MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-242A16
Chromosome	2 (Build37)
Map Location	131,221,054 - 131,351,172
singlet/doublet	doublet
Overlap gene	LOC100043463, Smox
Upstream gene	Cpxm1, LOC100043446, 1700020A23Rik, 4933425O20Rik, A930025D01Rik, Vps16, Ptpra, Mrps26, Oxt, Avp, 1700012O15Rik, Ubox5, Fastkd5, Prosapip1, 2600009E05Rik, Itpa, Slc4a11, 4930402H24Rik, LOC100043766, C030014O09Rik, LOC627316, Atrn, LOC100043768, Gfra4, Adam33, Siglec1, LOC100043457, Hspa12b, 1700037H04Rik, Spef1, Cenpb, Cdc25b, 2310035K24Rik, D430028G21Rik, Pank2, Rnf24
Downstream gene	Adra1d, Lamr1-ps1, Prnp, Prnd, Rassf2, Slc23a2, LOC626513, LOC100043470, EG329521, 5730494N06Rik, Pcna, Cds2, Prokr2, 1700026D11Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cpxm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56264 MGI:1934569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043446 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	1700020A23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75656 MGI:1922906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins

name	4933425O20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66766 MGI:1914016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930025D01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319513 MGI:2442177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80743 MGI:2136772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptpra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19262 MGI:97808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99045 MGI:1333830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oxt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18429 MGI:97453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Avp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11998 MGI:88121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700012O15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75488 MGI:1922738
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs

name	Ubox5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140629 MGI:2154658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fastkd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380601 MGI:2139469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prosapip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241638 MGI:2656976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2600009E05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77006 MGI:1924256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16434 MGI:96622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc4a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269356 MGI:2138987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930402H24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228602 MGI:1923029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043766 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 13 Proteins pseudo : _no_value

name	C030014O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77463 MGI:1924713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC627316 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 263 ESTs, 12 Proteins pseudo : _no_value

name	Atrn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11990 MGI:1341628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043768 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043768
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 11 Proteins pseudo : _no_value

name	Gfra4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14588 MGI:1341873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110751 MGI:1341813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Siglec1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20612 MGI:99668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043457 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043457
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Hspa12b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72630 MGI:1919880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700037H04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67326 MGI:1914576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70997 MGI:3513546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12616 MGI:88376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc25b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12531 MGI:99701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310035K24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69596 MGI:1916846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D430028G21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228607 MGI:2444773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pank2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74450 MGI:1921700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51902 MGI:1261771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043463 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Smox (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228608 MGI:2445356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adra1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11550 MGI:106673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lamr1-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79234 MGI:1930596
definition	gene_synonym : 67kDa note : laminin receptor 1 (ribosomal protein SA), pseudogene 1 pseudo : _no_value

name	Prnp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19122 MGI:97769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prnd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26434 MGI:1346999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rassf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215653 MGI:2442060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc23a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54338 MGI:1859682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626513 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 22 Proteins pseudo : _no_value

name	LOC100043470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG329521 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329521 MGI:3644445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 9 Proteins

name	5730494N06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70612 MGI:1917862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcna (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18538 MGI:97503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cds2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110911 MGI:1332236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prokr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246313 MGI:2181363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700026D11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70371 MGI:1917621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Cpxm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9789916 GeneID:56264 MGI:1934569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase X 1 (M14 family) transcript_id : NM_019696.1

name	1700020A23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367228 GeneID:75656 MGI:1922906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins product : RIKEN cDNA 1700020A23 gene, transcript variant 2 transcript_id : XM_894775.2

name	4933425O20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801888 GeneID:66766 MGI:1914016
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933425O20 gene transcript_id : NM_025753.3

name	A930025D01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803380 GeneID:319513 MGI:2442177
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930025D01 gene transcript_id : NM_178762.3

name	Vps16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46852152 GeneID:80743 MGI:2136772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 16 (yeast) transcript_id : NM_030559.2

name	Ptpra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679556 GeneID:19262 MGI:97808
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, A transcript_id : NM_008980.1

name	Mrps26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402168 GeneID:99045 MGI:1333830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S26 transcript_id : NM_207207.1

name	Oxt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359854 GeneID:18429 MGI:97453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxytocin transcript_id : NM_011025.3

name	Avp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753149 GeneID:11998 MGI:88121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginine vasopressin transcript_id : NM_009732.1

name	1700012O15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250151 GeneID:75488 MGI:1922738
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs product : RIKEN cDNA 1700012O15 gene transcript_id : XM_001480924.1

name	Ubox5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802671 GeneID:140629 MGI:2154658
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U box domain containing 5 transcript_id : NM_080562.3

name	Fastkd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38016134 GeneID:380601 MGI:2139469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FAST kinase domains 5 transcript_id : NM_198176.1

name	Prosapip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38372902 GeneID:241638 MGI:2656976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ProSAPiP1 protein transcript_id : NM_197945.2

name	2600009E05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802963 GeneID:77006 MGI:1924256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2600009E05 gene transcript_id : NM_029832.2

name	Itpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982663 GeneID:16434 MGI:96622
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inosine triphosphatase (nucleoside triphosphate pyrophosphatase) transcript_id : NM_025922.2

name	Slc4a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487206 GeneID:269356 MGI:2138987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 4, sodium bicarbonate transporter-like, member 11 transcript_id : NM_001081162.1

name	4930402H24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33695156 GeneID:228602 MGI:1923029
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930402H24 gene transcript_id : NM_029432.1

name	C030014O09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250011 GeneID:77463 MGI:1924713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA C030014O09 gene transcript_id : XM_001480201.1

name	Atrn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299634 GeneID:11990 MGI:1341628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : attractin transcript_id : NM_009730.2

