MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-244I16
Chromosome	2 (Build37)
Map Location	151,814,787 - 151,960,791
singlet/doublet	doublet
Overlap gene	2310046K01Rik, Scrt2, Srxn1
Upstream gene	4930519N13Rik, LOC668926, Nanp, LOC433486, LOC381390, 4930442J19Rik, LOC100043839, LOC100043840, 4921509C19Rik, Nsfl1c, Fkbp1a, Sdcbp2, Snph, LOC668929, BC052486, 5430405G05Rik, Psmf1, Rspo4, Angpt4, 5430432M24Rik
Downstream gene	Tcf15, LOC100043843, Csnk2a1, Tbc1d20, Rbck1, Trib3, LOC628060, Nrsn2, Sox12, Zcchc3, 6820408C15Rik, EG629114, LOC668930, 9230107O10Rik, 9230002F21Rik, EG654457, OTTMUSG00000015852, Defb29, 4930525K10Rik, Defb19, OTTMUSG00000015859, Defb36, OTTMUSG00000015862, Rem1, H13, Mcts2, Id1, LOC629170, Cox4i2, Bcl2l1, Tpx2, Mylk2, Fkhl18, Dusp15, Ttll9, Pdrg1, Xkr7, BC020535, Hck
Link	Open Mouse BAC browser

Click to get alignment info.

name	4930519N13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78177 MGI:1925427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668926 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins pseudo : _no_value

name	Nanp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67311 MGI:1914561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433486 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 39 Proteins

name	LOC381390 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381390
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 38 Proteins

name	4930442J19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74660 MGI:1921910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100043839 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 140 ESTs, 5 Proteins

name	LOC100043840 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 53 mRNAs, 2805 ESTs, 35 Proteins pseudo : _no_value

name	4921509C19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381393 MGI:2685851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsfl1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:386649 MGI:3042273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14225 MGI:95541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdcbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228765 MGI:2385156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241727 MGI:2139270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668929 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	BC052486 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228767 MGI:3039588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs

name	5430405G05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108832 MGI:1918629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 3 Proteins

name	Psmf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228769 MGI:1346072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rspo4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228770 MGI:1924467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Angpt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11602 MGI:1336887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430432M24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73847 MGI:1921097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2310046K01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69698 MGI:1916948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scrt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545474 MGI:2139287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein

name	Srxn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76650 MGI:104971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcf15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21407 MGI:104664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043843 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 665 ESTs, 7 Proteins pseudo : _no_value

name	Csnk2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12995 MGI:88543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67231 MGI:1914481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbck1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24105 MGI:1344372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Trib3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228775 MGI:1345675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628060 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 3141 ESTs, 7 Proteins pseudo : _no_value

name	Nrsn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228777 MGI:2684969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sox12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20667 MGI:98360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zcchc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67917 MGI:1915167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6820408C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228778 MGI:3045333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG629114 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629114 MGI:3644405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668930 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	9230107O10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319579 MGI:2442320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9230002F21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442835 MGI:3045368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG654457 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654457 MGI:3643488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000015852 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545475 MGI:3650536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75400 MGI:1922650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930525K10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:403172 MGI:2684967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246700 MGI:2385955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000015859 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433490 MGI:3650541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:266620 MGI:2385956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000015862 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654459 MGI:3651158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rem1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19700 MGI:1097696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14950 MGI:95886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcts2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66405 MGI:1913655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Id1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15901 MGI:96396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629170 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629170
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Cox4i2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84682 MGI:2135755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12048 MGI:88139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72119 MGI:1919369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mylk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228785 MGI:2139434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkhl18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14239 MGI:95546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252864 MGI:1934928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttll9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74711 MGI:1913589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pdrg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68559 MGI:1915809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xkr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228787 MGI:3526711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC020535 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228788 MGI:2385159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hck (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15162 MGI:96052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930519N13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402161 GeneID:78177 MGI:1925427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930519N13 gene transcript_id : NM_207204.1

