MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-241F10
Chromosome	2 (Build37)
Map Location	127,953,006 - 128,082,853
singlet/doublet	doublet
Overlap gene	Bcl2l11, LOC100043424
Upstream gene	Ncaph, 1700041B20Rik, 1810024B03Rik, LOC100043408, Ascc3l1, Ciao1, Tmem127, ENSMUSG00000074822, Stard7, Dusp2, Astl, Adra2b, A530057A03Rik, Fahd2a, Kcnip3, Prom2, Zfp661, Mrps5, Mal, LOC668892, Mall, Nphp1, 1500011K16Rik, Bub1, Acoxl
Downstream gene	LOC100043729, LOC383791, LOC100043730, Gm355, Anapc1, Mertk, Tmem87b, 1600015H20Rik, Zc3h8, LOC100043735, LOC100043736, Zc3h6, LOC668894, Ttl, LOC100043738, Rpo1-2, Chchd5, LOC545461, LOC100043431, Slc20a1, A730036I17Rik, LOC671466
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ncaph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215387 MGI:2444777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700041B20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73338 MGI:1920588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 3 Proteins

name	1810024B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329509 MGI:1925560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 Proteins

name	LOC100043408 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043408
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ascc3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320632 MGI:2444401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ciao1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26371 MGI:1346998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69470 MGI:1916720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000074822 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545459 MGI:3642134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Stard7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99138 MGI:2139090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13537 MGI:101911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Astl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215095 MGI:3046414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adra2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11552 MGI:87935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A530057A03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215456 MGI:2684962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fahd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68126 MGI:1915376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56461 MGI:1929258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prom2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192212 MGI:2138997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72180 MGI:1919430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77721 MGI:1924971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mal (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17153 MGI:892970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668892 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	Mall (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228576 MGI:2385152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nphp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53885 MGI:1858233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500011K16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67885 MGI:1915135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Bub1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12235 MGI:1100510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acoxl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74121 MGI:1921371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl2l11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12125 MGI:1197519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC100043424 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100043729 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC383791 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100043730 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043730
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	Gm355 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241634 MGI:2685201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Anapc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17222 MGI:103097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mertk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17289 MGI:96965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem87b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72477 MGI:1919727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1600015H20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70370 MGI:1917620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3h8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57432 MGI:1930128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043735 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043736 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043736
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs

name	Zc3h6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78751 MGI:1926001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ttl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69737 MGI:1916987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043738 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043738
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Rpo1-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20017 MGI:108014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chchd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66170 MGI:1913420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545461 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 184 ESTs pseudo : _no_value

name	LOC100043431 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Slc20a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20515 MGI:108392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A730036I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329513 MGI:3041182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671466 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Ncaph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384708 GeneID:215387 MGI:2444777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : non-SMC condensin I complex, subunit H transcript_id : NM_144818.2

name	1700041B20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367223 GeneID:73338 MGI:1920588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 3 Proteins product : RIKEN cDNA 1700041B20 gene, transcript variant 1 transcript_id : XM_485065.3

name	Ascc3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130349 GeneID:320632 MGI:2444401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating signal cointegrator 1 complex subunit 3-like 1 transcript_id : NM_177214.4

name	Ciao1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372685 GeneID:26371 MGI:1346998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) transcript_id : NM_025296.3

name	Tmem127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360306 GeneID:69470 MGI:1916720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 127 transcript_id : NM_175145.3

name	ENSMUSG00000074822 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249998 GeneID:545459 MGI:3642134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, ENSMUSG00000074822 transcript_id : XM_001480101.1

name	Stard7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314859 GeneID:99138 MGI:2139090
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : START domain containing 7 transcript_id : NM_139308.1

name	Dusp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46560572 GeneID:13537 MGI:101911
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 2 transcript_id : NM_010090.2

name	Astl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130015 GeneID:215095 MGI:3046414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : astacin-like metalloendopeptidase (M12 family) transcript_id : NM_172539.2

name	Adra2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111548655 GeneID:11552 MGI:87935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor, alpha 2b transcript_id : NM_009633.3

name	A530057A03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487336 GeneID:215456 MGI:2684962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530057A03 gene transcript_id : NM_001081089.1

name	Fahd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29366813 GeneID:68126 MGI:1915376
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fumarylacetoacetate hydrolase domain containing 2A transcript_id : NM_029629.1

name	Kcnip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981036 GeneID:56461 MGI:1929258
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kv channel interacting protein 3, calsenilin transcript_id : NM_019789.2

name	Prom2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349738 GeneID:192212 MGI:2138997
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prominin 2 transcript_id : NM_178047.3

name	Prom2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270282 GeneID:192212 MGI:2138997
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prominin 2 transcript_id : NM_138750.1

name	Zfp661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328309 GeneID:72180 MGI:1919430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 661 transcript_id : NM_028141.2

name	Mrps5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21914844 GeneID:77721 MGI:1924971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S5 transcript_id : NM_029963.2

name	Mal (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801061 GeneID:17153 MGI:892970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin and lymphocyte protein, T-cell differentiation protein transcript_id : NM_010762.4

name	Mall (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802823 GeneID:228576 MGI:2385152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mal, T-cell differentiation protein-like transcript_id : NM_145532.3

name	Nphp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802425 GeneID:53885 MGI:1858233
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nephronophthisis 1 (juvenile) homolog (human) transcript_id : NM_016902.2