name	Gfra4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910239 GeneID:14588 MGI:1341873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glial cell line derived neurotrophic factor family receptor alpha 4 transcript_id : NM_020014.1

name	Adam33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956237 GeneID:110751 MGI:1341813
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 33 transcript_id : NM_033615.1

name	Siglec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938285 GeneID:20612 MGI:99668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialic acid binding Ig-like lectin 1, sialoadhesin transcript_id : NM_011426.2

name	LOC100043457 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250013 GeneID:100043457
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043457 transcript_id : XM_001480206.1

name	Hspa12b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130472 GeneID:72630 MGI:1919880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein 12B transcript_id : NM_028306.3

name	1700037H04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801935 GeneID:67326 MGI:1914576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700037H04 gene transcript_id : NM_026091.2

name	Spef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114687765 GeneID:70997 MGI:3513546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm flagellar 1 transcript_id : NM_027641.2

name	Cenpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328104 GeneID:12616 MGI:88376
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein B transcript_id : NM_007682.2

name	Cdc25b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963486 GeneID:12531 MGI:99701
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 25 homolog B (S. pombe) transcript_id : NM_023117.1

name	2310035K24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980818 GeneID:69596 MGI:1916846
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310035K24 gene transcript_id : NM_027129.2

name	D430028G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450262 GeneID:228607 MGI:2444773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D430028G21 gene transcript_id : NM_144888.1

name	Pank2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943833 GeneID:74450 MGI:1921700
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pantothenate kinase 2 (Hallervorden-Spatz syndrome) transcript_id : NM_153501.1

name	Rnf24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130609 GeneID:51902 MGI:1261771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 24 transcript_id : NM_178607.3

name	Smox (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704049 GeneID:228608 MGI:2445356
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermine oxidase transcript_id : NM_145533.1

name	Adra1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347546 GeneID:11550 MGI:106673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor, alpha 1d transcript_id : NM_013460.4

name	Prnp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13173472 GeneID:19122 MGI:97769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prion protein transcript_id : NM_011170.1

name	Prnd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13605923 GeneID:26434 MGI:1346999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prion protein dublet transcript_id : NM_023043.1

name	Rassf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254305 GeneID:215653 MGI:2442060
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras association (RalGDS/AF-6) domain family 2 transcript_id : NM_175445.3

name	Slc23a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42741687 GeneID:54338 MGI:1859682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 23 (nucleobase transporters), member 2 transcript_id : NM_018824.2

name	EG329521 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367260 GeneID:329521 MGI:3644445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 9 Proteins product : predicted gene, EG329521 transcript_id : XM_194054.6

name	5730494N06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357407 GeneID:70612 MGI:1917862
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730494N06 gene transcript_id : NM_027478.2

name	Pcna (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130232 GeneID:18538 MGI:97503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proliferating cell nuclear antigen transcript_id : NM_011045.2

name	Cds2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343990 GeneID:110911 MGI:1332236
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 transcript_id : NM_138651.4

name	Prokr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542916 GeneID:246313 MGI:2181363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prokineticin receptor 2 transcript_id : NM_144944.2

name	1700026D11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250161 GeneID:70371 MGI:1917621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700026D11 gene transcript_id : XM_001480981.1

name	Cpxm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789917 CCDS:CCDS16740.1 GeneID:56264 MGI:1934569
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA]; GO:0004180 - carboxypeptidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : metallocarboxypeptidase CPX-1; metallocarboxypeptidase 1; carboxypeptidase X (M14 family) product : carboxypeptidase X 1 (M14 family) protein_id : NP_062670.1

name	1700020A23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82886863 GeneID:75656 MGI:1922906
definition	codon_start : 1 product : hypothetical protein LOC75656 isoform 2 protein_id : XP_899868.1

name	4933425O20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313328 CCDS:CCDS16742.1 GeneID:66766 MGI:1914016
definition	codon_start : 1 product : hypothetical protein LOC66766 protein_id : NP_080029.1

name	A930025D01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520223 GeneID:319513 MGI:2442177
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC319513 protein_id : NP_848877.1

name	Vps16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46852153 GeneID:80743 MGI:2136772
definition	GO_component : GO:0005884 - actin filament [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005769 - early endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vacuolar protein sorting 16 protein_id : NP_085036.2

name	Ptpra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679557 CCDS:CCDS16743.1 GeneID:19262 MGI:97808
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008286 - insulin receptor signaling pathway [Evidence IMP]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protein tyrosine phosphatase, receptor type, A protein_id : NP_033006.1

name	Mrps26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402169 CCDS:CCDS16744.1 GeneID:99045 MGI:1333830
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S26 protein_id : NP_997090.1

name	Oxt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754960 CCDS:CCDS16745.1 GeneID:18429 MGI:97453
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005185 - neurohypophyseal hormone activity [Evidence IEA] codon_start : 1 product : oxytocin protein_id : NP_035155.1

name	Avp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753150 CCDS:CCDS16746.1 GeneID:11998 MGI:88121
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005185 - neurohypophyseal hormone activity [Evidence IEA] GO_process : GO:0030146 - diuresis [Evidence IDA]; GO:0030819 - positive regulation of cAMP biosynthesis [Evidence IDA]; GO:0050880 - regulation of blood vessel size [Evidence IEA]; GO:0042310 - vasoconstriction [Evidence IEA] codon_start : 1 product : arginine vasopressin protein_id : NP_033862.1

name	1700012O15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250152 GeneID:75488 MGI:1922738
definition	codon_start : 1 product : hypothetical protein LOC75488 protein_id : XP_001480974.1

