MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-242D11
Chromosome	2 (Build37)
Map Location	90,926,450 - 91,070,224
singlet/doublet	doublet
Overlap gene	Sfpi1, Mybpc3, Madd, Nr1h3, Acp2, Ddb2
Upstream gene	Olfr1267-ps1, Olfr1268-ps1, Olfr1269, Olfr32, LOC100043090, Olfr1270, LOC627525, LOC100043096, Olfr1506, Olfr142, Olfr1271, Olfr1272, Olfr1273, LOC100042690, LOC100043113, LOC668629, GA_x5J8B7W2BV0-3116-4045, Ptprj, 4933423P22Rik, Nup160, Fnbp4, Rpl30-ps3, Agbl2, Mtch2, C1qtnf4, Ndufs3, Kbtbd4, Ptpmt1, Cugbp1, LOC279067, Rapsn, Psmc3, Slc39a13
Downstream gene	Pacsin3, Zfp289, 1110051M20Rik, Lrp4, LOC619941, Ckap5, F2, Zfp408, Arhgap1, D2Ertd391e, LOC100043179, D230010M03Rik, D030051N19Rik, Chrm4, Mdk, Dgkz, Creb3l1, Phf21a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr1267-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258204 MGI:3031101
definition	gene_synonym : MOR228-1 note : olfactory receptor 1267, pseudogene 1 pseudo : _no_value

name	Olfr1268-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258981 MGI:3031102
definition	gene_synonym : MOR229-1 note : olfactory receptor 1268, pseudogene 1 pseudo : _no_value

name	Olfr1269 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258339 MGI:3031103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18331 MGI:109303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043090 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043090
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 2 Proteins

name	Olfr1270 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258987 MGI:3031104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627525 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 3 Proteins

name	LOC100043096 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Olfr1506 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257665 MGI:3031340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr142 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:406186 MGI:2177525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1271 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258789 MGI:3031105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1272 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258982 MGI:3031106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1273 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258977 MGI:3031107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042690 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2357 Proteins

name	LOC100043113 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC668629 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 3 Proteins

name	GA_x5J8B7W2BV0-3116-4045 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ptprj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19271 MGI:104574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933423P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71158 MGI:1918408
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Nup160 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59015 MGI:1926227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fnbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55935 MGI:1860513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl30-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19949 MGI:1321401
definition	gene_synonym : RpL30-4 note : ribosomal protein L30, pseudogene 3 pseudo : _no_value

name	Agbl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271813 MGI:2443254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtch2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56428 MGI:1929260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1qtnf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67445 MGI:1914695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68349 MGI:1915599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kbtbd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67136 MGI:1914386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptpmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66461 MGI:1913711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cugbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13046 MGI:1342295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC279067 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:279067
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins

name	Rapsn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19400 MGI:99422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19182 MGI:1098754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68427 MGI:1915677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfpi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20375 MGI:98282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mybpc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17868 MGI:102844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Madd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228355 MGI:2444672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr1h3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22259 MGI:1352462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11432 MGI:87882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107986 MGI:1355314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pacsin3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80708 MGI:1891410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp289 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77038 MGI:1924288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110051M20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228356 MGI:1915079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228357 MGI:2442252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC619941 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Ckap5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75786 MGI:1923036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14061 MGI:88380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp408 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381410 MGI:2685857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228359 MGI:2445003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D2Ertd391e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51897 MGI:1196429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043179 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	D230010M03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241547 MGI:2443194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D030051N19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228361 MGI:2443564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Chrm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12672 MGI:88399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mdk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17242 MGI:96949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Dgkz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104418 MGI:1278339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Creb3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26427 MGI:1347062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf21a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192285 MGI:2384756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1269 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129617 GeneID:258339 MGI:3031103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1269 transcript_id : NM_146342.1

name	Olfr32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468916 GeneID:18331 MGI:109303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 32 transcript_id : NM_010980.1

name	LOC100043090 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249925 GeneID:100043090
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 2 Proteins product : similar to Crx opposite strand transcript 1 transcript_id : XM_001478712.1

name	Olfr1270 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128966 GeneID:258987 MGI:3031104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1270 transcript_id : NM_146985.1

name	LOC627525 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367098 GeneID:627525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 3 Proteins product : similar to PTPRJ transcript_id : XM_892197.2

name	LOC100043096 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249927 GeneID:100043096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : similar to protein tyrosine phosphatase receptor type J transcript_id : XM_001478719.1

name	Olfr1506 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128630 GeneID:257665 MGI:3031340
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1506 transcript_id : NM_146265.1

name	Olfr142 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22208851 GeneID:406186 MGI:2177525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 142 transcript_id : NM_146984.1

name	Olfr1271 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129262 GeneID:258789 MGI:3031105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1271 transcript_id : NM_146793.1

name	Olfr1272 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128968 GeneID:258982 MGI:3031106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1272 transcript_id : NM_146980.1

name	Olfr1273 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128976 GeneID:258977 MGI:3031107
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1273 transcript_id : NM_146975.1

name	LOC100042690 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249892 GeneID:100042690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2357 Proteins product : similar to olfactory receptor 1506 transcript_id : XM_001478640.1

name	LOC100043113 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249930 GeneID:100043113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : similar to protein tyrosine phosphatase receptor type J transcript_id : XM_001478727.1

name	LOC668629 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249894 GeneID:668629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 3 Proteins product : similar to PTPRJ transcript_id : XM_001002717.2

name	GA_x5J8B7W2BV0-3116-4045 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:22128628 GeneID:257663
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor GA_x5J8B7W2BV0-3116-4045 transcript_id : NM_146263.1

name	Ptprj (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115648014 GeneID:19271 MGI:104574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, J transcript_id : NM_008982.4

name	4933423P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249935 GeneID:71158 MGI:1918408
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 4933423P22 gene transcript_id : XM_001478748.1

name	Nup160 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130462 GeneID:59015 MGI:1926227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 160 transcript_id : NM_021512.2

name	Fnbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130721 GeneID:55935 MGI:1860513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin binding protein 4 transcript_id : NM_018828.2