name	Bub1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30840981 GeneID:12235 MGI:1100510
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : budding uninhibited by benzimidazoles 1 homolog (S. cerevisiae) transcript_id : NM_009772.1

name	Acoxl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380979 GeneID:74121 MGI:1921371
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A oxidase-like transcript_id : NM_028765.2

name	Bcl2l11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90093352 GeneID:12125 MGI:1197519
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2-like 11 (apoptosis facilitator) transcript_id : NM_207680.2

name	Bcl2l11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90093353 GeneID:12125 MGI:1197519
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2-like 11 (apoptosis facilitator) transcript_id : NM_207681.2

name	Bcl2l11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90093356 GeneID:12125 MGI:1197519
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2-like 11 (apoptosis facilitator) transcript_id : NM_009754.3

name	LOC100043424 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250003 GeneID:100043424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043424 transcript_id : XM_001480133.1

name	LOC100043729 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250118 GeneID:100043729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100043729 transcript_id : XM_001480842.1

name	Gm355 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367229 GeneID:241634 MGI:2685201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : gene model 355, (NCBI) transcript_id : XM_141353.7

name	Anapc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678833 GeneID:17222 MGI:103097
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anaphase promoting complex subunit 1 transcript_id : NM_008569.1

name	Mertk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106354 GeneID:17289 MGI:96965
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : c-mer proto-oncogene tyrosine kinase transcript_id : NM_008587.1

name	Tmem87b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487302 GeneID:72477 MGI:1919727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 87B transcript_id : NM_028248.2

name	1600015H20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387777 GeneID:70370 MGI:1917620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600015H20 gene transcript_id : NM_024237.3

name	Zc3h8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719325 GeneID:57432 MGI:1930128
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 8 transcript_id : NM_020594.2

name	LOC100043736 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250121 GeneID:100043736
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs product : hypothetical protein LOC100043736 transcript_id : XM_001480858.1

name	Zc3h6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341560 GeneID:78751 MGI:1926001
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 6 transcript_id : NM_178404.2

name	LOC668894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367240 GeneID:668894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to catenin, alpha 2 transcript_id : XM_001004454.1

name	Ttl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076928 GeneID:69737 MGI:1916987
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase transcript_id : NM_027192.1

name	LOC100043738 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250127 GeneID:100043738
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100043738 transcript_id : XM_001480861.1

name	Rpo1-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677788 GeneID:20017 MGI:108014
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase 1-2 transcript_id : NM_009086.1

name	Chchd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353048 GeneID:66170 MGI:1913420
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 5 transcript_id : NM_025395.2

name	LOC100043431 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250006 GeneID:100043431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : hypothetical protein LOC100043431 transcript_id : XM_001480152.1

name	Slc20a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657578 GeneID:20515 MGI:108392
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 20, member 1 transcript_id : NM_015747.1

name	A730036I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367589 GeneID:329513 MGI:3041182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A730036I17 gene transcript_id : NM_177847.3

name	LOC671466 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250132 GeneID:671466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical LOC671466 transcript_id : XM_001480876.1

name	Ncaph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450193 CCDS:CCDS16693.1 GeneID:215387 MGI:2444777
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0000278 - mitotic cell cycle [Evidence IEA]; GO:0007076 - mitotic chromosome condensation [Evidence IEA] codon_start : 1 product : barren homolog protein_id : NP_659067.1

name	1700041B20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94367224 GeneID:73338 MGI:1920588
definition	codon_start : 1 product : hypothetical protein LOC73338 isoform 1 protein_id : XP_485065.3

name	Ascc3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40018610 CCDS:CCDS16695.1 GeneID:320632 MGI:2444401
definition	GO_function : GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : U5 snRNP-specific protein, 200 kDa (DEXH RNA helicase family) product : U5 snRNP-specific protein, 200 kDa protein_id : NP_796188.2

name	Ciao1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542399 CCDS:CCDS16696.1 GeneID:26371 MGI:1346998
definition	GO_function : GO:0005515 - protein binding [Evidence TAS]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence TAS] codon_start : 1 note : WD repeat domain 39 product : WD40 protein Ciao1 protein_id : NP_079572.2

name	Tmem127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28201995 CCDS:CCDS16697.1 GeneID:69470 MGI:1916720
definition	codon_start : 1 product : hypothetical protein LOC69470 protein_id : NP_780354.1

name	ENSMUSG00000074822 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249999 GeneID:545459 MGI:3642134
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480151.1

name	Stard7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314860 CCDS:CCDS16698.1 GeneID:99138 MGI:2139090
definition	codon_start : 1 note : GTT1-like product : START domain containing 7 protein_id : NP_647469.1

name	Dusp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46560573 CCDS:CCDS16699.1 GeneID:13537 MGI:101911
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017017 - MAP kinase phosphatase activity [Evidence IEA]; GO:0051019 - mitogen-activated protein kinase binding [Evidence IPI]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IDA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 product : dual specificity phosphatase 2 protein_id : NP_034220.2

name	Astl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369754 CCDS:CCDS16700.1 GeneID:215095 MGI:3046414
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008533 - astacin activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 product : astacin-like metalloendopeptidase protein_id : NP_766127.1

name	Adra2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575786 CCDS:CCDS16701.1 GeneID:11552 MGI:87935
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004935 - adrenoceptor activity [Evidence IMP]; GO:0004938 - alpha2-adrenergic receptor activity [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0000165 - MAPKKK cascade [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : subtype alpha2-C2 product : adrenergic receptor, alpha 2b protein_id : NP_033763.2