name	Ubox5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543595 CCDS:CCDS16747.1 GeneID:140629 MGI:2154658
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000151 - ubiquitin ligase complex [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016567 - protein ubiquitination [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : UbcM4-interacting protein 5; ring finger protein 37 product : ubiquitin conjugating enzyme 7 interacting protein 5 protein_id : NP_542129.2

name	Fastkd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016135 GeneID:380601 MGI:2139469
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : FAST kinase domains 5 protein_id : NP_937819.1

name	Prosapip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38372903 GeneID:241638 MGI:2656976
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : ProSAPiP1 protein protein_id : NP_922936.2

name	2600009E05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110350660 GeneID:77006 MGI:1924256
definition	codon_start : 1 product : hypothetical protein LOC77006 protein_id : NP_084108.1

name	Itpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982664 CCDS:CCDS16748.1 GeneID:16434 MGI:96622
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0047429 - nucleoside-triphosphate diphosphatase activity [Evidence IDA] GO_process : GO:0009117 - nucleotide metabolism [Evidence IEA] codon_start : 1 note : nucleoside triphosphate pyrophosphatase; inosine triphosphate pyrophosphatase product : inosine triphosphatase protein_id : NP_080198.2

name	Slc4a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487207 GeneID:269356 MGI:2138987
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005452 - inorganic anion exchanger activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence IEA] codon_start : 1 product : solute carrier family 4, sodium bicarbonate transporter-like, member 11 protein_id : NP_001074631.1

name	4930402H24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33695157 CCDS:CCDS16750.1 GeneID:228602 MGI:1923029
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC228602 protein_id : NP_083708.1

name	C030014O09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250012 GeneID:77463 MGI:1924713
definition	codon_start : 1 product : hypothetical protein LOC77463 protein_id : XP_001480251.1

name	Atrn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299635 CCDS:CCDS16751.1 GeneID:11990 MGI:1341628
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0040014 - regulation of body size [Evidence IMP] codon_start : 1 product : attractin protein_id : NP_033860.2

name	Gfra4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910240 CCDS:CCDS16752.1 GeneID:14588 MGI:1341873
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015026 - coreceptor activity [Evidence TAS]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007399 - nervous system development [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence TAS] codon_start : 1 note : GFR alpha-4 product : glial cell line derived neurotrophic factor family receptor alpha 4 protein_id : NP_064398.1

name	Adam33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956238 CCDS:CCDS16753.1 GeneID:110751 MGI:1341813
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence NAS] [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence NAS] [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence NAS] [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence NAS]; GO:0042035 - regulation of cytokine biosynthesis [Evidence NAS] codon_start : 1 exception : mismatches in translation note : disintegrin and metalloprotease domain 33 product : a disintegrin and metalloprotease domain 33 protein_id : NP_291093.1

name	Siglec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938286 CCDS:CCDS16754.1 GeneID:20612 MGI:99668
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0016337 - cell-cell adhesion [Evidence ISS]; GO:0007160 - cell-matrix adhesion [Evidence ISS]; GO:0006954 - inflammatory response [Evidence ISS] codon_start : 1 product : sialoadhesin protein_id : NP_035556.2

name	LOC100043457 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250014 GeneID:100043457
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480256.1

name	Hspa12b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312236 CCDS:CCDS16755.1 GeneID:72630 MGI:1919880
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : HSPA12B protein_id : NP_082582.1

name	1700037H04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385590 CCDS:CCDS16756.1 GeneID:67326 MGI:1914576
definition	codon_start : 1 product : hypothetical protein LOC67326 protein_id : NP_080367.1

name	Spef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625792 GeneID:70997 MGI:3513546
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0019861 - flagellum [Evidence IEA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA] codon_start : 1 note : calponin-homology and microtubule-associated protein product : sperm flagellar 1 protein_id : NP_081917.1

name	Cenpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328105 CCDS:CCDS16757.1 GeneID:12616 MGI:88376
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : centromere autoantigen B protein_id : NP_031708.2

name	Cdc25b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963487 CCDS:CCDS16758.1 GeneID:12531 MGI:99701
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007144 - female meiosis I [Evidence IMP]; GO:0000087 - M phase of mitotic cell cycle [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0001556 - oocyte maturation [Evidence IMP]; GO:0045860 - positive regulation of protein kinase activity [Evidence IMP]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : cell division cycle 25B product : cell division cycle 25 homolog B protein_id : NP_075606.1

name	2310035K24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980819 CCDS:CCDS16759.1 GeneID:69596 MGI:1916846
definition	codon_start : 1 product : hypothetical protein LOC69596 protein_id : NP_081405.2

name	D430028G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450263 CCDS:CCDS16760.1 GeneID:228607 MGI:2444773
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : mitochondrial anti-viral signaling protein product : virus-induced signaling adapter protein_id : NP_659137.1

name	Pank2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51571537 CCDS:CCDS16761.1 GeneID:74450 MGI:1921700
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004594 - pantothenate kinase activity [Evidence IGI] GO_process : GO:0015937 - coenzyme A biosynthesis [Evidence IEA] codon_start : 1 product : pantothenate kinase 2 protein_id : NP_705721.2

name	Rnf24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519929 CCDS:CCDS16762.1 GeneID:51902 MGI:1261771
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ring finger protein 24 protein_id : NP_848722.1

name	Smox (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704050 CCDS:CCDS16763.1 GeneID:228608 MGI:2445356
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0046592 - polyamine oxidase activity [Evidence IDA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0046208 - spermine catabolism [Evidence IDA] codon_start : 1 note : polyamine oxidase 1 product : spermine oxidase protein_id : NP_663508.1