name	Agbl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370920 GeneID:271813 MGI:2443254
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP/GTP binding protein-like 2 transcript_id : NM_178755.2

name	Mtch2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46909582 GeneID:56428 MGI:1929260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial carrier homolog 2 (C. elegans) transcript_id : NM_019758.2

name	C1qtnf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378034 GeneID:67445 MGI:1914695
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C1q and tumor necrosis factor related protein 4 transcript_id : NM_026161.2

name	Ndufs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801183 GeneID:68349 MGI:1915599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) Fe-S protein 3 transcript_id : NM_026688.2

name	Kbtbd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368494 GeneID:67136 MGI:1914386
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch repeat and BTB (POZ) domain containing 4 transcript_id : NM_025991.2

name	Ptpmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121247409 GeneID:66461 MGI:1913711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, mitochondrial 1 transcript_id : NM_025576.2

name	Cugbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38570085 GeneID:13046 MGI:1342295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CUG triplet repeat, RNA binding protein 1 transcript_id : NM_017368.2

name	Cugbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38570083 GeneID:13046 MGI:1342295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CUG triplet repeat, RNA binding protein 1 transcript_id : NM_198683.1

name	LOC279067 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367097 GeneID:279067
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein product : similar to acidic ribosomal phosphoprotein P1, transcript variant 2 transcript_id : XM_895931.2

name	LOC279067 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367096 GeneID:279067
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 7 Proteins product : similar to acidic ribosomal phosphoprotein P1, transcript variant 1 transcript_id : XM_205095.5

name	Rapsn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348284 GeneID:19400 MGI:99422
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor-associated protein of the synapse transcript_id : NM_009023.2

name	Psmc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679502 GeneID:19182 MGI:1098754
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, ATPase 3 transcript_id : NM_008948.1

name	Slc39a13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369701 GeneID:68427 MGI:1915677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (metal ion transporter), member 13 transcript_id : NM_026721.2

name	Sfpi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755473 GeneID:20375 MGI:98282
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SFFV proviral integration 1 transcript_id : NM_011355.1

name	Mybpc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031946 GeneID:17868 MGI:102844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin binding protein C, cardiac transcript_id : NM_008653.2

name	Madd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647239 GeneID:228355 MGI:2444672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP-kinase activating death domain transcript_id : NM_145527.3

name	Nr1h3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374866 GeneID:22259 MGI:1352462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 1, group H, member 3 transcript_id : NM_013839.3

name	Acp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29150252 GeneID:11432 MGI:87882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acid phosphatase 2, lysosomal transcript_id : NM_007387.1

name	Ddb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363643 GeneID:107986 MGI:1355314
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : damage specific DNA binding protein 2 transcript_id : NM_028119.3

name	Pacsin3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13559517 GeneID:80708 MGI:1891410
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C and casein kinase substrate in neurons 3 transcript_id : NM_030880.1

name	Pacsin3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803499 GeneID:80708 MGI:1891410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C and casein kinase substrate in neurons 3 transcript_id : NM_028733.2

name	Zfp289 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963846 GeneID:77038 MGI:1924288
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 289 transcript_id : NM_023854.1

name	1110051M20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803506 GeneID:228356 MGI:1915079
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110051M20 gene transcript_id : NM_175123.3

name	Lrp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27883855 GeneID:228357 MGI:2442252
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : low density lipoprotein receptor-related protein 4 transcript_id : NM_172668.2

name	LOC619941 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367103 GeneID:619941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to CGI-140 protein transcript_id : XM_884324.2

name	Ckap5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66955861 GeneID:75786 MGI:1923036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytoskeleton associated protein 5 transcript_id : NM_029437.1

name	F2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129932 GeneID:14061 MGI:88380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coagulation factor II transcript_id : NM_010168.2

name	Zfp408 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364558 GeneID:381410 MGI:2685857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 408 transcript_id : NM_001033451.2

name	Arhgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803553 GeneID:228359 MGI:2445003
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 1 transcript_id : NM_146124.3

name	D2Ertd391e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130154 GeneID:51897 MGI:1196429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 2, ERATO Doi 391, expressed transcript_id : NM_145528.2

name	LOC100043179 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249943 GeneID:100043179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : hypothetical protein LOC100043179 transcript_id : XM_001479237.1

name	D230010M03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379648 GeneID:241547 MGI:2443194
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D230010M03 gene transcript_id : NM_178724.3

name	D030051N19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124053444 GeneID:228361 MGI:2443564
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D030051N19 gene transcript_id : NM_172669.3

name	D030051N19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124053442 GeneID:228361 MGI:2443564
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D030051N19 gene transcript_id : NM_001080754.1

name	Chrm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680939 GeneID:12672 MGI:88399
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, muscarinic 4 transcript_id : NM_007699.1

name	Mdk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59894793 GeneID:17242 MGI:96949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : midkine transcript_id : NM_010784.4

name	Mdk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59894787 GeneID:17242 MGI:96949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : midkine transcript_id : NM_001012336.1

name	Mdk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59894789 GeneID:17242 MGI:96949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : midkine transcript_id : NM_001012335.1

name	Dgkz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794243 GeneID:104418 MGI:1278339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol kinase zeta transcript_id : NM_138306.1

name	Creb3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606376 GeneID:26427 MGI:1347062
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cAMP responsive element binding protein 3-like 1 transcript_id : NM_011957.2

name	Phf21a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270290 GeneID:192285 MGI:2384756
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 21A transcript_id : NM_138755.1

name	Olfr1269 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129618 CCDS:CCDS16406.1 GeneID:258339 MGI:3031103
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51551618-51550689; olfactory receptor MOR228-3 product : olfactory receptor 1269 protein_id : NP_666454.1

name	Olfr32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468917 CCDS:CCDS16407.1 GeneID:18331 MGI:109303
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR227-7P; GA_x6K02T2Q125-51573576-51572650 product : olfactory receptor 32 protein_id : NP_035110.1

name	LOC100043090 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249926 GeneID:100043090
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478762.1

name	Olfr1270 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128967 CCDS:CCDS16408.1 GeneID:258987 MGI:3031104
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51584440-51583526; olfactory receptor MOR227-1 product : olfactory receptor 1270 protein_id : NP_667196.1