name	A530057A03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487337 GeneID:215456 MGI:2684962
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glycerol-3-phosphate acyltransferase-like 1 product : hypothetical protein LOC215456 protein_id : NP_001074558.1

name	Fahd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29366814 CCDS:CCDS16702.1 GeneID:68126 MGI:1915376
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : fumarylacetoacetate hydrolase domain containing 2A protein_id : NP_083905.1

name	Kcnip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981037 CCDS:CCDS16703.1 GeneID:56461 MGI:1929258
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence TAS]; GO:0016566 - specific transcriptional repressor activity [Evidence IMP]; GO:0016564 - transcriptional repressor activity [Evidence TAS]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007610 - behavior [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0016481 - negative regulation of transcription [Evidence TAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IMP]; GO:0006813 - potassium ion transport [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048265 - response to pain [Evidence IMP]; GO:0019233 - sensory perception of pain [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium channel interacting protein 3; calsenilin, presenilin binding protein, EF hand transcription factor product : calsenilin, presenilin-binding protein, EF hand transcription factor protein_id : NP_062763.2

name	Prom2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270283 CCDS:CCDS16704.1 GeneID:192212 MGI:2138997
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; prominin-related protein product : prominin 2 isoform 1 protein_id : NP_620089.1

name	Prom2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017333 GeneID:192212 MGI:2138997
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; prominin-related protein product : prominin 2 isoform 2 protein_id : NP_835148.1

name	Zfp661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328310 CCDS:CCDS16705.1 GeneID:72180 MGI:1919430
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 2 (A1-5) protein_id : NP_082417.2

name	Mrps5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17157985 CCDS:CCDS16706.1 GeneID:77721 MGI:1924971
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S5 protein_id : NP_084239.1

name	Mal (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857808 CCDS:CCDS16707.1 GeneID:17153 MGI:892970
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006917 - induction of apoptosis [Evidence IDA] codon_start : 1 product : myelin and lymphocyte protein, T-cell differentiation protein protein_id : NP_034892.1

name	Mall (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704048 CCDS:CCDS16708.1 GeneID:228576 MGI:2385152
definition	GO_component : GO:0030136 - clathrin-coated vesicle [Evidence ISS]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence ISS]; GO:0000139 - Golgi membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA]; GO:0045121 - lipid raft [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0042632 - cholesterol homeostasis [Evidence ISS] codon_start : 1 product : mal, T-cell differentiation protein-like protein_id : NP_663507.1

name	Nphp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393845 CCDS:CCDS16709.1 GeneID:53885 MGI:1858233
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0019904 - protein domain specific binding [Evidence IEA] codon_start : 1 note : nephrocystin; nephrocystin 1 variant 2 product : nephronophthisis 1 (juvenile) homolog protein_id : NP_058598.1

name	Bub1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30840982 GeneID:12235 MGI:1100510
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IDA]; GO:0000776 - kinetochore [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : budding uninhibited by benzimidazoles 1 homolog protein_id : NP_033902.1

name	Acoxl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311885 CCDS:CCDS16711.1 GeneID:74121 MGI:1921371
definition	GO_component : GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0003997 - acyl-CoA oxidase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006635 - fatty acid beta-oxidation [Evidence IEA]; GO:0006631 - fatty acid metabolism [Evidence IEA] codon_start : 1 product : acyl-Coenzyme A oxidase-like protein_id : NP_083041.1

name	Bcl2l11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46592786 CCDS:CCDS16713.1 GeneID:12125 MGI:1197519
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043065 - positive regulation of apoptosis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Bcl2 interacting mediator of cell death product : BCL2-like 11 apoptosis facilitator isoform 1 protein_id : NP_997563.1

name	Bcl2l11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46592795 CCDS:CCDS16714.1 GeneID:12125 MGI:1197519
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043065 - positive regulation of apoptosis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Bcl2 interacting mediator of cell death product : BCL2-like 11 apoptosis facilitator isoform 2 protein_id : NP_997564.1

name	Bcl2l11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753192 CCDS:CCDS16712.1 GeneID:12125 MGI:1197519
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043065 - positive regulation of apoptosis [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; Bcl2 interacting mediator of cell death product : BCL2-like 11 apoptosis facilitator isoform 3 protein_id : NP_033884.1

name	LOC100043424 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250004 GeneID:100043424
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480183.1

name	LOC100043729 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250119 GeneID:100043729
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480892.1

name	Gm355 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82886935 GeneID:241634 MGI:2685201
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141353.6

name	Anapc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678834 CCDS:CCDS16715.1 GeneID:17222 MGI:103097
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : meiotic check point regulator product : anaphase promoting complex subunit 1 protein_id : NP_032595.1

name	Mertk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106355 CCDS:CCDS16716.1 GeneID:17289 MGI:96965
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : Tyro 12 product : c-mer proto-oncogene tyrosine kinase protein_id : NP_032613.1

name	Tmem87b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487303 GeneID:72477 MGI:1919727
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : novel lung seven transmembrane receptor domain containing protein product : hypothetical protein LOC72477 protein_id : NP_082524.2

name	1600015H20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789193 GeneID:70370 MGI:1917620
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC70370 protein_id : NP_077199.1

name	Zc3h8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719326 CCDS:CCDS16718.1 GeneID:57432 MGI:1930128
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : fetal liver zinc finger 1; zinc finger CCCH type domain containing 8 product : zinc finger CCCH type containing 8 protein_id : NP_065619.2