name	Adra1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347547 CCDS:CCDS16764.1 GeneID:11550 MGI:106673
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004935 - adrenoceptor activity [Evidence IEA]; GO:0004937 - alpha1-adrenergic receptor activity [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0001986 - decreased strength of heart contraction during baroreceptor response to increased blood pressure [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0001994 - norepinephrine-epinephrine vasoconstriction during regulation of blood pressure [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : adrenergic receptor, alpha 1d protein_id : NP_038488.4

name	Prnp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13173473 CCDS:CCDS16766.1 GeneID:19122 MGI:97769
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0045121 - lipid raft [Evidence TAS] [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005507 - copper ion binding [Evidence IDA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006878 - copper ion homeostasis [Evidence TAS]; GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence TAS]; GO:0006979 - response to oxidative stress [Evidence IDA] codon_start : 1 product : prion protein protein_id : NP_035300.1

name	Prnd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13605924 CCDS:CCDS16767.1 GeneID:26434 MGI:1346999
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IDA]; GO:0048503 - GPI anchor binding [Evidence IEA] GO_process : GO:0006878 - copper ion homeostasis [Evidence IDA] codon_start : 1 note : prion protein-like protein product : prion protein dublet protein_id : NP_075530.1

name	Rassf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425302 CCDS:CCDS16768.1 GeneID:215653 MGI:2442060
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Ras association (RalGDS/AF-6) domain family 2 protein_id : NP_780654.1

name	Slc23a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42741688 CCDS:CCDS16769.1 GeneID:54338 MGI:1859682
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008520 - L-ascorbate:sodium symporter activity [Evidence IMP] [Evidence ISS]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0008523 - sodium-dependent multivitamin transporter activity [Evidence ISS]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0019852 - L-ascorbic acid metabolism [Evidence ISS] [Evidence IMP]; GO:0015993 - molecular hydrogen transport [Evidence ISS]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : sodium-dependent vitamin C transporter; solute carrier family 23 (nucleobase transporters), member 1 product : solute carrier family 23 (nucleobase transporters), member 2 protein_id : NP_061294.2

name	EG329521 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82886998 GeneID:329521 MGI:3644445
definition	codon_start : 1 product : hypothetical protein protein_id : XP_194054.4

name	5730494N06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312612 CCDS:CCDS16770.1 GeneID:70612 MGI:1917862
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC70612 protein_id : NP_081754.1

name	Pcna (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242171 CCDS:CCDS16771.1 GeneID:18538 MGI:97503
definition	GO_component : GO:0000307 - cyclin-dependent protein kinase holoenzyme complex [Evidence IPI]; GO:0005652 - nuclear lamina [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0043626 - PCNA complex [Evidence IEA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030337 - DNA polymerase processivity factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006287 - base-excision repair, gap-filling [Evidence IDA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IMP]; GO:0006275 - regulation of DNA replication [Evidence IEA] codon_start : 1 product : proliferating cell nuclear antigen protein_id : NP_035175.1

name	Cds2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149726 CCDS:CCDS16772.1 GeneID:110911 MGI:1332236
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : phosphatidate cytidylyltransferase 2 protein_id : NP_619592.1

name	Prokr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542917 CCDS:CCDS16773.1 GeneID:246313 MGI:2181363
definition	GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : G protein-coupled receptor 73-like 1 product : prokineticin receptor 2 protein_id : NP_659193.2

name	1700026D11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250162 GeneID:70371 MGI:1917621
definition	codon_start : 1 product : hypothetical protein LOC70371 protein_id : XP_001481031.1

name	LOC100043446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043446
definition	number : 1 pseudo : _no_value

name	LOC100043446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043446
definition	number : 2 pseudo : _no_value

name	LOC100043446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043446
definition	number : 3 pseudo : _no_value

name	LOC100043446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043446
definition	number : 4 pseudo : _no_value

name	LOC100043463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043463
definition	number : 4 pseudo : _no_value

name	LOC100043463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043463
definition	number : 3 pseudo : _no_value

name	LOC100043463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043463
definition	number : 2 pseudo : _no_value

name	LOC100043463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043463
definition	number : 1 pseudo : _no_value

name	LOC100043470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043470
definition	number : 3 pseudo : _no_value

name	LOC100043470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043470
definition	number : 2 pseudo : _no_value

name	LOC100043470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043470
definition	number : 1 pseudo : _no_value

name	LOC100043766 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250157 GeneID:100043766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 13 Proteins product : similar to PKC-potentiated PP1 inhibitory protein pseudo : _no_value transcript_id : XR_034913.1

name	LOC627316 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250158 GeneID:627316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 263 ESTs, 12 Proteins product : similar to proteasome 26S non-ATPase subunit 11 pseudo : _no_value transcript_id : XR_034915.1

name	LOC100043768 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250159 GeneID:100043768
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 11 Proteins product : similar to high mobility group box 1 pseudo : _no_value transcript_id : XR_034918.1

name	LOC626513 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250160 GeneID:626513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 22 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_034932.1