name	Nanp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385585 GeneID:67311 MGI:1914561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylneuraminic acid phosphatase transcript_id : NM_026086.1

name	LOC433486 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367310 GeneID:433486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 39 Proteins product : serine/threonine kinase transcript_id : XM_485079.3

name	LOC381390 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250203 GeneID:381390
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 38 Proteins product : hypothetical LOC381390 transcript_id : XM_355352.4

name	4930442J19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250204 GeneID:74660 MGI:1921910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA 4930442J19 gene transcript_id : XM_001481096.1

name	LOC100043839 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250206 GeneID:100043839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 140 ESTs, 5 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase transcript_id : XM_001481097.1

name	4921509C19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130885 GeneID:381393 MGI:2685851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921509C19 gene transcript_id : NM_198655.2

name	Nsfl1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130836 GeneID:386649 MGI:3042273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NSFL1 (p97) cofactor (p47) transcript_id : NM_198326.2

name	Fkbp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94158952 GeneID:14225 MGI:95541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 1a transcript_id : NM_008019.2

name	Sdcbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704053 GeneID:228765 MGI:2385156
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syndecan binding protein (syntenin) 2 transcript_id : NM_145535.1

name	Snph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130824 GeneID:241727 MGI:2139270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaphilin transcript_id : NM_198214.2

name	LOC668929 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250058 GeneID:668929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to syntaphilin transcript_id : XM_001004826.2

name	BC052486 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367316 GeneID:228767 MGI:3039588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs product : cDNA sequence BC052486 transcript_id : XM_619827.3

name	5430405G05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367317 GeneID:108832 MGI:1918629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 3 Proteins product : RIKEN cDNA 5430405G05 gene transcript_id : XM_130642.6

name	Psmf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74136560 GeneID:228769 MGI:1346072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) inhibitor subunit 1 transcript_id : NM_144889.2

name	Psmf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47078286 GeneID:228769 MGI:1346072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) inhibitor subunit 1 transcript_id : NM_212446.1

name	Rspo4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100817772 GeneID:228770 MGI:1924467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : R-spondin family, member 4 transcript_id : NM_001040689.1

name	Angpt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753005 GeneID:11602 MGI:1336887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiopoietin 4 transcript_id : NM_009641.1

name	5430432M24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165379 GeneID:73847 MGI:1921097
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430432M24 gene transcript_id : NM_146127.1

name	5430432M24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28077016 GeneID:73847 MGI:1921097
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430432M24 gene transcript_id : NM_028666.1

name	2310046K01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350464 GeneID:69698 MGI:1916948
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310046K01 gene transcript_id : NM_027172.2

name	Scrt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250060 GeneID:545474 MGI:2139287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein product : scratch homolog 2, zinc finger protein (Drosophila) transcript_id : XM_619828.4

name	Srxn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802557 GeneID:76650 MGI:104971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfiredoxin 1 homolog (S. cerevisiae) transcript_id : NM_029688.3

name	Tcf15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185897 GeneID:21407 MGI:104664
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 15 transcript_id : NM_009328.2

name	Csnk2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542426 GeneID:12995 MGI:88543
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein kinase 2, alpha 1 polypeptide transcript_id : NM_007788.2

name	Tbc1d20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378176 GeneID:67231 MGI:1914481
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 20 transcript_id : NM_024196.2

name	Rbck1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046238 GeneID:24105 MGI:1344372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RanBP-type and C3HC4-type zinc finger containing 1 transcript_id : NM_019705.3

name	Rbck1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046256 GeneID:24105 MGI:1344372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RanBP-type and C3HC4-type zinc finger containing 1 transcript_id : NM_001083921.1

name	Trib3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117553620 GeneID:228775 MGI:1345675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tribbles homolog 3 (Drosophila) transcript_id : NM_175093.2

name	Nrsn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57977288 GeneID:228777 MGI:2684969
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurensin 2 transcript_id : NM_001009948.1

