||||| |||||||||| ||||  ||||| ||||||||| ||||
seq2  TTGGACCTCAGT-CTCTGGGCAT-CTGA--TCTAG-CCACTGGGAATCTT  187

seq1  T-CCTGTTTGTGATGGGGAATGAGTCCCTCGCCATCCTTGTTCCCAAGA-  243
      | ||||||||||||||||||||||||||||||||||||||||||| ||| 
seq2  TCCCTGTTTGTGATGGGGAATGAGTCCCTCGCCATCCTTGTTCCCCAGAG  237

seq1  GAGGAATGATGTAGACACACATGCTCAGAAGCACGACCGGCATGGACACA  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAATGATGTAGACACACATGCTCAGAAGCACGACCGGCATGGACACA  287

seq1  CATGTCTCTCTCTTCCAGGGGACACCTCACCCCGGTCACTTCCTACTCCT  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTCTCTCTCTTCCAGGGGACACCTCACCCCGGTCACTTCCTACTCCT  337

seq1  -ACATCTGCTTTCTAGAGCTGCCTCATGTCAGGAGGGAGGGGACAGCTGG  392
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATCTGCTTTCTAGAGCTGCCTCATGTCAGGAGGGAGGGGACAGCTGG  387

seq1  GGACAGATCTTCAAAGGATGTTTAATTTAGTGCAGTCTGGAATCTGCAGT  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACAGATCTTCAAAGGATGTTTAATTTAGTGCAGTCTGGAATCTGCAGT  437

seq1  ATAGACACTGGGATCTCCACCAACCCTGAATTCAGGCATTGCTCTCAAAC  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGACACTGGGATCTCCACCAACCCTGAATTCAGGCATTGCTCTCAAAC  487

seq1  CGTGAGGCAGTTTCAAGTTCCCTCTGAGCAAATGATACAGACTGGGGGGC  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTGAGGCAGTTTCAAGTTCCCTCTGAGCAAATGATACAGACTGGGGGGC  537

seq1  AAGTTCAGGAAGGACATGGAGGGATGAGATGGCACCGTGGGATGAGAGTT  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTCAGGAAGGACATGGAGGGATGAGATGGCACCGTGGGATGAGAGTT  587

seq1  GGTTAAGACACCGGTCTCTGCATCTTTGCCCTCTTGGTATCTGAATATCT  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTAAGACACCGGTCTCTGCATCTTTGCCCTCTTGGTATCTGAATATCT  637

seq1  GTGCAGGTGAGACTTCTTGTCCCAGCCATTTGCATATATATGGTTGCTCT  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCAGGTGAGACTTCTTGTCCCAGCCATTTGCATATATATGGTTGCTCT  687

seq1  AAGGGTGCTCTGAGTCCTTGCTTGTGTCATAATCGGTGTATGCTTCTGTG  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGGTGCTCTGAGTCCTTGCTTGTGTCATAATCGGTGTATGCTTCTGTG  737

seq1  GGAATTGTCTGTGTGTCTGTCAGCAGGCAAGTGAGCACTGTCTATGCAGC  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATTGTCTGTGTGTCTGTCAGCAGGCAAGTGAGCACTGTCTATGCAGC  787

seq1  AGTCCTCCGAATGTGATGTGAGCAGGCAGCTTTGCGTGACTCATTTCCCT  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCTCCGAATGTGATGTGAGCAGGCAGCTTTGCGTGACTCATTTCCCT  837

seq1  CCTGCTCCCAGCAGGGTGGGGGAGTTGGGATTCCAGGCCGCCTGGGCCTG  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCTCCCAGCAGGGTGGGGGAGTTGGGATTCCAGGCCGCCTGGGCCTG  887

seq1  GCTCTCCCTGGCACAGAGGATAGGAGTGGGGCAGGAGGGTCATGGGAAGG  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTCCCTGGCACAGAGGATAGGAGTGGGGCAGGAGGGTCATGGGAAGG  937

seq1  AGGAGTCCTGGGGCTGGCTGGACAGGGAAGTAGGGAGGGCTCCAGCTGGG  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGTCCTGGGGCTGGCTGGACAGGGAAGTAGGGAGGGCTCCAGCTGGG  987

seq1  GTCAGCTGGCTCCTGAGCCCCCATGACAAAACCTACTTAGGTGGCAGGGG  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGCTGGCTCCTGAGCCCCCATGACAAAACCTACTTAGGTGGCAGGGG  1037

seq1  AAAGGCTGTGGACGCCTACACTGACAGGACCTGCCTCATAAATCCCCACA  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGCTGTGGACGCCTACACTGACAGGACCTGCCTCATAAATCCCCACA  1087

seq1  CCTGGAGATTCTCCATCTCCCTCTGTCTCTACCCCTATCCAGGGGAGGGC  1142
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGAGATTCTCCATCTCCCTCTGTCTCTACCCCTATCCAGGGGAGGGC  1137

seq1  CAACATGTACTCTGGGTTTCCCCAGAGGCATGGGAATTC  1181
      |||||||||||||||||||||||||||||||||||||||
seq2  CAACATGTACTCTGGGTTTCCCCAGAGGCATGGGAATTC  1176

seq1: chr2_37455792_37456903
seq2: B6Ng01-233C21.g_66_1189

seq1  GAATTCAGTAAAAGAAGATCAAGATGAAAAGCTACATGAAAATGATTGTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTAAAAGAAGATCAAGATGAAAAGCTACATGAAAATGATTGTC  50