name	LOC627525 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82886469 GeneID:627525
definition	codon_start : 1 product : similar to PTPRJ protein_id : XP_897290.1

name	LOC100043096 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249928 GeneID:100043096
definition	codon_start : 1 product : similar to protein tyrosine phosphatase receptor type J protein_id : XP_001478769.1

name	Olfr1506 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128631 CCDS:CCDS16409.1 GeneID:257665 MGI:3031340
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x5J8B7W1PMD-3116-4045; GA_x6K02T2RJGU-1819-2748 product : olfactory receptor 1506 protein_id : NP_666377.1

name	Olfr142 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208852 CCDS:CCDS16410.1 GeneID:406186 MGI:2177525
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51607674-51606757 product : olfactory receptor 142 protein_id : NP_667195.1

name	Olfr1271 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129263 CCDS:CCDS16411.1 GeneID:258789 MGI:3031105
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51620802-51619885; olfactory receptor MOR227-5 product : olfactory receptor 1271 protein_id : NP_667004.1

name	Olfr1272 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128969 CCDS:CCDS16412.1 GeneID:258982 MGI:3031106
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51636504-51635578; olfactory receptor MOR227-3 product : olfactory receptor 1272 protein_id : NP_667191.1

name	Olfr1273 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128977 GeneID:258977 MGI:3031107
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-51650793-51649870; olfactory receptor MOR227-4 product : olfactory receptor 1273 protein_id : NP_667186.1

name	LOC100042690 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249893 GeneID:100042690
definition	codon_start : 1 product : similar to olfactory receptor 1506 protein_id : XP_001478690.1

name	LOC100043113 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249931 GeneID:100043113
definition	codon_start : 1 product : similar to protein tyrosine phosphatase receptor type J protein_id : XP_001478777.1

name	LOC668629 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249895 GeneID:668629
definition	codon_start : 1 product : similar to PTPRJ protein_id : XP_001002717.2

name	GA_x5J8B7W2BV0-3116-4045 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:22128629 GeneID:257663
definition	codon_start : 1 exception : mismatches in translation product : olfactory receptor GA_x5J8B7W2BV0-3116-4045 protein_id : NP_666375.1

name	Ptprj (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490379 GeneID:19271 MGI:104574
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA]; GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 note : colon tumor susceptibility 1 product : protein tyrosine phosphatase, receptor type, J protein_id : NP_033008.2

name	4933423P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249936 GeneID:71158 MGI:1918408
definition	codon_start : 1 product : hypothetical protein LOC71158 protein_id : XP_001478798.1

name	Nup160 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946932 CCDS:CCDS16413.1 GeneID:59015 MGI:1926227
definition	GO_component : GO:0005643 - nuclear pore [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005487 - nucleocytoplasmic transporter activity [Evidence IDA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : gene trap locus-13; gene trap locus 1-13; nucleoporin 160kDa product : nucleoporin 160 protein_id : NP_067487.1

name	Fnbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055220 CCDS:CCDS16414.1 GeneID:55935 MGI:1860513
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : formin binding protein 30 product : formin binding protein 4 protein_id : NP_061298.1

name	Agbl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520209 GeneID:271813 MGI:2443254
definition	GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : carboxypeptidase 2, cytosolic product : ATP/GTP binding protein-like 2 protein_id : NP_848870.1

name	Mtch2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790055 CCDS:CCDS16416.1 GeneID:56428 MGI:1929260
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : mitochondrial carrier homolog 2 protein_id : NP_062732.1

name	C1qtnf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385666 CCDS:CCDS16417.1 GeneID:67445 MGI:1914695
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : C1q and tumor necrosis factor related protein 4 protein_id : NP_080437.1

name	Ndufs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037117 CCDS:CCDS16418.1 GeneID:68349 MGI:1915599
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016651 - oxidoreductase activity, acting on NADH or NADPH [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : NADH dehydrogenase (ubiquinone) Fe-S protein 3 (30kD) (NADH-coenzyme Q reductase) product : NADH dehydrogenase (ubiquinone) Fe-S protein 3 protein_id : NP_080964.1

name	Kbtbd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385496 CCDS:CCDS16419.1 GeneID:67136 MGI:1914386
definition	codon_start : 1 product : kelch repeat and BTB (POZ) domain containing 4 protein_id : NP_080267.1

name	Ptpmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956130 GeneID:66461 MGI:1913711
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004439 - phosphoinositide 5-phosphatase activity [Evidence IDA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0046488 - phosphatidylinositol metabolism [Evidence IC]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : PTEN-like phosphatase protein_id : NP_079852.1

name	Cugbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38570086 CCDS:CCDS16420.1 GeneID:13046 MGI:1342295
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence ISS]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0042835 - BRE binding [Evidence ISS]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0000900 - translation repressor activity, nucleic acid binding [Evidence ISS] GO_process : GO:0009790 - embryonic development [Evidence ISS]; GO:0007281 - germ cell development [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006376 - mRNA splice site selection [Evidence IDA]; GO:0016246 - RNA interference [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : CUG triplet repeat, RNA-binding protein 1 isoform 1 protein_id : NP_059064.2

name	Cugbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38570084 CCDS:CCDS16421.1 GeneID:13046 MGI:1342295
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence ISS]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0042835 - BRE binding [Evidence ISS]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0000900 - translation repressor activity, nucleic acid binding [Evidence ISS] GO_process : GO:0009790 - embryonic development [Evidence ISS]; GO:0007281 - germ cell development [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006376 - mRNA splice site selection [Evidence IDA]; GO:0016246 - RNA interference [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : CUG triplet repeat, RNA-binding protein 1 isoform 2 protein_id : NP_941955.1

name	LOC279067 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82886481 GeneID:279067
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 isoform 2 protein_id : XP_901024.1

name	LOC279067 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82886483 GeneID:279067
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 isoform 1 protein_id : XP_205095.3

name	Rapsn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677669 CCDS:CCDS16422.1 GeneID:19400 MGI:99422
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : receptor-associated protein of the synapse, 43 kDa; 43kDa acetylcholine receptor-associated protein product : receptor-associated protein of the synapse protein_id : NP_033049.1