name	LOC100043736 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250122 GeneID:100043736
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480908.1

name	Zc3h6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409960 GeneID:78751 MGI:1926001
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger CCCH type domain containing 6 product : zinc finger CCCH type containing 6 protein_id : NP_848491.1

name	LOC668894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367241 GeneID:668894
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004454.1

name	Ttl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076929 CCDS:CCDS16719.1 GeneID:69737 MGI:1916987
definition	GO_component : GO:0005874 - microtubule [Evidence IC] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IMP] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0030516 - regulation of axon extension [Evidence IMP] codon_start : 1 product : tubulin tyrosine ligase protein_id : NP_081468.1

name	LOC100043738 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250128 GeneID:100043738
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480911.1

name	Rpo1-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677789 CCDS:CCDS16720.1 GeneID:20017 MGI:108014
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RNA polymerase 1-2, 128 kDa subunit; DNA-directed RNA polymerase I 135kDa polypeptide; RNA polymerase I subunit 2 product : RNA polymerase I polypeptide B protein_id : NP_033112.1

name	Chchd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076873 CCDS:CCDS16721.1 GeneID:66170 MGI:1913420
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : coiled-coil-helix-coiled-coil-helix domain containing 5 protein_id : NP_079671.1

name	LOC100043431 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250007 GeneID:100043431
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480202.1

name	Slc20a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657579 CCDS:CCDS16722.1 GeneID:20515 MGI:108392
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 20, member 1 protein_id : NP_056562.1

name	A730036I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244436 GeneID:329513 MGI:3041182
definition	codon_start : 1 product : hypothetical protein LOC329513 protein_id : NP_808515.1

name	LOC671466 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250133 GeneID:671466
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480926.1

name	LOC100043408 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043408
definition	number : 1 pseudo : _no_value

name	LOC100043408 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043408
definition	number : 2 pseudo : _no_value

name	LOC100043408 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043408
definition	number : 3 pseudo : _no_value

name	LOC668892 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668892
definition	number : 1 pseudo : _no_value

name	LOC668892 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668892
definition	number : 2 pseudo : _no_value

name	LOC668892 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668892
definition	number : 3 pseudo : _no_value

name	LOC383791 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383791
definition	number : 1 pseudo : _no_value

name	LOC100043735 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043735
definition	number : 1 pseudo : _no_value

name	1810024B03Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149250112 GeneID:329509 MGI:1925560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 Proteins product : RIKEN cDNA 1810024B03 gene transcript_id : XR_035468.1

name	1500011K16Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149250000 GeneID:67885 MGI:1915135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : RIKEN cDNA 1500011K16 gene transcript_id : XR_035448.1

name	LOC100043730 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250120 GeneID:100043730
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to high mobility group nucleosomal binding domain 2 pseudo : _no_value transcript_id : XR_034868.1

name	LOC545461 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250131 GeneID:545461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 184 ESTs product : similar to SET domain containing 3 pseudo : _no_value transcript_id : XR_034879.1