clone name	MSMg01-100E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-440B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-390E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398L13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-398D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-059O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305K16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-385A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-266D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417P15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-309B11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076N23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-242A16.b	B6Ng01-242A16.g
ACC	GA051798	GA051799
length	1,172	1,140
definition	B6Ng01-242A16.b	B6Ng01-242A16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(131,350,015 - 131,351,172)	(131,221,054 - 131,222,199)
sequence	gaattcaccttcattccacgcagcctgcctaccattcaaccaagctccaa gaaaggcaaataggtagaaccaggcttatcctaaggaagtgtgcactggg cagggagaagtcttccaggggaatctcactcagcaggcacaaacagaggg gtaaagggatgtctcctcaataaacctaacagccataactccttacacca agccccagtcagagatgggagcaaacacacagagagcctttgaactgagg agagaagcaaaggagcgtgggaagggtcacttcttttattatcccaaaat gcaaagtattgaaggcacttgcaataacatgagagaggaaaaaagcagga agcagaaccccacctggtcattacccagcctggagaaaaagaaaagctct cgggccaggtctgacgtcagcccggtgtccactacagaaggtaaaattcc attctacagacaattaggaaattaagagcacgggggcaagggacgaggac cagcagtcacgagttagtggttcttcaaggaacacatttggcagtgagga cacctttcagggcccctgctggaagaggtctcggtacatctcgatgagcc gggcggcctcgcgctggccagagagcagagcaccgtgggtggtggagtag tacttgcggtgtgtggcctccccggagaagagcacctgcatgggctaagt gggaggaaggggaagtaagcatggagaagcaacagaggcagcgggctccc tgtcagccccggaacccccactcttgccaggcagacatgagtgaacagaa cgcagtattctgtttccatggggtgaagggtcacccacccacctcgccac cttcccttcccttccccatacacccatgcgtaatgtttccttctgtccca aggctgtcagaaaggcctggctctatagtcccaaaggctccattcacctc ttagcaattagttctaacccctccttcagcctttattttcttagagagaa tttataccaccttgcttctgaggccagcctgcaaagatgaaaatgaaaac tatgcatgtaaagcacttagaatctggaaagaaatgttaaacaaagctag gtggtaattaaccaactttttatggaccccatactaaaggtcaaggattg ttctggtccttggaatggtaaa	gaattctcccatttctgcccagtattcttctttaaggagatgtctgtctg tctgtctgtctgtctgtccacttactcgtatacccatgacctctaaagca ttgttacacttactcttccctgtctttttctttgtgttttgtgcagtgtt gggaacgaagccccaggtcttgctcacactaggcaagtgctcttctattg agccacatccacagcttgtatctcacatcggaaggtcagtctgctcttgt tacagacagcctgaagcccagattgcacttcactgcctgccctctctcct ttgaaagcagttcttttctaatgttctttctagattatgagaatgcagtt ctgtgcacttggtctagccctaccttacctctcaatacagcaaaaatggt gaggcccagccccccacatccagagctaaaattagcattcctggctgggt cagttttcttgccattttagggcccttccctactcaatggctctcccttg tgacttgagctagtcatgagaccacctccttctcactatctggaacctga tgaactggaatggcttaggacaccacccggatctctggtctctttaacac agcatttactgacagggcatttggtccggatcagacactgactctagcct agatggagggaagtttattaattgcttacagggtgccttctggggttcat cagaagtactgggcatgagaggaacgtgcctgtgagctaccataggcacc actgtccttgtggctgtgttctcgtctgtccctgcctctctgtgatgcca gactctgagctctgtgaagcgtgactgagacagggctgaacctggctctg ggcctaagccctcatcaccaaagaagaccaatcagtatgctgggttcctc ctccaaacgatgggaagggttaggtgttcagaagagaaaggatgacagtc cctctccctcctgcccaccacagtatcacaacatttagagtctgtcatga gcagctggatgatccaaggcagaatctacccctcacagctatcttttctt taaatgaaaaaaataaattcttttcttacagaaataattttgatcaacgt tttctccttctcagttcttcagaatcctcctgccttcctc
quality values	Open. Hide. 58 25 18 29 58 34 26 46 54 58 62 19 16 62 62 62 37 23 62 62 47 62 62 62 62 62 62 62 62 54 62 51 44 32 38 56 28 28 31 50 59 59 62 62 62 62 62 59 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 49 49 54 62 59 62 54 54 54 62 62 62 62 62 62 62 59 59 59 62 62 59 62 62 62 54 59 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 51 62 47 46 62 62 62 62 62 54 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 45 58 58 58 54 54 58 54 58 58 58 58 58 52 58 58 58 58 44 43 49 45 46 52 58 58 58 58 58 54 52 41 58 58 58 58 58 58 58 58 58 58 58 58 58 54 35 58 39 54 51 58 58 54 58 58 52 52 52 52 58 58 58 58 54 58 58 58 58 