name	Psmc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679503 CCDS:CCDS16423.1 GeneID:19182 MGI:1098754
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005829 - cytosol [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Tat binding protein 1 product : proteasome (prosome, macropain) 26S subunit, ATPase 3 protein_id : NP_032974.1

name	Slc39a13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037119 CCDS:CCDS16424.1 GeneID:68427 MGI:1915677
definition	codon_start : 1 product : solute carrier family 39 (metal ion transporter), member 13 protein_id : NP_080997.1

name	Sfpi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755474 CCDS:CCDS16425.1 GeneID:20375 MGI:98282
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0030851 - granulocyte differentiation [Evidence IDA]; GO:0030098 - lymphocyte differentiation [Evidence IDA]; GO:0030225 - macrophage differentiation [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : hematopoietic transcription factor PU.1 protein_id : NP_035485.1

name	Mybpc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031947 GeneID:17868 MGI:102844
definition	GO_component : GO:0005856 - cytoskeleton [Evidence TAS]; GO:0005863 - striated muscle thick filament [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005200 - structural constituent of cytoskeleton [Evidence TAS] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006936 - muscle contraction [Evidence IPI]; GO:0006941 - striated muscle contraction [Evidence IEA] codon_start : 1 note : cardinc C-protein; cardiac C-protein product : myosin binding protein C, cardiac protein_id : NP_032679.2

name	Madd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647240 GeneID:228355 MGI:2444672
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 note : Rab3 GDP/GTP exchange protein; insulinoma-glucagonoma protein 20 product : MAP-kinase activating death domain protein_id : NP_663502.3

name	Nr1h3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625616 CCDS:CCDS16426.1 GeneID:22259 MGI:1352462
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004884 - ecdysteroid hormone receptor activity [Evidence IEA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IMP]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0044255 - cellular lipid metabolism [Evidence IDA]; GO:0016481 - negative regulation of transcription [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : ubiquitously-expressed nuclear receptor 1; LXR alpha; nuclear receptor subfamily 1 group H member 3 product : nuclear receptor subfamily 1, group H, member 3 protein_id : NP_038867.2

name	Acp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29150253 CCDS:CCDS16427.1 GeneID:11432 MGI:87882
definition	EC_number : 3.1.3.2 GO_component : GO:0005764 - lysosome [Evidence ISS] [Evidence IEA] GO_function : GO:0003993 - acid phosphatase activity [Evidence IDA] [Evidence IMP]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007040 - lysosome organization and biogenesis [Evidence IMP]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 note : acid phosphatase 2 lysosomal product : acid phosphatase 2, lysosomal protein_id : NP_031413.1

name	Ddb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29150251 CCDS:CCDS16428.1 GeneID:107986 MGI:1355314
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006290 - pyrimidine dimer repair [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : damage specific DNA binding protein 2 protein_id : NP_082395.2

name	Pacsin3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077027 CCDS:CCDS16429.1 GeneID:80708 MGI:1891410
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005802 - Golgi trans face [Evidence IDA] GO_function : GO:0008092 - cytoskeletal protein binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0045806 - negative regulation of endocytosis [Evidence IDA] codon_start : 1 product : protein kinase C and casein kinase substrate in neurons 3 protein_id : NP_083009.1

name	Pacsin3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13559518 CCDS:CCDS16429.1 GeneID:80708 MGI:1891410
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005802 - Golgi trans face [Evidence IDA] GO_function : GO:0008092 - cytoskeletal protein binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0045806 - negative regulation of endocytosis [Evidence IDA] codon_start : 1 exception : mismatches in translation product : protein kinase C and casein kinase substrate in neurons 3 protein_id : NP_112019.1

name	Zfp289 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963847 CCDS:CCDS16430.1 GeneID:77038 MGI:1924288
definition	GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 289 protein_id : NP_076343.1

name	1110051M20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29126243 CCDS:CCDS16431.1 GeneID:228356 MGI:1915079
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC228356 protein_id : NP_780332.1

name	Lrp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27883856 CCDS:CCDS16432.1 GeneID:228357 MGI:2442252
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0042733 - embryonic digit morphogenesis [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0006897 - endocytosis [Evidence IEA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IDA] codon_start : 1 exception : mismatches in translation note : LDLR dan product : low density lipoprotein receptor-related protein 4 protein_id : NP_766256.2

name	LOC619941 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367104 GeneID:619941
definition	codon_start : 1 product : similar to CGI-140 protein protein_id : XP_889417.2

name	Ckap5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66955862 CCDS:CCDS16433.1 GeneID:75786 MGI:1923036
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0043021 - ribonucleoprotein binding [Evidence ISS] GO_process : GO:0051300 - spindle pole body organization and biogenesis [Evidence ISS] codon_start : 1 exception : mismatches in translation product : cytoskeleton associated protein 5 protein_id : NP_083713.1

name	F2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753798 CCDS:CCDS16434.1 GeneID:14061 MGI:88380
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0003809 - thrombin activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0007596 - blood coagulation [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : prothrombin product : coagulation factor II protein_id : NP_034298.1

name	Zfp408 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626129 CCDS:CCDS16436.1 GeneID:381410 MGI:2685857
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 408 protein_id : NP_001028623.1

name	Arhgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981892 CCDS:CCDS16437.1 GeneID:228359 MGI:2445003
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0030675 - Rac GTPase activator activity [Evidence IDA]; GO:0005100 - Rho GTPase activator activity [Evidence ISS] [Evidence IDA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence ISS] codon_start : 1 exception : mismatches in translation product : Rho GTPase activating protein 1 protein_id : NP_666236.2

name	D2Ertd391e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704040 CCDS:CCDS16438.1 GeneID:51897 MGI:1196429
definition	codon_start : 1 product : hypothetical protein LOC51897 protein_id : NP_663503.1

name	LOC100043179 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249944 GeneID:100043179
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479287.1

name	D230010M03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520149 GeneID:241547 MGI:2443194
definition	codon_start : 1 product : hypothetical protein LOC241547 protein_id : NP_848839.1