name	Sox12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139957 GeneID:20667 MGI:98360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 12 transcript_id : NM_011438.2

name	Zcchc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328413 GeneID:67917 MGI:1915167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 3 transcript_id : NM_175126.3

name	6820408C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385521 GeneID:228778 MGI:3045333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6820408C15 gene transcript_id : NM_177656.3

name	EG629114 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83776582 GeneID:629114 MGI:3644405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG629114 transcript_id : NM_001037933.1

name	9230107O10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301231 GeneID:319579 MGI:2442320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9230107O10 gene transcript_id : NM_176950.3

name	9230002F21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134152691 GeneID:442835 MGI:3045368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9230002F21 gene transcript_id : NM_001002791.2

name	EG654457 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84993769 GeneID:654457 MGI:3643488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG654457 transcript_id : NM_001039120.1

name	OTTMUSG00000015852 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802931 GeneID:545475 MGI:3650536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000015852 transcript_id : NM_001037502.2

name	Defb29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367292 GeneID:75400 MGI:1922650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 29 transcript_id : NM_001001444.2

name	4930525K10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032315 GeneID:403172 MGI:2684967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930525K10 gene transcript_id : NM_207276.2

name	Defb19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476290 GeneID:246700 MGI:2385955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 19 transcript_id : NM_145157.2

name	OTTMUSG00000015859 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801976 GeneID:433490 MGI:3650541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000015859 transcript_id : NM_001037752.2

name	Defb36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368751 GeneID:266620 MGI:2385956
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 36 transcript_id : NM_001037247.2

name	OTTMUSG00000015862 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84993773 GeneID:654459 MGI:3651158
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000015862 transcript_id : NM_001039122.1

name	Rem1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368615 GeneID:19700 MGI:1097696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rad and gem related GTP binding protein 1 transcript_id : NM_009047.5

name	H13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360213 GeneID:14950 MGI:95886
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 13 transcript_id : NM_010376.3

name	Mcts2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366629 GeneID:66405 MGI:1913655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : malignant T cell amplified sequence 2 transcript_id : NM_025543.2

name	Id1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130032 GeneID:15901 MGI:96396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibitor of DNA binding 1 transcript_id : NM_010495.2

name	Cox4i2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131189 GeneID:84682 MGI:2135755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase subunit IV isoform 2 transcript_id : NM_053091.2

name	Bcl2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129881 GeneID:12048 MGI:88139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl2-like 1 transcript_id : NM_009743.4

name	Tpx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88900516 GeneID:72119 MGI:1919369
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TPX2, microtubule-associated protein homolog (Xenopus laevis) transcript_id : NM_028109.3

name	Mylk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486659 GeneID:228785 MGI:2139434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, light polypeptide kinase 2, skeletal muscle transcript_id : NM_001081044.1

name	Fkhl18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371908 GeneID:14239 MGI:95546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead-like 18 (Drosophila) transcript_id : NM_010226.2

name	Dusp15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130203 GeneID:252864 MGI:1934928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase-like 15 transcript_id : NM_145744.2

name	Ttll9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288893 GeneID:74711 MGI:1913589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 9 transcript_id : NM_001083618.1

name	Ttll9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288918 GeneID:74711 MGI:1913589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 9 transcript_id : NM_029064.2

name	Pdrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130583 GeneID:68559 MGI:1915809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : p53 and DNA damage regulated 1 transcript_id : NM_178939.2

name	Xkr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59858536 GeneID:228787 MGI:3526711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X Kell blood group precursor related family member 7 homolog transcript_id : NM_001011732.1

name	BC020535 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704055 GeneID:228788 MGI:2385159
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC020535 transcript_id : NM_145536.1

name	Hck (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34734055 GeneID:15162 MGI:96052
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemopoietic cell kinase transcript_id : NM_010407.3