42 58 58 51 58 58 51 58 48 33 58 58 51 40 58 54 58 58 54 58 42 39 42 46 58 31 58 50 53 58 46 58 37 58 51 42 58 58 50 58 58 58 50 51 41 29 58 49 58 37 51 51 37 52 46 41 58 58 49 52 58 58 37 58 53 58 50 51 49 33 50 49 40 51 58 41 37 58 36 26 49 43 23 58 31 51 25 24 58 53 53 53 37 50 51 58 50 52 53 40 58 52 53 54 58 50 38 15 50 50 22 8 17 31 46 51 47 32 42 32 51 34 52 29 40 53 38 49 31 39 51 18 33 33 31 49 23 25 51 31 54 32 42 35 42 42 54 54 37 39 28 54 49 44 44 38 39 42 32 53 44 44 42 30 37 52 38 27 42 44 54 53 34 28 30 28 31 28 38 25 42 31 32 54 32 40 26 51 21 20 45 34 52 24 52 36 39 45 36 31 32 44 41 35 31 41 6 10 15 23 45 45 35 31 41 19 46 25 21 31 27 32 29 51 47 40 27 36 46 35 29 49 26 14 37 31 26 46 29 34 31 51 14 16 30 46 42 35 31 26 30 30 40 19 12 27 29 41 29 29 32 22 51 32 18 46 17 46 45 28 36 14 20 27 14 22 43 28 13 21 30 31 31 31 20 25 18 32 10 46 24 43 9 8 9 23 31 33 32 31 36 22 14 20 7 6 7 43 31 42 19 6 9 30 41 5 16 32 21 10 18 32 32 18 33 27 27 32 23 21 14 37 39 36 23 18 46 33 29 36 21 11 10 9 11 30 31 25 21 33 16 11 11 26 11 11 22 33 29 20 6 6 18 19 21 9 8 7 9 13 21 36 36 8 17 21 38 9 18 19 12 13 31 13 13 31 26 26 21 36 31 25 18 14 16 23 6 7 7 13 9 7 8 20 26 20 6 4 7 26 25 15 15 25 10 10 15 10 28 17 19 31 27 32 15 24 21 28 15 20 20 11 18 27 20 15 25 9 6 4 14 17 34 34 24 10 14 6 11 34 32 18 27 8 6 6 7 27 23 11 17 21 9 25 21 11 12 8 27 27 29 8 4 11 25 18 28 20 11 23 9 29 20 6 15 30 15 21 22 11 6 10 28 20 15 8 28 12 6 5 5 6 9 6 5 6 9 3 11 9 9 12 2 3 7 8 17 3 2 2 2 7 4 9 6 5 21 10 8 4 18 21 18 4 4 8 18 10 4 9 5 9 14 9 18 8 14 22 12 9 4 24 4 2 5 6 6 4 3 1 2 6 6 11 3 4 3 7 9 14 2 1 2 17 10	Open. Hide. 62 47 47 42 62 62 62 62 62 47 44 42 45 45 32 28 28 34 50 44 44 59 59 62 59 62 62 62 62 62 62 62 59 62 59 62 62 54 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 59 62 49 54 62 62 62 62 54 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 49 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 46 38 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 58 58 54 58 58 58 54 58 58 58 58 54 54 58 58 58 58 54 41 45 41 58 52 58 58 58 58 58 58 58 58 47 39 52 58 58 54 58 58 58 58 58 58 54 40 58 58 58 54 42 54 58 58 48 58 58 58 58 54 47 58 58 49 58 47 58 29 58 58 50 53 53 51 40 51 58 58 51 58 45 49 53 58 53 51 58 58 50 52 53 53 58 58 41 40 58 51 50 51 53 51 51 51 54 58 54 50 51 58 58 51 52 39 39 58 43 35 29 37 58 51 51 49 53 51 51 50 58 39 40 53 52 50 58 50 50 51 52 50 49 39 58 52 53 50 50 58 46 52 53 32 27 37 44 49 41 21 58 49 50 53 30 50 58 52 39 35 52 52 42 54 54 51 45 53 47 39 40 37 37 49 49 32 51 26 50 44 52 45 39 54 54 54 49 38 49 39 39 45 45 39 32 54 51 32 40 32 45 41 54 49 49 37 30 45 41 39 18 51 25 49 52 34 24 42 40 44 42 35 39 53 47 35 33 16 52 39 32 25 21 37 52 42 27 46 35 30 32 41 32 31 29 47 32 30 46 31 47 47 31 33 41 29 40 34 31 53 45 29 41 25 32 32 32 52 31 40 32 31 46 28 26 31 30 41 32 34 41 31 29 33 28 31 43 28 35 24 42 31 26 41 23 31 31 32 37 38 17 30 42 31 32 31 31 26 27 27 28 42 27 27 31 24 29 31 31 36 13 30 23 22 26 47 26 12 31 23 31 25 30 24 31 28 21 30 31 35 36 31 46 33 21 37 25 20 39 14 29 38 30 37 38 25 30 31 30 32 21 27 46 31 23 41 41 21 43 16 23 16 33 32 32 32 16 32 34 36 37 31 31 29 41 24 15 17 14 25 22 26 25 31 26 25 30 36 25 30 18 31 27 22 44 31 33 33 18 48 26 15 14 25 25 29 24 32 14 22 24 24 21 33 26 12 43 4 30 48 21 25 14 30 19 32 34 17 26 22 32 20 39 15 20 18 28 13 47 19 14 11 14 15 21 23 31 21 11 6 24 12 29 32 27 32 31 31 26 15 17 8 8 13 16 22 47 27 18 7 8 6 6 11 11 21 15 16 24 24 24 28 20 28 17 22 21 27 13 15 13 16 19 16 24 10 18 6 12 9 15 16 7 10 28 27 15 19 24 20 13 30 28 5 11 7 27 4 14 12 14 12 17 14 19 20 14 17 13 3 5 13 3 6 28 6 24 6 7 20 20 29 27 24 13 5 2 5 3 3 3 8 10 29 15 4 16 4 4 6 9 5 12 16 16 8 6 4 7 5 23 28 14 12 18 18 10 8 8 6 5 18 25 17 10 3 6 5 7 9 7 4 4 3 2 1 3 3 5 2 7 22 7 4 18 18 7 8 6 4 4 10 1 3 4 10 6 4 3 4 7 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_131350015_131351172
seq2: B6Ng01-242A16.b_50_1221 (reverse)