name	D030051N19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124053445 GeneID:228361 MGI:2443564
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC228361 isoform 1 protein_id : NP_766257.3

name	D030051N19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124053443 GeneID:228361 MGI:2443564
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC228361 isoform 2 protein_id : NP_001074223.1

name	Chrm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680940 CCDS:CCDS16439.1 GeneID:12672 MGI:88399
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : AChR M4; muscarinic acetylcholine receptor 4 product : cholinergic receptor, muscarinic 4 protein_id : NP_031725.1

name	Mdk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59894790 CCDS:CCDS16440.1 GeneID:17242 MGI:96949
definition	GO_function : GO:0008083 - growth factor activity [Evidence ISS] [Evidence IEA]; GO:0008201 - heparin binding [Evidence ISS] [Evidence IEA] GO_process : GO:0030325 - adrenal gland development [Evidence ISS]; GO:0030154 - cell differentiation [Evidence IEA] [Evidence ISS]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0009611 - response to wounding [Evidence IDA] codon_start : 1 product : midkine protein_id : NP_001012335.1

name	Mdk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59894788 CCDS:CCDS16440.1 GeneID:17242 MGI:96949
definition	GO_function : GO:0008083 - growth factor activity [Evidence ISS] [Evidence IEA]; GO:0008201 - heparin binding [Evidence ISS] [Evidence IEA] GO_process : GO:0030325 - adrenal gland development [Evidence ISS]; GO:0030154 - cell differentiation [Evidence IEA] [Evidence ISS]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0009611 - response to wounding [Evidence IDA] codon_start : 1 product : midkine protein_id : NP_001012336.1

name	Mdk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754668 CCDS:CCDS16440.1 GeneID:17242 MGI:96949
definition	GO_function : GO:0008083 - growth factor activity [Evidence ISS] [Evidence IEA]; GO:0008201 - heparin binding [Evidence ISS] [Evidence IEA] GO_process : GO:0030325 - adrenal gland development [Evidence ISS]; GO:0030154 - cell differentiation [Evidence IEA] [Evidence ISS]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0009611 - response to wounding [Evidence IDA] codon_start : 1 product : midkine protein_id : NP_034914.1

name	Dgkz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794244 CCDS:CCDS16441.1 GeneID:104418 MGI:1278339
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : diacylglycerol kinase zeta protein_id : NP_612179.1

name	Creb3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606377 GeneID:26427 MGI:1347062
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IEA] codon_start : 1 note : BBF-2 (drosophila) homolog; old astrocyte specifically induced substance product : cAMP responsive element binding protein 3-like 1 protein_id : NP_036087.2

name	Phf21a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270291 CCDS:CCDS16442.1 GeneID:192285 MGI:2384756
definition	GO_component : GO:0000118 - histone deacetylase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0001967 - suckling behavior [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; Braf35/HDAC complex (Bhc); BRAF35/HDAC2 complex product : PHD finger protein 21A isoform 1 protein_id : NP_620094.1