clone name	MSMg01-437N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523H22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-181G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116C17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179P23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-241F10.b	B6Ng01-241F10.g
ACC	GA051281	GA051282
length	1,167	1,071
definition	B6Ng01-241F10.b	B6Ng01-241F10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(128,081,697 - 128,082,853)	(127,953,006 - 127,954,067)
sequence	gaattcagtctttggttgccaaaaacaaaaacaaaaacaaacaaacaaaa cccttatatttagccagggacaccatatatcacattttggttttatctgg ccatcattttcatagctgagccaagtcttattcaactgtggtcagagaat ccacaatttgctttttgctctgagaacttgtttgcagttttctcggtatt ccaggacactcgctctgttttctgcccctccccccagctctttccctttc tacatatgtacacacgggcacacctttatgtgactatttaaaccttcatt catccattcgtttataacacctccaagacctctgtgtttgcacaaaacct gaccacactggtgtttgtgttgcttgtaatatgttctctatattgcattg taacatccagagactcacaaaactgccctctctggtcttgtctgctacgt aggccgttgcctgtcagacggttagcccttctatttgtaaatttcagctt gagctacagtgcaaaattctgtctcaaaaacaaaacaaaacaaaaaacaa aaaataaacaaacaaacacctttgaatctatactgaaaagctgtttttcc tttgcttttagttcccaaacagcaatcctcacagcaaggctcagagcatt cgcatctcccagcctctgtgagagctccagagatcacccaaaaggactcc ttcctgcctgggacctttctatttatttatttatttagttagttagttag ttagttagttaatgatctgggatctctctataaaatgggtacataaacca gttgtgatagtgacacaagtagatacccctgaagaggcagaggcaggagg atcgcaaactcaaggtcagcctggctacacattttaaaaaaaaagggggg gggggggggccacaaatcaaacatttgctgtcaacaaatttacaaacccc tttattctaaacatataatatgcatgtaattattggtaatttaggtaaat taccatttactaaagatcaaggcaactttgcaatataatgagacgggatg ttgcttgttagcttgcataaagaaacggaatcttggcctgatggggtgtg gagcaccctgtagccatgactttgtaactggtcaagtgcagaagaaacgg ctttaccaatgtataaa	gaattcccgcaaagcgcgcgccgtcccggcctggcccaggggtggggcgg ggcgcaaagcgaagctgcccggccccctaagttccagccggagctgcggt ggccggcacagtctgagcggcgctgggcggcgagtttgtcaacaatcgcc ttgccttcggctgcctgacccgtaggcgccgcccccaccgcctctgccca ttggttacgatggggagcgactgcgcgcgggccaatgggggagcactggc agccggcgccaggggcgcagggctggcggtgcccgcgcggcggcgggagc tgcgcgctaggggcggagcgggaggaggcggaggatgatcccggcggcgg ccggtgcagcgcgggccagaggcgcggcgcgcgaaaccttcggctccccg gcggagcgtggcggagggcggacgggcaggcgcggggccctggagcccag gacccggctttgtttcccttgcctcctcggtggcgacgtgcaggggtcgt tcgatcggcgcaacacgccgcgctcggaagggaaggggcggacgtgagtc tcggcatggtggcccggggagggaaagagtcagccttgcgccgggtattg ccaagaacgcgcagctaggtgtggaactttcaaagggatgtctcttaagg cccctctttggaagtgtgcacattccggcaaggttgcacccgagagaagt ggttttgtgtttggggtggcgcgcagggcagcagcagagggacctttgcg gccgagggcgctcgacccgggcggagctgcgctcggagttacaaactcta ttgtgacgcacttactacgactgacggccgctgccaaaccttctccagac ttgctgccctcagcatttttcggcaaacaatggggcccgaagcagggagg cggccagccgcctgcaatctctgcaatctgcgcccgctcctgtgctccag cttccgcattctgagccagggaattagagagcccgcctgggaattttcag actgattcagtttggtcctgagtaagcacgaaatgtagaacgttcccgcg agcctcgcttcctcctaaaac
quality values	Open. Hide. 58 24 33 26 58 37 16 45 58 58 58 58 58 62 47 41 62 47 43 33 21 62 62 62 62 56 42 62 62 62 62 62 51 56 50 38 38 56 31 43 56 56 56 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 49 62 62 59 59 51 62 59 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 54 49 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 46 62 62 62 62 62 52 62 62 62 62 62 62 53 62 62 62 58 58 54 54 58 58 52 58 58 58 53 52 58 58 58 58 58 54 58 54 52 58 52 54 58 58 58 54 58 58 58 54 58 54 58 45 54 58 58 58 50 58 58 58 58 58 32 58 58 58 58 54 58 58 58 58 52 54 58 58 58 42 51 50 58 58 58 58 51 58 47 58 58 58 49 58 58 58 46 58 58 58 50 46 58 51 58 58 54 58 50 54 53 53 49 51 53 54 58 58 58 58 58 58 52 51 58 58 50 58 58 58 50 50 58 50 58 58 50 50 48 49 58 46 51 46 58 53 46 58 50 39 36 35 8 6 51 41 50 49 53 53 58 53 52 52 50 53 53 52 51 39 50 58 50 51 50 50 29 58 21 51 40 47 33 39 27 53 39 49 45 45 52 54 52 42 34 51 54 51 45 42 51 49 50 54 32 51 24 50 39 42 49 42 28 54 16 27 31 39 39 49 44 31 13 54 54 49 24 47 37 26 47 45 51 40 31 27 37 37 40 32 31 34 37 51 9 17 9 9 9 9 18 53 40 53 52 54 52 40 45 52 53 32 32 49 49 35 32 53 53 39 36 45 45 32 34 32 41 40 31 45 52 45 35 33 39 52 35 40 53 45 42 40 34 32 42 30 45 31 32 42 31 51 51 43 34 29 31 42 38 43 39 26 30 31 35 51 51 30 31 36 46 27 24 31 32 27 43 31 51 30 40 30 31 31 31 42 42 31 31 38 32 31 25 27 37 36 35 32 31 31 31 31 31 38 26 31 31 25 21 36 40 21 26 27 22 31 19 46 24 31 26 26 31 46 11 35 16 23 20 20 29 28 15 26 30 31 33 38 31 48 32 31 36 43 16 12 25 33 27 36 33 25 29 32 35 15 7 14 34 32 31 21 31 18 32 44 48 11 33 44 47 43 41 44 44 44 25 31 43 43 47 48 48 48 48 44 43 44 44 44 41 9 6 8 16 16 27 42 25 22 30 35 38 31 29 17 33 38 20 15 20 18 17 17 20 10 29 12 19 48 19 25 27 5 4 10 14 43 20 12 33 24 25 8 31 7 17 21 24 16 16 30 39 25 7 6 24 24 14 24 13 20 14 19 21 19 21 24 17 8 14 24 18 18 28 11 13 9 21 5 21 21 10 10 12 5 5 7 10 27 29 21 5 23 13 21 11 19 21 27 22 8 24 20 33 32 10 7 14 24 28 12 15 5 11 11 5 15 28 25 40 6 13 27 9 6 7 5 15 7 15 6 10 27 11 25 16 8 28 10 24 12 16 9 16 7 25 5 8 8 5 11 11 8 20 22 22 11 9 4 6 5 30 20 8 21 23 14 13 6 11 17 9 13 8 5 14 5 6 23 11 8 7 13 3 8 30 26 13 8 14 5 18 9 15 8 8 4 10 18 5 4 4 5 16 8 11 5 23 9 12 12 6 12 17 5 5 2 2 7 6 6 7 4 4 7 7 12 3 3 6 8 10 9 18 25 5 7 22 7 1 3 3 3 3 19 8 2 2 11 22 12 4 6 5 3 6 9 25 18	Open. Hide. 62 47 42 41 62 62 62 54 62 62 42 39 30 38 36 18 22 27 21 27 31 56 47 47 62 62 62 62 62 62 62 62 59 62 62 62 59 44 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 56 62 62 59 59 59 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 46 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 54 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 47 43 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 47 41 62 54 47 62 62 62 62 54 47 62 47 31 62 62 56 62 62 62 62 62 62 54 62 62 62 62 56 62 62 62 62 62 62 62 56 62 56 62 62 56 62 62 62 62 47 47 47 62 56 56 62 56 56 56 56 62 62 62 62 62 62 54 42 62 62 62 62 46 62 48 54 62 62 54 62 54 62 62 62 62 49 52 62 54 62 62 62 62 62 52 47 31 62 54 46 52 54 47 46 48 62 54 54 62 41 62 54 54 58 58 58 58 58 54 58 58 54 58 54 58 46 54 58 54 54 54 54 45 35 58 54 58 58 52 58 58 52 54 58 58 54 48 58 58 58 54 58 54 58 54 58 58 42 58 38 54 52 58 39 39 52 45 42 52 54 58 54 54 43 58 58 58 54 54 46 58 54 58 54 45 50 42 52 58 54 52 54 38 52 54 34 54 49 54 54 39 54 54 58 42 41 54 51 58 51 50 58 50 51 41 16 58 58 50 50 48 47 44 33 50 51 42 49 46 50 52 51 51 58 48 48 41 52 54 58 38 51 54 47 41 39 47 47 58 45 32 37 41 43 58 58 51 40 58 50 50 52 46 33 51 50 50 51 50 51 33 53 51 35 58 58 35 40 42 58 36 19 25 11 58 31 58 48 38 46 51 50 51 47 39 51 47 34 9 49 41 52 50 50 39 37 58 36 58 44 50 39 31 42 39 54 38 32 31 32 50 50 53 53 42 58 37 23 41 22 20 8 50 50 29 29 40 19 58 54 54 41 26 14 17 42 53 29 39 42 38 52 37 51 39 33 32 30 54 33 24 14 32 33 13 49 41 39 25 39 54 54 33 51 30 54 25 33 29 26 39 44 49 32 11 11 6 4 5 51 42 53 53 52 54 54 54 40 49 31 51 29 53 33 28 29 29 54 33 32 6 10 11 32 16 34 19 24 54 11 52 26 15 13 26 16 27 21 31 47 30 29 18 31 21 25 7 47 45 45 29 32 52 40 26 20 15 53 51 35 53 46 29 21 29 11 14 34 33 30 29 28 31 36 30 18 27 32 16 39 33 26 22 18 40 18 30 31 31 40 22 27 38 41 12 20 31 31 33 38 27 28 42 43 32 37 29 30 17 20 31 31 29 30 32 25 18 12 19 15 32 29 10 14 18 10 12 32 31 27 31 29 46 30 31 20 23 31 22 37 19 31 31 31 30 35 25 22 26 14 20 20 11 14 32 31 37 48 48 44 16 11 26 31 24 9 31 21 31 21 19 7 13 27 32 32 16 38 8 17 6 31 24 18 17 7 44 10 11 5 28 6 5 6 12 16 9 5 5 8 25 25 11 37 31 19 16 17 21 15 12 25 28 21 7 5 7 32 29 30 32 22 11 15 43 25 12 13 32 11 32 13 9 8 30 18 17 10 26 8 6 18 9 15 32 30 14 21 9 7 17 18 31 14 23 6 22 11 3 6 28 13 27 30 4 3 4 6 4 5 27 7 28 33 30 12 9 21 10 9 34 20 6 15 24 30 38 20 28 14 6 28 7 20 12 16 11 30 13 18 8 13 34 14 11 8 7 6 3 3 4 3 3 1 3 14 4 5 7 15 6 14 16 17 12 12 7 5 9 21 17 16 5 7 9 25 25 22 7 6 5 6 5 6 6 6 4 14 6 7 14 7 5 5 4 5 6 25 30 30 22 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_128081697_128082853
seq2: B6Ng01-241F10.b_43_1209 (reverse)