seq1  TTTACCA-TCCAAGTGCCCAGAACAATCCCTGGACCCTAGTAGGGGCTCC  49
      ||||||| |||||| | |||||||||||| ||  |  ||||| ||| |||
seq2  TTTACCATTCCAAG-GACCAGAACAATCCTTGACCTTTAGTATGGGGTCC  49

seq1  ATAAAGGTTTGTTAAATTACCACCTAACTTTGTTT-ACATT--CTTCCAG  96
      |||||   ||| | |||||||||||| |||||||| |||||   ||||||
seq2  ATAAAAAGTTGGTTAATTACCACCTAGCTTTGTTTAACATTTCTTTCCAG  99

seq1  ATTCTAAGTGC-TTACATGCATAG-TTTCA-TTTCATCTTTGCA-GCTGG  142
      ||||||||||| |||||||||||| ||||| ||||||||||||| |||||
seq2  ATTCTAAGTGCTTTACATGCATAGTTTTCATTTTCATCTTTGCAGGCTGG  149

seq1  CCTCAGAAGC-AGGTGGTATAAA-TCTCTCTAAGAAAATAAAGGCTG-AG  189
      |||||||||| |||||||||||| ||||||||||||||||||||||| ||
seq2  CCTCAGAAGCAAGGTGGTATAAATTCTCTCTAAGAAAATAAAGGCTGAAG  199

seq1  GA-GGGTTAG-ACT-ATTGCTAAGAGGTGAATGGAGCCTTTGGGACTATA  236
      || ||||||| ||| |||||||||||||||||||||||||||||||||||
seq2  GAGGGGTTAGAACTAATTGCTAAGAGGTGAATGGAGCCTTTGGGACTATA  249

seq1  GAGCCAGGCC-TTCTGACAGCCTTGGGACAGAAGG-AACATTACGCATGG  284
      |||||||||| |||||||||||||||||||||||| ||||||||||||||
seq2  GAGCCAGGCCTTTCTGACAGCCTTGGGACAGAAGGAAACATTACGCATGG  299

seq1  GTGTATGGGGAAGGGAAGGGAAGGTGGCGAGGTGGGTGGGTGACCCTTCA  334
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTATGGGGAAGGGAAGGGAAGGTGGCGAGGTGGGTGGGTGACCCTTCA  349

seq1  CCCCATGGAAACAGAATACCTGCGTTCTGTTCACTCATGTCTGCCTGGCA  384
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  CCCCATGGAAACAGAATA-CTGCGTTCTGTTCACTCATGTCTGCCTGGCA  398

seq1  AGAGTGGGGGTTCCGGGGCTGACAGGGAGCCCGCTGCCTCTGTTGCTTCT  434
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTGGGGGTTCCGGGGCTGACAGGGAGCCCGCTGCCTCTGTTGCTTCT  448

seq1  CCATGCTTACTTCCCCTTCCTCCCACTTAGCCCATGCAGGTGCTCTTCTC  484
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGCTTACTTCCCCTTCCTCCCACTTAGCCCATGCAGGTGCTCTTCTC  498

seq1  CGGGGAGGCCACACACCGCAAGTACTACTCCACCACCCACGGTGCTCTGC  534
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGGGAGGCCACACACCGCAAGTACTACTCCACCACCCACGGTGCTCTGC  548

seq1  TCTCTGGCCAGCGCGAGGCCGCCCGGCTCATCGAGATGTACCGAGACCTC  584
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGGCCAGCGCGAGGCCGCCCGGCTCATCGAGATGTACCGAGACCTC  598

seq1  TTCCAGCAGGGGCCCTGAAAGGTGTCCTCACTGCCAAATGTGTTCCTTGA  634
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAGCAGGGGCCCTGAAAGGTGTCCTCACTGCCAAATGTGTTCCTTGA  648

seq1  AGAACCACTAACTCGTGACTGCTGGTCCTCGTCCCTTGCCCCCGTGCTCT  684
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACCACTAACTCGTGACTGCTGGTCCTCGTCCCTTGCCCCCGTGCTCT  698

seq1  TAATTTCCTAATTGTCTGTAGAATGGAATTTTACCTTCTGTAGTGGACAC  734
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTTCCTAATTGTCTGTAGAATGGAATTTTACCTTCTGTAGTGGACAC  748

seq1  CGGGCTGACGTCAGACCTGGCCCGAGAGCTTTTCTTTTTCTCCAGGCTGG  784
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGGCTGACGTCAGACCTGGCCCGAGAGCTTTTCTTTTTCTCCAGGCTGG  798

seq1  GTAATGACCAGGTGGGGTTCTGCTTCCTGCTTTTTTCCTCTCTCATGTTA  834
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAATGACCAGGTGGGGTTCTGCTTCCTGCTTTTTTCCTCTCTCATGTTA  848

seq1  TTGCAAGTGCCTTCAATACTTTGCATTTTGGGATAATAAAAGAAGTGACC  884
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCAAGTGCCTTCAATACTTTGCATTTTGGGATAATAAAAGAAGTGACC  898

seq1  CTTCCCACGCTCCTTTGCTTCTCTCCTCAGTTCAAAGGCTCTCTGTGTGT  934
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCCACGCTCCTTTGCTTCTCTCCTCAGTTCAAAGGCTCTCTGTGTGT  948

seq1  TTGCTCCCATCTCTGACTGGGGCTTGGTGTAAGGAGTTATGGCTGTTAGG  984
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTCCCATCTCTGACTGGGGCTTGGTGTAAGGAGTTATGGCTGTTAGG  998

seq1  TTTATTGAGGAGACATCCCTTTACCCCTCTGTTTGTGCCTGCTGAGTGAG  1034
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATTGAGGAGACATCCCTTTACCCCTCTGTTTGTGCCTGCTGAGTGAG  1048

seq1  ATTCCCCTGGAAGACTTCTCCCTGCCCAGTGCACACTTCCTTAGGATAAG  1084
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCCCTGGAAGACTTCTCCCTGCCCAGTGCACACTTCCTTAGGATAAG  1098

seq1  CCTGGTTCTACCTATTTGCCTTTCTTGGAGCTTGGTTGAATGGTAGGCAG  1134
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGTTCTACCTATTTGCCTTTCTTGGAGCTTGGTTGAATGGTAGGCAG  1148

seq1  GCTGCGTGGAATGAAGGTGAATTC  1158
      ||||||||||||||||||||||||
seq2  GCTGCGTGGAATGAAGGTGAATTC  1172

seq1: chr2_131221054_131222199
seq2: B6Ng01-242A16.g_66_1205

seq1  GAATTCTCCCATTTCTGCCCAGTATTCTTCTTTAAGGAGATGTCTGTCTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCCCATTTCTGCCCAGTATTCTTCTTTAAGGAGATGTCTGTCTG  50