seq1  TTTATAAATATATTCAGAAATAAATCTAACACAATTAAGGTCGAACATCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATAAATATATTCAGAAATAAATCTAACACAATTAAGGTCGAACATCC  100

seq1  AAATGTGGCAATGCTCCTATAATCCCAGCATTTGGAAGGTGGAAGCAGGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTGGCAATGCTCCTATAATCCCAGCATTTGGAAGGTGGAAGCAGGA  150

seq1  GGGTTACTAGTTCAATGTCAACCTCCACCACACAGGGAATTGGAGGAGGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTTACTAGTTCAATGTCAACCTCCACCACACAGGGAATTGGAGGAGGC  200

seq1  CAGCCTGAAAAACTAGAAGCTCAATCTCAAAAACAAAACAAAACAAAACA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCTGAAAAACTAGAAGCTCAATCTCAAAAACAAAACAAAACAAAACA  250

seq1  AAACAAAAAAGTAATCAGAGAGTTCCAACTGTGACTCAGTGGTGTAGTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAAAAAAGTAATCAGAGAGTTCCAACTGTGACTCAGTGGTGTAGTGT  300

seq1  TTGCCTAATGTGCACAAGATCTAGGGTTTGATACCAAGCACCATCCAAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCTAATGTGCACAAGATCTAGGGTTTGATACCAAGCACCATCCAAAG  350

seq1  AAATAAGGCAGAAAATTAGTAATATATGCCTCTATGTGAAAGAGCTTATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAGGCAGAAAATTAGTAATATATGCCTCTATGTGAAAGAGCTTATT  400

seq1  TTTTCCACATCTCTAAGGTTTTCCATAGCACTCACACTACTTTATTCTCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCCACATCTCTAAGGTTTTCCATAGCACTCACACTACTTTATTCTCA  450

seq1  AGAAGAAAAATTTACAAGTATACCTCTAAGGTACTGGAGGTCTCAGTTGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGAAAAATTTACAAGTATACCTCTAAGGTACTGGAGGTCTCAGTTGT  500

seq1  AGAATTTCCAGTATTATTGCTTGAGTTTGAAGATACTGTATCATTTTTGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATTTCCAGTATTATTGCTTGAGTTTGAAGATACTGTATCATTTTTGC  550

seq1  TTTCATTATCTGATTTTTCATCGGAACTGATACATTCAATATCTGCATCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCATTATCTGATTTTTCATCGGAACTGATACATTCAATATCTGCATCA  600

seq1  AAACCTGTTGGGTATCCCATTGCCTGTAAAACCTGTACAAATTCCATTAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCTGTTGGGTATCCCATTGCCTGTAAAACCTGTACAAATTCCATTAA  650

seq1  AACATTTTTATTGGGTTACCAAATATGAAAAAGGATAGCTGAAATTCTGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATTTTTATTGGGTTACCAAATATGAAAAAGGATAGCTGAAATTCTGA  700

seq1  GATAAAAAGTTTCAGAATCTGTAACAGTTTACTAAAACCCCTATGAAGAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAAAAAGTTTCAGAATCTGTAACAGTTTACTAAAACCCCTATGAAGAA  750

seq1  CAAGAATGGTGCTACAAATGTAAAAGCTTGG-TTTAGTCCAGTCCACACT  799
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  CAAGAATGGTGCTACAAATGTAAAAGCTTGGTTTTAGTCCAGTCCACACT  800

seq1  TCAAGGTAGCACTACATGAAAATGGGAACACATACTCAGAGTACCTAGCC  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGGTAGCACTACATGAAAATGGGAACACATACTCAGAGTACCTAGCC  850

seq1  TAAAGAC-TTAAGAAATACAAGCCTAAAGGTACTGCTACTTCATTTAATC  898
      | ||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  T-AAGACTTTAAGAAATACAAGCCTAAAGGTACTGCTACTTCATTTAATC  899

seq1  TGGAGGTGAATGAAAGAGAACGTACAGC-ACAGTCAAGCTCATCCAACGA  947
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  TGGAGGTGAATGAAAGAGAACGTACAGCTACAGTCAAGCTCATCCAACGA  949

seq1  AAAATAGCACCTGAAAAAAAAAAAATTAAACTAGAAAG-AAGACTTGAAA  996
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  AAAATAGCACCTGAAAAAAAAAAAATTAAACTAGAAAGAAAGACTTGAAA  999

seq1  GCCTAATACTA-TCAC-TCGCCTTTGGTCTTCAA-TTTTTGCAACTGG-A  1042
      ||||| ||||| |||| |||||||||||  |||| ||||||||||||| |
seq2  GCCTATTACTATTCACTTCGCCTTTGGTTCTCAATTTTTTGCAACTGGAA  1049

seq1  AAAGATGAAGATTAGATCAGC--TG-ATCTCTAAAATCTA-TGA-CACAA  1087
      |||||||||||||||||||||  || |||||| ||||||| ||| |||||
seq2  AAAGATGAAGATTAGATCAGCCTTGAATCTCTTAAATCTATTGACCACAA  1099

seq1  CCATGAAGAAAAATTAGGCAAAGAA  1112
      ||||| ||||| ||||||| |||||
seq2  CCATGGAGAAATATTAGGCCAAGAA  1124

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information