clone name	MSMg01-295H24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-536G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237C20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139O08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-358A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-184P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301J10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-475F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535N21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-349J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165P13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-242D11.b	B6Ng01-242D11.g
ACC	GA051920	GA051921
length	1,111	1,117
definition	B6Ng01-242D11.b	B6Ng01-242D11.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(91,069,107 - 91,070,224)	(90,926,450 - 90,927,573)
sequence	gaattccagcaagagattttcatttccccaggaatctaggacacaggaat agagaaatacagttatgcctggaggtggtaaagagcctgaaatattctag ggaacagcatcatgatgaaaaggagaaagacagctgctttgagtttgtgc cagaccgagctgcttttgtttttgcacactccacccctcagttttgtaga agagggtgctgaagggctccacatagctaagcatacttctgttcctgagc catacaccatatcgccctatattacctcttcttatactgttatatatgta tattatatatgctgtgtattatattacatgcatagaactgaagtttcctt acactgccatggagattggtttgagcattgagttttgtgcttcacaggaa gctagcttggggcagagagcaggtatgctggtatagaggactttgtttac cccagatgttgataggaagttggcttgagaacagttacaggaaacagtag ggccatggtttgtaacttttgtcatctgatcttggctttggtcttgacat ctttcaaatccttggtgaggtactacacattacattttcaaagtgaaaag atatttaatgaatttttgtaaaatttatgtctgttataaaattcaagtaa tagaagtttaaagatttaagtaaatatccaaaacaatccattttaaacat ttctctggacacatccatttttctcttcagtattgctacacaaatattct atcatagattgttgtgcttaacttatgtcaaatatgtatgttttatacac tagtacccaggttagccttgaactcactatgtaaggatgatcttgaactg tttgtttgtttgtttgtttgtttgagacagggttttctctgtgtagccct ggctgtcctggaactcactctgtagaccaggctggccttgaactcacaag gagatccacctgcctttgtctcttcagtgctgtgattaagggcatacact gccactgcctggcctgatcttgaacttttgatcactgtctcacctggatt acaagtgcgtcaacatctcgttcttatctctattcgtcatcattgtccac ttttgatttag	gaattccttaccaacctaccgaggccctcagacacaccatagggtatgtg tcagacacaccgggcccggcctggcagctcctcacctgcctcctctttcc agagcctgaacagaaccagcggccaggtctcctggttcacaatacccttg ccagccccacccgggcaggcatctgctcccaggctccagccccctttgtc ctctgctctgaaaagcaccgtttcccttttctgggtgaccacacaccatg cacagggaatttccattgtagcctgcggagtgtctgattcactcaggccc ctcacaaagttaactccttgcaggtccaacacagtaggctgtctcccacc caatcttgggtagctgtgtactgaccttaggccccatagaaaggaacttg agctcagaaactccacttagctcccctcattcatcccaaaaccctgacca tgcaccctcaggcagtttcccagacatcgagggattggaggggaggcaaa catgcccctttctacctgtgtggcctgaaatgagcccatggcttacctat aaagcagaagcaattcctgtctgtagtcttactgaaaaggcaagtgtgct gggcccacagtaagagctctttattagttttctatctttttaaagagccc actactctgatcggggtctccgctcaagaccaggtcctctgggctggctc tctctttctgagagcagagggctcagagacattgcctttgagttggtggg gacctgaagagaaaagcatctcacagcccttcttttccaatcctctgact tcttttctcggaagctcttaagggactgaggactaagcaagatgctgagt tctggagacgggactgtcttcttccccagattgagatgccaggcatgtgt gtctcacacagactctgtgcctactacctcagttagccttgagaaatccc ccacctccatttccagaggtatcttctatatgctcctatctggggacaaa gagctgagtcctagagtgggttcctggctctcagtgtgaagaatattagg tatatgagtcacacttgcagttcacaagaaagcaacttgcgaggccaatg agaggccaatactaagt
quality values	Open. Hide. 58 22 28 26 58 58 41 18 58 47 62 54 62 49 47 24 26 62 62 62 41 29 62 62 62 62 62 62 54 47 56 42 44 30 43 56 44 43 32 49 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 54 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 54 54 62 62 58 58 58 54 52 58 58 58 58 58 58 58 58 54 54 58 54 41 58 52 54 54 58 58 54 58 58 54 58 54 58 58 58 58 58 58 58 58 46 58 58 58 58 58 58 58 58 58 54 58 50 54 52 58 58 58 58 46 58 58 54 50 58 58 58 58 58 52 52 58 58 54 42 58 52 54 54 58 51 54 58 46 51 49 51 53 47 58 58 54 51 58 53 50 51 58 54 53 51 51 51 50 58 58 49 53 58 49 53 58 52 53 45 24 58 47 47 58 58 54 49 58 44 50 51 58 48 28 20 51 58 58 51 46 54 51 58 39 40 58 58 58 46 51 58 40 48 37 50 58 48 49 51 49 50 51 58 51 41 50 52 42 54 40 44 35 51 58 58 58 54 41 53 53 39 39 50 52 39 39 39 49 43 50 50 47 37 50 42 41 26 58 50 52 41 37 54 53 39 53 52 52 34 53 53 34 53 34 41 54 38 39 51 42 53 42 53 53 33 37 37 44 50 47 31 46 40 30 49 54 49 39 45 41 51 37 40 37 51 47 54 36 31 52 38 32 39 32 47 42 53 29 30 34 37 54 47 37 32 53 32 37 45 28 23 44 30 32 32 36 32 31 45 33 35 37 32 32 31 53 23 18 39 24 53 30 25 29 32 23 33 20 33 24 47 32 31 32 53 34 52 32 51 31 51 32 27 28 51 32 33 28 46 27 32 18 46 29 42 38 51 43 31 42 14 31 24 31 25 46 31 13 51 45 25 31 31 30 15 31 29 42 24 32 23 24 29 18 13 16 30 34 31 38 34 32 29 27 20 46 33 31 34 34 34 32 31 42 31 25 24 8 10 23 27 30 23 25 25 25 18 28 35 36 6 20 30 41 38 29 31 23 31 19 9 8 5 13 33 18 41 10 30 18 25 19 20 29 24 18 13 9 33 9 44 22 26 32 34 23 7 5 26 32 22 34 22 37 19 10 17 8 29 31 26 27 17 31 9 44 21 11 32 24 25 28 10 19 21 29 25 32 16 32 17 11 25 19 32 20 27 13 11 17 14 37 22 22 8 29 32 25 17 12 12 43 39 33 29 12 8 28 9 25 6 14 8 5 6 8 18 11 18 12 12 11 3 9 14 12 10 8 24 16 5 22 28 26 17 20 7 6 5 5 3 5 10 9 3 3 6 3 4 3 3 31 4 4 5 5 8 7 5 8 16 18 8 11 15 20 13 25 9 16 5 12 8 9 17 13 28 28 21 22 5 23 28 17 13 5	Open. Hide. 62 47 42 47 62 62 62 62 62 62 30 27 18 18 27 25 28 28 28 28 38 43 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 51 49 56 28 35 34 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 49 49 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 38 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 54 53 58 58 58 58 58 58 49 58 58 58 58 58 58 54 58 58 58 58 58 58 54 42 58 58 58 54 52 58 58 58 54 54 33 58 58 52 58 51 48 54 58 54 52 54 58 58 52 58 58 51 54 40 58 58 58 58 51 46 58 58 58 58 58 48 42 49 35 54 58 49 58 58 53 58 51 58 58 58 58 49 58 51 50 50 50 41 42 47 58 53 58 52 58 58 53 53 58 58 51 53 49 47 41 48 58 49 44 54 52 52 51 54 54 58 58 58 41 31 58 58 37 49 42 43 49 43 52 47 54 52 51 58 53 54 58 51 50 51 47 58 58 58 52 50 53 52 58 50 58 54 53 32 49 42 49 29 50 52 50 43 50 50 58 51 54 41 54 46 54 44 45 54 49 27 49 39 51 49 53 53 54 54 16 34 52 45 52 19 49 24 45 45 24 53 23 49 44 32 53 40 42 31 46 23 37 42 32 47 44 42 42 44 33 54 47 39 41 29 47 35 45 33 34 51 54 54 54 46 27 28 39 44 51 47 24 35 23 53 49 49 53 40 53 34 33 42 45 40 34 40 33 40 53 49 51 32 52 32 31 49 49 31 32 32 32 31 32 30 47 32 30 31 31 31 23 29 45 31 31 51 51 45 31 31 36 20 24 42 42 29 31 35 36 51 43 33 33 39 51 45 41 19 31 31 33 19 31 27 18 30 21 42 21 33 24 31 33 22 18 31 32 32 32 31 17 30 30 34 31 27 31 33 16 31 12 13 32 20 21 23 32 30 26 31 29 31 27 19 21 32 39 32 29 31 22 43 31 31 37 42 33 32 21 36 29 27 24 31 39 26 35 32 36 34 35 32 33 27 23 14 23 31 29 18 21 27 31 26 25 34 33 31 38 31 20 20 18 31 31 31 26 31 29 21 15 28 32 16 18 30 32 13 21 14 10 23 20 24 19 30 34 15 14 27 37 34 34 13 13 13 24 16 17 32 17 16 34 9 30 20 12 22 34 10 22 25 24 31 20 6 16 16 19 8 25 9 6 4 14 26 18 17 19 20 25 19 12 19 40 34 18 10 8 9 40 14 13 23 7 11 6 15 23 25 12 14 12 8 24 6 16 8 6 10 29 24 6 13 8 16 10 10 15 16 18 19 19 24 20 6 13 7 12 11 17 8 7 8 16 6 24 11 9 16 12 16 9 16 20 2 1 5 3 4 10 20 10 10 5 15 5 7 6 17 7 14 5 8 11 6 6 4 7 8 21 26 17 11 9 7 8 11 5 6 7 8 4 15 3 3 10 6 8 11 6 3 5 2 3 3 7 2 2 2 4 6 5 10 16 6 8 4 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_91069107_91070224
seq2: B6Ng01-242D11.b_47_1157 (reverse)