seq1  TCTGTCTGTCTGTCTGTCCACTTACTCGTATACCCATGACCTCTAAAGCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTCTGTCTGTCTGTCCACTTACTCGTATACCCATGACCTCTAAAGCA  100

seq1  TTGTTACACTTACTCTTCCCTGTCTTTTTCTTTGTGTTTTGTGCAGTGTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTACACTTACTCTTCCCTGTCTTTTTCTTTGTGTTTTGTGCAGTGTT  150

seq1  GGGAACGAAGCCCCAGGTCTTGCTCACACTAGGCAAGTGCTCTTCTATTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAACGAAGCCCCAGGTCTTGCTCACACTAGGCAAGTGCTCTTCTATTG  200

seq1  AGCCACATCCACAGCTTGTATCTCACATCGGAAGGTCAGTCTGCTCTTGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCACATCCACAGCTTGTATCTCACATCGGAAGGTCAGTCTGCTCTTGT  250

seq1  TACAGACAGCCTGAAGCCCAGATTGCACTTCACTGCCTGCCCTCTCTCCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGACAGCCTGAAGCCCAGATTGCACTTCACTGCCTGCCCTCTCTCCT  300

seq1  TTGAAAGCAGTTCTTTTCTAATGTTCTTTCTAGATTATGAGAATGCAGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAAGCAGTTCTTTTCTAATGTTCTTTCTAGATTATGAGAATGCAGTT  350

seq1  CTGTGCACTTGGTCTAGCCCTACCTTACCTCTCAATACAGCAAAAATGGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGCACTTGGTCTAGCCCTACCTTACCTCTCAATACAGCAAAAATGGT  400

seq1  GAGGCCCAGCCCCCCACATCCAGAGCTAAAATTAGCATTCCTGGCTGGGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCCCAGCCCCCCACATCCAGAGCTAAAATTAGCATTCCTGGCTGGGT  450

seq1  CAGTTTTCTTGCCATTTTAGGGCCCTTCCCTACTCAATGGCTCTCCCTTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTTTTCTTGCCATTTTAGGGCCCTTCCCTACTCAATGGCTCTCCCTTG  500

seq1  TGACTTGAGCTAGTCATGAGACCACCTCCTTCTCACTATCTGGAACCTGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTTGAGCTAGTCATGAGACCACCTCCTTCTCACTATCTGGAACCTGA  550

seq1  TGAACTGGAATGGCTTAGGACACCACCCGGATCTCTGGTCTCTTTAACAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAACTGGAATGGCTTAGGACACCACCCGGATCTCTGGTCTCTTTAACAC  600

seq1  AGCATTTACTGACAGGGCATTTGGTCCGGATCAGACACTGACTCTAGCCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATTTACTGACAGGGCATTTGGTCCGGATCAGACACTGACTCTAGCCT  650

seq1  AGATGGAGGGAAGTTTATTAATTGCTTACAGGGTGCCTTCTGGGGTTCAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGGAGGGAAGTTTATTAATTGCTTACAGGGTGCCTTCTGGGGTTCAT  700

seq1  CAGAAGTACTGGGCATGAGAGGAACGTGCCTGTGAGCTACCATAGGCACC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAGTACTGGGCATGAGAGGAACGTGCCTGTGAGCTACCATAGGCACC  750

seq1  ACTGTCCTTGTGGCTGTGTTCTCGTCTGTCCCTGCCTCTCTGTGATGCCA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTCCTTGTGGCTGTGTTCTCGTCTGTCCCTGCCTCTCTGTGATGCCA  800

seq1  GACTCTGAGCTCTGTGAAGCGTGACTGAGACAGGGCTGAACCTGGCTCTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCTGAGCTCTGTGAAGCGTGACTGAGACAGGGCTGAACCTGGCTCTG  850

seq1  GGCCTAAGCCCTCATCACCAAAGAAGACCAATCAGTATGCTGGGTTCCTC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTAAGCCCTCATCACCAAAGAAGACCAATCAGTATGCTGGGTTCCTC  900

seq1  CTCCAAACGATGGGAAGGGTTTAGGTGTTCAGAAGAAGAAAGGATGACAG  950
      ||||||||||||||||||| ||||||||||||||| ||||||||||||||
seq2  CTCCAAACGATGGGAAGGG-TTAGGTGTTCAGAAG-AGAAAGGATGACAG  948

seq1  TCCCTCTCCCTCCTGCCCACCACAGTATCAC-ACATTTAGAGTCTGTCAT  999
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  TCCCTCTCCCTCCTGCCCACCACAGTATCACAACATTTAGAGTCTGTCAT  998

seq1  GAGCAGCTGGATGATCCAA-GCAGAATCTACCCTCAACAGCTATCTTTTT  1048
      ||||||||||||||||||| |||||||||||||   ||||||||||||  
seq2  GAGCAGCTGGATGATCCAAGGCAGAATCTACCCCTCACAGCTATCTTT--  1046

seq1  CTTTTTAATTGAAAAAAATTAAAATTTCTTTCCTACAGAATATATTTTGA  1098
       | ||||| ||||||||||  |||||  |||| |||||||   |||||||
seq2  -TCTTTAAATGAAAAAAAT--AAATTCTTTTCTTACAGAAATAATTTTGA  1093

seq1  TC-ACGTTTTTCTCTTCTCCAATTTCTTCCAGATCCTCCTGCCTCCCTC  1146
      || |||||||   ||||||  | ||||||   |||||||||||| ||||
seq2  TCAACGTTTTCTCCTTCTC--AGTTCTTCAGAATCCTCCTGCCTTCCTC  1140

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information