seq1  TTTATACATTTGTGTAAAGCCCTGTTCTCTGCAC-TGA-CAGTCACAAAG  48
      ||||||||||   |||||||| | |  ||||||| ||| |||| ||||||
seq2  TTTATACATT--GGTAAAGCCGTTTCTTCTGCACTTGACCAGTTACAAAG  48

seq1  TCAT-GCTACA-GGTGCTCCACACCCATTCAGG-CAAGATTCCG-TTCTT  94
      |||| |||||| ||||||||||||||  ||||| |||||||||| |||||
seq2  TCATGGCTACAGGGTGCTCCACACCCCATCAGGCCAAGATTCCGTTTCTT  98

seq1  TATGCAAAGCTAACAGGC-ACAT-CCGTCTCATTAATATGCAAAGTTGCT  142
      ||||| ||||||||| || |||| |||||||||||   ||||||||||| 
seq2  TATGC-AAGCTAACAAGCAACATCCCGTCTCATTATATTGCAAAGTTGCC  147

seq1  TTGATCTTTAGTAAATGGTAATTTA-CTAAATTACCAATAATTACATGCA  191
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  TTGATCTTTAGTAAATGGTAATTTACCTAAATTACCAATAATTACATGCA  197

seq1  TATTATATGTTTTAGAATAAGGGGTTTTGT-AATTTGTTGACAGCAAATG  240
      ||||||||| |||||||||| ||| ||||| |||||||||||||||||||
seq2  TATTATATG-TTTAGAATAAAGGGGTTTGTAAATTTGTTGACAGCAAATG  246