seq1  CTAAAACAAAAGGTGACAATGATGACGATAAGAAAGAAAAAAGAAAAGAG  50
      ||||| ||||||  ||||||||||||||    | ||| | ||| || |||
seq2  CTAAATCAAAAGTGGACAATGATGACGA----ATAGAGATAAG-AACGAG  45

seq1  AATTGTGGACGCACTTGTAATCCCAGGTGAGACAGGTGGATCAAAAGTTC  100
      |  ||| |||||||||||||| |||||||||||||   ||||||||||||
seq2  A--TGTTGACGCACTTGTAAT-CCAGGTGAGACAG--TGATCAAAAGTTC  90

seq1  AAGATCA-GCCAGGCAGTGGCAGTGTATGCCTTTAATCACAGCACTGAAG  149
      ||||||| ||||||||||||||||||||||| ||||||||||||||||||
seq2  AAGATCAGGCCAGGCAGTGGCAGTGTATGCCCTTAATCACAGCACTGAAG  140

seq1  AGACAAAGGCAGGTGGATCTCC-TGTGAGTTCAAGGCCAGCCTGGTCTAC  198
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  AGACAAAGGCAGGTGGATCTCCTTGTGAGTTCAAGGCCAGCCTGGTCTAC  190

seq1  AGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAG-AAACCCTGTCTCAA  247
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  AGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAAACCCTGTCTCAA  240

seq1  ACAAACAAACAAACAAACAAACAGTTCAAGATCATCCTTACATAGTGAGT  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACAAACAAACAAACAAACAGTTCAAGATCATCCTTACATAGTGAGT  290

seq1  TCAAGGCTAACCTGGGTACTAGTGTATAAAACATACATATTTGACATAAG  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGGCTAACCTGGGTACTAGTGTATAAAACATACATATTTGACATAAG  340

seq1  TTAAGCACAACAATCTATGATAGAATATTTGTGTAGCAATACTGAAGAGA  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAGCACAACAATCTATGATAGAATATTTGTGTAGCAATACTGAAGAGA  390

seq1  AAAATGGATGTGTCCAGAGAAATGTTTAAAATGGATTGTTTTGGATATTT  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATGGATGTGTCCAGAGAAATGTTTAAAATGGATTGTTTTGGATATTT  440

seq1  ACTTAAATCTTTAAACTTCTATTACTTGAATTTTATAACAGACATAAATT  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTAAATCTTTAAACTTCTATTACTTGAATTTTATAACAGACATAAATT  490

seq1  TTACAAAAATTCATTAAATATCTTTTCACTTTGAAAATGTAATGTGTAGT  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACAAAAATTCATTAAATATCTTTTCACTTTGAAAATGTAATGTGTAGT  540

seq1  ACCTCACCAAGGATTTGAAAGATGTCAAGACCAAAGCCAAGATCAGATGA  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTCACCAAGGATTTGAAAGATGTCAAGACCAAAGCCAAGATCAGATGA  590

seq1  CAAAAGTTACAAACCATGGCCCTACTGTTTCCTGTAACTGTTCTCAAGCC  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAGTTACAAACCATGGCCCTACTGTTTCCTGTAACTGTTCTCAAGCC  640

seq1  AACTTCCTATCAACATCTGGGGTAAACAAAGTCCTCTATACCAGCATACC  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTCCTATCAACATCTGGGGTAAACAAAGTCCTCTATACCAGCATACC  690

seq1  TGCTCTCTGCCCCAAGCTAGCTTCCTGTGAAGCACAAAACTCAATGCTCA  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCTCTGCCCCAAGCTAGCTTCCTGTGAAGCACAAAACTCAATGCTCA  740

seq1  AACCAATCTCCATGGCAGTGTAAGGAAACTTCAGTTCTATGCATGTAATA  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCAATCTCCATGGCAGTGTAAGGAAACTTCAGTTCTATGCATGTAATA  790

seq1  TAATACACAGCATATATAATATACATATATAACAGTATAAGAAGAGGTAA  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATACACAGCATATATAATATACATATATAACAGTATAAGAAGAGGTAA  840

seq1  TATAGGGCGATATGGTGTATGGCTCAGGAACAGAAGTATGCTTAGCTATG  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGGGCGATATGGTGTATGGCTCAGGAACAGAAGTATGCTTAGCTATG  890

seq1  TGGAGCCCTTCAGCACCCTCTTCTACAAAACTGAGGGGTGGAGTGTGCAA  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGCCCTTCAGCACCCTCTTCTACAAAACTGAGGGGTGGAGTGTGCAA  940

seq1  AAACAAAAGCAGCTCGGTCTGGCACAAACTCAAAGCAGCTGTCTTTCTCC  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAAAAGCAGCTCGGTCTGGCACAAACTCAAAGCAGCTGTCTTTCTCC  990

seq1  TTTTCATCATGATGCTGTTCCCTAGAATATTTCAGGCTCTTTACCACCTC  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCATCATGATGCTGTTCCCTAGAATATTTCAGGCTCTTTACCACCTC  1040

seq1  CAGGCATAACTGTATTTCTCTATTCCTGTGTCCTAGATTCCTGGGGAAAT  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCATAACTGTATTTCTCTATTCCTGTGTCCTAGATTCCTGGGGAAAT  1090