name	Nanp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385586 CCDS:CCDS16864.1 GeneID:67311 MGI:1914561
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0050124 - N-acylneuraminate-9-phosphatase activity [Evidence IEA] [Evidence ISS]; GO:0008967 - phosphoglycolate phosphatase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0046380 - N-acetylneuraminate biosynthesis [Evidence ISS] codon_start : 1 product : haloacid dehalogenase-like hydrolase domain containing 4 protein_id : NP_080362.1

name	LOC433486 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51706423 GeneID:433486
definition	codon_start : 1 product : hypothetical protein protein_id : XP_485079.1

name	LOC381390 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:38075170 GeneID:381390
definition	codon_start : 1 product : hypothetical protein protein_id : XP_355352.1

name	4930442J19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250205 GeneID:74660 MGI:1921910
definition	codon_start : 1 product : hypothetical protein LOC74660 protein_id : XP_001481146.1

name	LOC100043839 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250207 GeneID:100043839
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481147.1

name	4921509C19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348544 GeneID:381393 MGI:2685851
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : novel protein tyrosine kinase (4921509C19Rik) product : hypothetical protein LOC381393 protein_id : NP_941057.1

name	Nsfl1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38198665 CCDS:CCDS16868.1 GeneID:386649 MGI:3042273
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : p47 protein protein_id : NP_938085.1

name	Fkbp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679803 CCDS:CCDS16869.1 GeneID:14225 MGI:95541
definition	GO_function : GO:0005528 - FK506 binding [Evidence ISS]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : FK506 binding protein 1a (12 kDa); FK506 Binding Protein12-T1; FK506 binding protein12-T2 product : FK506 binding protein 1a protein_id : NP_032045.1

name	Sdcbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704054 CCDS:CCDS16870.1 GeneID:228765 MGI:2385156
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008022 - protein C-terminus binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0046907 - intracellular transport [Evidence ISS]; GO:0007399 - nervous system development [Evidence ISS] codon_start : 1 product : syndecan binding protein (syntenin) 2 protein_id : NP_663510.1

name	Snph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016174 CCDS:CCDS16871.1 GeneID:241727 MGI:2139270
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0045806 - negative regulation of endocytosis [Evidence ISS]; GO:0006906 - vesicle fusion [Evidence ISS] codon_start : 1 product : syntaphilin protein_id : NP_937857.1

name	LOC668929 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250059 GeneID:668929
definition	codon_start : 1 product : similar to syntaphilin protein_id : XP_001004826.2

name	BC052486 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63492515 GeneID:228767 MGI:3039588
definition	codon_start : 1 product : hypothetical protein protein_id : XP_619827.1

name	5430405G05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94367318 GeneID:108832 MGI:1918629
definition	codon_start : 1 product : hypothetical protein LOC108832 protein_id : XP_130642.2

name	Psmf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47078287 CCDS:CCDS16872.1 GeneID:228769 MGI:1346072
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : proteasome inhibitor subunit 1 isoform a protein_id : NP_997611.1

name	Psmf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74136561 CCDS:CCDS16873.1 GeneID:228769 MGI:1346072
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : proteasome inhibitor subunit 1 isoform b protein_id : NP_659138.2

name	Rspo4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100817773 GeneID:228770 MGI:1924467
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; R-spondin-like protein product : R-spondin family, member 4 isoform 1 protein_id : NP_001035779.1

name	Angpt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753006 CCDS:CCDS16874.1 GeneID:11602 MGI:1336887
definition	GO_function : GO:0005172 - vascular endothelial growth factor receptor binding [Evidence TAS] GO_process : GO:0007492 - endoderm development [Evidence TAS]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : angiopoietin 3 product : angiopoietin 4 protein_id : NP_033771.1

name	5430432M24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165380 CCDS:CCDS16875.1 GeneID:73847 MGI:1921097
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; novel transcript product : hypothetical protein LOC73847 isoform 2 protein_id : NP_666239.1

name	5430432M24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077017 GeneID:73847 MGI:1921097
definition	codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1; novel transcript product : hypothetical protein LOC73847 isoform 1 protein_id : NP_082942.1