seq1  TTTGATTTGTG---CCCCCCCCCCCCCTTTTTTTTT-AAATGTGTAGCCC  286
      |||||||||||   |||||||||||||||||||||| |||||||||| ||
seq2  TTTGATTTGTGGCCCCCCCCCCCCCCCTTTTTTTTTAAAATGTGTAG-CC  295

seq1  AGGCTGACCTTGAGTTTGCGATCCTCCTGCCTCTGCCTCTTCA-GGGTAT  335
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  AGGCTGACCTTGAGTTTGCGATCCTCCTGCCTCTGCCTCTTCAGGGGTAT  345

seq1  CTACTTGTGTCACTATCACAACTGGTTTATGTACCCATTTTATAGAGAGA  385
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTTGTGTCACTATCACAACTGGTTTATGTACCCATTTTATAGAGAGA  395

seq1  TCCCAGATCATTAACTAACTAACTAACTAACTAACTAAATAAATAAATAA  435
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAGATCATTAACTAACTAACTAACTAACTAACTAAATAAATAAATAA  445

seq1  ATAGAAATTTCCCAGGCAGGAAGGAGTCCTTTTGGGTGATCTCTGGAGCT  485
      |||||||  |||||||||||||||||||||||||||||||||||||||||
seq2  ATAGAAAGGTCCCAGGCAGGAAGGAGTCCTTTTGGGTGATCTCTGGAGCT  495

seq1  CTCACAGAGGCTGGGAGATGCGAATGCTCTGAGCCTTGCTGTGAGGATTG  535
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACAGAGGCTGGGAGATGCGAATGCTCTGAGCCTTGCTGTGAGGATTG  545

seq1  CTGTTTGGGAACTAAAAGCAAAGGAAAAACAGCTTTTCAGTATAGATTCA  585
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTTGGGAACTAAAAGCAAAGGAAAAACAGCTTTTCAGTATAGATTCA  595

seq1  AAGGTGTTTGTTTGTTTATTTTTTGTTTTTTGTTTTGTTTTGTTTTTGAG  635
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTGTTTGTTTGTTTATTTTTTGTTTTTTGTTTTGTTTTGTTTTTGAG  645

seq1  ACAGAATTTTGCACTGTAGCTCAAGCTGAAATTTACAAATAGAAGGGCTA  685
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAATTTTGCACTGTAGCTCAAGCTGAAATTTACAAATAGAAGGGCTA  695

seq1  ACCGTCTGACAGGCAACGGCCTACGTAGCAGACAAGACCAGAGAGGGCAG  735
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCGTCTGACAGGCAACGGCCTACGTAGCAGACAAGACCAGAGAGGGCAG  745

seq1  TTTTGTGAGTCTCTGGATGTTACAATGCAATATAGAGAACATATTACAAG  785
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGTGAGTCTCTGGATGTTACAATGCAATATAGAGAACATATTACAAG  795

seq1  CAACACAAACACCAGTGTGGTCAGGTTTTGTGCAAACACAGAGGTCTTGG  835
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACACAAACACCAGTGTGGTCAGGTTTTGTGCAAACACAGAGGTCTTGG  845

seq1  AGGTGTTATAAACGAATGGATGAATGAAGGTTTAAATAGTCACATAAAGG  885
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGTTATAAACGAATGGATGAATGAAGGTTTAAATAGTCACATAAAGG  895

seq1  TGTGCCCGTGTGTACATATGTAGAAAGGGAAAGAGCTGGGGGGAGGGGCA  935
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCCCGTGTGTACATATGTAGAAAGGGAAAGAGCTGGGGGGAGGGGCA  945

seq1  GAAAACAGAGCGAGTGTCCTGGAATACCGAGAAAACTGCAAACAAGTTCT  985
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAACAGAGCGAGTGTCCTGGAATACCGAGAAAACTGCAAACAAGTTCT  995

seq1  CAGAGCAAAAAGCAAATTGTGGATTCTCTGACCACAGTTGAATAAGACTT  1035
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGCAAAAAGCAAATTGTGGATTCTCTGACCACAGTTGAATAAGACTT  1045

seq1  GGCTCAGCTATGAAAATGATGGCCAGATAAAACCAAAATGTGATATATGG  1085
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTCAGCTATGAAAATGATGGCCAGATAAAACCAAAATGTGATATATGG  1095

seq1  TGTCCCTGGCTAAATATAAGGGTTTTGTTTGTTTGTTTTTGTTTTTGTTT  1135
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCCTGGCTAAATATAAGGGTTTTGTTTGTTTGTTTTTGTTTTTGTTT  1145

seq1  TTGGCAACCAAAGACTGAATTC  1157
      ||||||||||||||||||||||
seq2  TTGGCAACCAAAGACTGAATTC  1167

seq1: chr2_127953006_127954067
seq2: B6Ng01-241F10.g_69_1139

seq1  GAATTCCCGCAAAGCGCGCGCCGTCCCGGCCTGGCCCAGGGGTGGGGCGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCGCAAAGCGCGCGCCGTCCCGGCCTGGCCCAGGGGTGGGGCGG  50

seq1  GGCGCAAAGCGAAGCTGCCCGGCCCCCTAAGTTCCAGCCGGAGCTGCGGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCGCAAAGCGAAGCTGCCCGGCCCCCTAAGTTCCAGCCGGAGCTGCGGT  100