seq1  GAAAATCTCTTGCTGGAATTC  1118
      |||||||||||||||||||||
seq2  GAAAATCTCTTGCTGGAATTC  1111

seq1: chr2_90926450_90927573
seq2: B6Ng01-242D11.g_66_1182

seq1  GAATTCCTTACCAACCTACCGAGGCCCTCAGACACACCATAGGGTATGTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTTACCAACCTACCGAGGCCCTCAGACACACCATAGGGTATGTG  50

seq1  TCAGACACACCGGGCCCGGCCTGGCAGCTCCTCACCTGCCTCCTCTTTCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGACACACCGGGCCCGGCCTGGCAGCTCCTCACCTGCCTCCTCTTTCC  100

seq1  AGAGCCTGAACAGAACCAGCGGCCAGGTCTCCTGGTTCACAATACCCTTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCCTGAACAGAACCAGCGGCCAGGTCTCCTGGTTCACAATACCCTTG  150

seq1  CCAGCCCCACCCGGGCAGGCATCTGCTCCCAGGCTCCAGCCCCCTTTGTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCCCCACCCGGGCAGGCATCTGCTCCCAGGCTCCAGCCCCCTTTGTC  200

seq1  CTCTGCTCTGAAAAGCACCGTTTCCCTTTTCTGGGTGACCACACACCATG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGCTCTGAAAAGCACCGTTTCCCTTTTCTGGGTGACCACACACCATG  250

seq1  CACAGGGAATTTCCATTGTAGCCTGCGGAGTGTCTGATTCACTCAGGCCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGGGAATTTCCATTGTAGCCTGCGGAGTGTCTGATTCACTCAGGCCC  300

seq1  CTCACAAAGTTAACTCCTTGCAGGTCCAACACAGTAGGCTGTCTCCCACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACAAAGTTAACTCCTTGCAGGTCCAACACAGTAGGCTGTCTCCCACC  350

seq1  CAATCTTGGGTAGCTGTGTACTGACCTTAGGCCCCATAGAAAGGAACTTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATCTTGGGTAGCTGTGTACTGACCTTAGGCCCCATAGAAAGGAACTTG  400

seq1  AGCTCAGAAACTCCACTTAGCTCCCCTCATTCATCCCAAAACCCTGACCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCAGAAACTCCACTTAGCTCCCCTCATTCATCCCAAAACCCTGACCA  450

seq1  TGCACCCTCAGGCAGTTTCCCAGACATCGAGGGATTGGAGGGGAGGCAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACCCTCAGGCAGTTTCCCAGACATCGAGGGATTGGAGGGGAGGCAAA  500

seq1  CATGCCCCTTTCTACCTGTGTGGCCTGAAATGAGCCCATGGCTTACCTAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCCCCTTTCTACCTGTGTGGCCTGAAATGAGCCCATGGCTTACCTAT  550

seq1  AAAGCAGAAGCAATTCCTGTCTGTAGTCTTACTGAAAAGGCAAGTGTGCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCAGAAGCAATTCCTGTCTGTAGTCTTACTGAAAAGGCAAGTGTGCT  600

seq1  GGGCCCACAGTAAGAGCTCTTTATTAGTTTTCTATCTTTTTAAAGAGCCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCCACAGTAAGAGCTCTTTATTAGTTTTCTATCTTTTTAAAGAGCCC  650

seq1  ACTACTCTGATCGGGGTCTCCGCTCAAGACCAGGTCCTCTGGGCTGGCTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTACTCTGATCGGGGTCTCCGCTCAAGACCAGGTCCTCTGGGCTGGCTC  700

seq1  TCTCTTTCTGAGAGCAGAGGGCTCAGAGACATTGCCTTTGAGTTGGTGGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTTTCTGAGAGCAGAGGGCTCAGAGACATTGCCTTTGAGTTGGTGGG  750

seq1  GACCTGAAGAGAAAAGCATCTCACAGCCCTTCTTTTCCAATCCTCTGACT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTGAAGAGAAAAGCATCTCACAGCCCTTCTTTTCCAATCCTCTGACT  800

seq1  TCTTTTCTCGGAAGCTCTTAAGGGACTGAGGACTAAGCAAGATGCTGAGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTTCTCGGAAGCTCTTAAGGGACTGAGGACTAAGCAAGATGCTGAGT  850

seq1  TCTGGAGACGGGACTGTCTTCTTCCCCAGATTGAGATGCCAGGCATGTGT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGAGACGGGACTGTCTTCTTCCCCAGATTGAGATGCCAGGCATGTGT  900

seq1  GTCTCACACAGACTCTGTGCCTACTACCTCAGTTAGCCTTGAGAAAT-CC  949
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  GTCTCACACAGACTCTGTGCCTACTACCTCAGTTAGCCTTGAGAAATCCC  950

seq1  CCACCTCCATTCCCAGAGGTATCTTCTATTATTGCTCCTATCTGGGGACA  999
      ||||||||||| |||||||||||||||||   ||||||||||||||||||
seq2  CCACCTCCATTTCCAGAGGTATCTTCTAT--ATGCTCCTATCTGGGGACA  998

seq1  AAGAGCCTGAGGTCCCTAGAAGTGGGTTCCTGGCTCTCAGTTGTGAAGAT  1049
      ||||| |||||   ||||| |||||||||||||||||||| |||||||| 
seq2  AAGAG-CTGAG--TCCTAG-AGTGGGTTCCTGGCTCTCAG-TGTGAAGAA  1043

seq1  AATTAGGTATAGGGAGTCACAC-TGCAGGTCAC-AGAAAGC-ACTGGCAG  1096
       ||||||||||  ||||||||| ||||| |||| ||||||| ||| || |
seq2  TATTAGGTATA-TGAGTCACACTTGCAGTTCACAAGAAAGCAACTTGC-G  1091

seq1  AAGCCAATGAAAGAGGCACATACTAAGT  1124
      | |||||||  ||||||  |||||||||
seq2  AGGCCAATG--AGAGGCCAATACTAAGT  1117

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information