name	2310046K01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312364 CCDS:CCDS16876.1 GeneID:69698 MGI:1916948
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69698 protein_id : NP_081448.1

name	Scrt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250061 GeneID:545474 MGI:2139287
definition	codon_start : 1 product : similar to Transcriptional repressor scratch 2 (Scratch homolog 2 zinc finger protein) protein_id : XP_619828.4

name	Srxn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313268 CCDS:CCDS16877.1 GeneID:76650 MGI:104971
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0016209 - antioxidant activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016667 - oxidoreductase activity, acting on sulfur group of donors [Evidence IDA] GO_process : GO:0006979 - response to oxidative stress [Evidence IDA] codon_start : 1 note : neoplastic progression 3 product : sulfiredoxin 1 homolog protein_id : NP_083964.1

name	Tcf15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185898 CCDS:CCDS16878.1 GeneID:21407 MGI:104664
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : paraxis product : transcription factor 15 protein_id : NP_033354.2

name	Csnk2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542427 CCDS:CCDS16879.1 GeneID:12995 MGI:88543
definition	GO_component : GO:0005956 - protein kinase CK2 complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008013 - beta-catenin binding [Evidence IPI]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0019888 - protein phosphatase regulator activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : casein kinase II, alpha 1 related sequence 4 product : casein kinase II, alpha 1 polypeptide protein_id : NP_031814.2

name	Tbc1d20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789165 CCDS:CCDS16880.1 GeneID:67231 MGI:1914481
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] codon_start : 1 product : TBC1 domain family, member 20 protein_id : NP_077158.1

name	Rbck1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046257 GeneID:24105 MGI:1344372
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ubiquitin conjugating enzyme 7 interacting protein 3; novel zinc finger, C3HC4 type (RING finger) protein product : RanBP-type and C3HC4-type zinc finger containing 1 protein_id : NP_001077390.1

name	Rbck1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046239 GeneID:24105 MGI:1344372
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ubiquitin conjugating enzyme 7 interacting protein 3; novel zinc finger, C3HC4 type (RING finger) protein product : RanBP-type and C3HC4-type zinc finger containing 1 protein_id : NP_062679.2

name	Trib3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117553621 CCDS:CCDS16881.1 GeneID:228775 MGI:1345675
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0019901 - protein kinase binding [Evidence IPI] [Evidence ISS]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] [Evidence ISS]; GO:0006469 - negative regulation of protein kinase activity [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0043405 - regulation of MAPK activity [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : induced in fatty liver dystrophy 2 product : tribbles homolog 3 protein_id : NP_780302.2

name	Nrsn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57977289 CCDS:CCDS16882.1 GeneID:228777 MGI:2684969
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : neurensin 2 protein_id : NP_001009948.1

name	Sox12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54020662 GeneID:20667 MGI:98360
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : SRY-box containing gene 12 protein_id : NP_035568.1

name	Zcchc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424730 CCDS:CCDS16884.1 GeneID:67917 MGI:1915167
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger, CCHC domain containing 3 protein_id : NP_780335.1

name	6820408C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244072 CCDS:CCDS16885.1 GeneID:228778 MGI:3045333
definition	codon_start : 1 product : hypothetical protein LOC228778 protein_id : NP_808324.1

name	EG629114 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776583 CCDS:CCDS16886.1 GeneID:629114 MGI:3644405
definition	codon_start : 1 product : beta-defensin 23 protein_id : NP_001033022.1

name	9230107O10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301232 GeneID:319579 MGI:2442320
definition	codon_start : 1 product : beta-defensin 20 protein_id : NP_795924.2

name	9230002F21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50582603 CCDS:CCDS16887.1 GeneID:442835 MGI:3045368
definition	codon_start : 1 note : beta-defensin 22 product : defensin beta 22 protein_id : NP_001002791.1

name	EG654457 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84993770 CCDS:CCDS16888.1 GeneID:654457 MGI:3643488
definition	codon_start : 1 product : defensin beta 26 protein_id : NP_001034209.1