seq1  GGCCGGCACAGTCTGAGCGGCGCTGGGCGGCGAGTTTGTCAACAATCGCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCGGCACAGTCTGAGCGGCGCTGGGCGGCGAGTTTGTCAACAATCGCC  150

seq1  TTGCCTTCGGCTGCCTGACCCGTAGGCGCCGCCCCCACCGCCTCTGCCCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCTTCGGCTGCCTGACCCGTAGGCGCCGCCCCCACCGCCTCTGCCCA  200

seq1  TTGGTTACGATGGGGAGCGACTGCGCGCGGGCCAATGGGGGAGCACTGGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTTACGATGGGGAGCGACTGCGCGCGGGCCAATGGGGGAGCACTGGC  250

seq1  AGCCGGCGCCAGGGGCGCAGGGCTGGCGGTGCCCGCGCGGCGGCGGGAGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCGGCGCCAGGGGCGCAGGGCTGGCGGTGCCCGCGCGGCGGCGGGAGC  300

seq1  TGCGCGCTAGGGGCGGAGCGGGAGGAGGCGGAGGATGATCCCGGCGGCGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCGCGCTAGGGGCGGAGCGGGAGGAGGCGGAGGATGATCCCGGCGGCGG  350

seq1  CCGGTGCAGCGCGGGCCAGAGGCGCGGCGCGCGAAACCTTCGGCTCCCCG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGGTGCAGCGCGGGCCAGAGGCGCGGCGCGCGAAACCTTCGGCTCCCCG  400

seq1  GCGGAGCGTGGCGGAGGGCGGACGGGCAGGCGCGGGGCCCTGGAGCCCAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGAGCGTGGCGGAGGGCGGACGGGCAGGCGCGGGGCCCTGGAGCCCAG  450

seq1  GACCCGGCTTTGTTTCCCTTGCCTCCTCGGTGGCGACGTGCAGGGGTCGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCCGGCTTTGTTTCCCTTGCCTCCTCGGTGGCGACGTGCAGGGGTCGT  500

seq1  TCGATCGGCGCAACACGCCGCGCTCGGAAGGGAAGGGGCGGACGTGAGTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGATCGGCGCAACACGCCGCGCTCGGAAGGGAAGGGGCGGACGTGAGTC  550

seq1  TCGGCATGGTGGCCCGGGGAGGGAAAGAGTCAGCCTTGCGCCGGGTATTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGGCATGGTGGCCCGGGGAGGGAAAGAGTCAGCCTTGCGCCGGGTATTG  600

seq1  CCAAGAACGCGCAGCTAGGTGTGGAACTTTCAAAGGGATGTCTCTTAAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGAACGCGCAGCTAGGTGTGGAACTTTCAAAGGGATGTCTCTTAAGG  650

seq1  -CCCTCTTTGGAAGTGTGCACATTCCGGCAAGGTTGCACCCGAGAGAAGT  699
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTCTTTGGAAGTGTGCACATTCCGGCAAGGTTGCACCCGAGAGAAGT  700

seq1  GGTTTAGTGTTTGGGGTGGCGCGCAGGGCAGGCAGCAGGAGGGACC-TTG  748
      ||||| |||||||||||||||||||||||| |||||| |||||||| |||
seq2  GGTTTTGTGTTTGGGGTGGCGCGCAGGGCA-GCAGCA-GAGGGACCTTTG  748

seq1  CGGCCGAGGGCGCTCGACCCGGGCGGAGCTGCGCTCGGAGTTACAAACTC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCCGAGGGCGCTCGACCCGGGCGGAGCTGCGCTCGGAGTTACAAACTC  798

seq1  TATTGTGACGCACTTACTACGACTGACGGCCGCTGCCAAACCTTCTCCAG  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGTGACGCACTTACTACGACTGACGGCCGCTGCCAAACCTTCTCCAG  848

seq1  ACTTGCTGCCCTCAGCA-TTTTCGGCAAACAATGGGG-CCGGAGCAGGGA  896
      ||||||||||||||||| ||||||||||||||||||| ||| ||||||| 
seq2  ACTTGCTGCCCTCAGCATTTTTCGGCAAACAATGGGGCCCGAAGCAGGG-  897

seq1  AGGCGGCCAGCCGCCTGCAATCTCTGC-ATCTGCGCCCGCTCCTGTGCTC  945
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  AGGCGGCCAGCCGCCTGCAATCTCTGCAATCTGCGCCCGCTCCTGTGCTC  947

seq1  CAGC-TCCGCA-TCTGAGCCCGGGAAAT-GAGAGCCCG-CTGGG-ATTTT  990
      |||| |||||| |||||||| ||||| | ||||||||| ||||| |||||
seq2  CAGCTTCCGCATTCTGAGCCAGGGAATTAGAGAGCCCGCCTGGGAATTTT  997

seq1  CAGACTTGATTCAAGTTTGTCCTGAAGGAAAGCACGAAATGTAG-ACG-T  1038
      ||||| |||||||  || |||||||  | ||||||||||||||| ||| |
seq2  CAGAC-TGATTCAGTTTGGTCCTGA--GTAAGCACGAAATGTAGAACGTT  1044

seq1  CCCGCGAGC--TGCTT-CTCCTAAAAC  1062
      |||||||||   |||| ||||||||||
seq2  CCCGCGAGCCTCGCTTCCTCCTAAAAC  1071

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information