name	OTTMUSG00000015852 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82775353 GeneID:545475 MGI:3650536
definition	codon_start : 1 note : beta-defensin 28 product : defensin beta 28 protein_id : NP_001032591.1

name	Defb29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47824874 GeneID:75400 MGI:1922650
definition	GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : defensin beta 29 protein_id : NP_001001444.1

name	4930525K10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402301 CCDS:CCDS16890.1 GeneID:403172 MGI:2684967
definition	codon_start : 1 product : beta-defensin 21 protein_id : NP_997159.1

name	Defb19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553123 GeneID:246700 MGI:2385955
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008200 - ion channel inhibitor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0009405 - pathogenesis [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : testis-specific beta-defensin-like; defensin beta 119; testis specific beta defensin-like; beta-defensin 24 product : defensin beta 19 protein_id : NP_660139.1

name	OTTMUSG00000015859 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702288 GeneID:433490 MGI:3650541
definition	codon_start : 1 note : novel protein similar to beta defensin product : beta-defensin 27 protein_id : NP_001032841.1

name	Defb36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370316 GeneID:266620 MGI:2385956
definition	GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : defensin beta 123; beta-defensin 36; novel protein similar to beta defensin product : defensin beta 36 protein_id : NP_001032324.1

name	OTTMUSG00000015862 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84993774 GeneID:654459 MGI:3651158
definition	codon_start : 1 note : novel protein similar to beta defensin product : defensin beta 25 protein_id : NP_001034211.1

name	Rem1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677713 CCDS:CCDS16895.1 GeneID:19700 MGI:1097696
definition	GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : RAS-like GTP binding protein Rem protein_id : NP_033073.1

name	H13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18034682 CCDS:CCDS16896.1 GeneID:14950 MGI:95886
definition	EC_number : 3.4.99.- GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008717 - D-alanyl-D-alanine endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 note : presenilin-like protein 3; signal peptide peptidase beta; presenilin-like aspartyl protease product : histocompatibility 13 protein_id : NP_034506.1

name	Mcts2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384966 GeneID:66405 MGI:1913655
definition	codon_start : 1 note : novel protein similar to malignant T cell amplified sequence 1 Mcts1 product : malignant T cell amplified sequence 2 protein_id : NP_079819.1

name	Id1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31077096 CCDS:CCDS16897.1 GeneID:15901 MGI:96396
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030509 - BMP signaling pathway [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0007507 - heart development [Evidence IGI]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045765 - regulation of angiogenesis [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : inhibitor of DNA binding 1 protein_id : NP_034625.1

name	Cox4i2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716379 CCDS:CCDS16898.1 GeneID:84682 MGI:2135755
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0005751 - respiratory chain complex IV (sensu Eukaryota) [Evidence ISS] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA] [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome c oxidase, subunit IVb; Cox IV-2 product : cytochrome c oxidase subunit IV isoform 2 precursor protein_id : NP_444321.1

name	Bcl2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037550 CCDS:CCDS16899.1 GeneID:12048 MGI:88139
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0006915 - apoptosis [Evidence IDA]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0045768 - positive regulation of anti-apoptosis [Evidence IDA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0009314 - response to radiation [Evidence IMP] codon_start : 1 note : Bcl2-like; B-cell leukemia/lymphoma x; anti-apoptosis regulatory protein product : Bcl2-like 1 protein_id : NP_033873.3

name	Tpx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88900517 CCDS:CCDS16900.1 GeneID:72119 MGI:1919369
definition	GO_component : GO:0005818 - aster [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS]; GO:0005876 - spindle microtubule [Evidence ISS] GO_function : GO:0019901 - protein kinase binding [Evidence ISS] GO_process : GO:0051227 - mitotic spindle assembly [Evidence ISS] codon_start : 1 product : TPX2, microtubule-associated protein homolog protein_id : NP_082385.3

name	Mylk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486660 GeneID:228785 MGI:2139434
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0007274 - neuromuscular synaptic transmission [Evidence IGI] [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : myosin, light polypeptide kinase 2, skeletal muscle protein_id : NP_001074513.1

name	Fkhl18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563254 CCDS:CCDS16901.1 GeneID:14239 MGI:95546
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : forkhead-like 18 protein_id : NP_034356.1

name	Dusp15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21919414 CCDS:CCDS16902.1 GeneID:252864 MGI:1934928
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] codon_start : 1 product : dual specificity phosphatase 15 protein_id : NP_665687.1

name	Ttll9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288894 GeneID:74711 MGI:1913589
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; tubulin tyrosine ligase like family 9; putative polyglutamylase product : tubulin tyrosine ligase like family 9 isoform 1 protein_id : NP_001077087.1

name	Ttll9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288919 CCDS:CCDS16903.1 GeneID:74711 MGI:1913589
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; tubulin tyrosine ligase like family 9; putative polyglutamylase product : tubulin tyrosine ligase like family 9 isoform 2 protein_id : NP_083340.2

name	Pdrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32490570 CCDS:CCDS16904.1 GeneID:68559 MGI:1915809
definition	GO_function : GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : p53 and DNA damage-regulated protein protein_id : NP_849270.1

name	Xkr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858537 CCDS:CCDS16905.1 GeneID:228787 MGI:3526711
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : XK-related protein 7 product : X Kell blood group precursor related family member 7 homolog protein_id : NP_001011732.1

name	BC020535 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704056 GeneID:228788 MGI:2385159
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC228788 protein_id : NP_663511.1

name	Hck (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34734056 GeneID:15162 MGI:96052
definition	EC_number : 2.7.10.1 GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : non-AUG (CUG) translation initiation codon product : hemopoietic cell kinase isoform p59Hck protein_id : NP_034537.2 transl_except : (pos:152934429..152934431,aa:Met)

name	LOC668930 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668930
definition	number : 1 pseudo : _no_value

name	LOC668930 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668930
definition	number : 2 pseudo : _no_value

name	LOC629170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629170
definition	number : 1 pseudo : _no_value

name	LOC668926 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250202 GeneID:668926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins product : similar to 60S ribosomal protein L7a (Surfeit locus protein 3) pseudo : _no_value transcript_id : XR_034992.1

name	LOC100043840 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250208 GeneID:100043840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 53 mRNAs, 2805 ESTs, 35 Proteins product : similar to alpha-tubulin isotype M-alpha-2 pseudo : _no_value transcript_id : XR_034993.1

name	LOC100043843 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250209 GeneID:100043843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 665 ESTs, 7 Proteins product : similar to hCG1994130 pseudo : _no_value transcript_id : XR_034998.1

name	LOC628060 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250210 GeneID:628060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 3141 ESTs, 7 Proteins product : similar to ribosomal protein large PO subunit pseudo : _no_value transcript_id : XR_035000.1

clone name	MSMg01-215P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408H09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533K23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339N08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-098O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-501F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389F06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168E21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-168E20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-153E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-244I16.b	B6Ng01-244I16.g
ACC	GA053649	GA053650
length	1,114	1,054
definition	B6Ng01-244I16.b	B6Ng01-244I16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(151,814,787 - 151,815,924)	(151,960,150 - 151,960,791)
sequence	gaattcaaggtcaacctggtctatagagcaagtttctgaacggtcgaggc tacacagagaaacccattcttaaaaagaaaagcagagggtggggtgtttc tggctgtagaatggccctgacactccactagagggccaagaggagtttaa aggctgatgagttcaaggctaggaaccaaatagcagaatttgagttagta ctgctctgagcacctaccataaatttgagtatagactggaaagaaaatag aggctggatctattacatgtactaagttatattagggagctttatcaagg gtacaaatgactgattggatatcatctgggatggtgtgggaaaacatacc agctctagacaggacgttagcagaaaaaggtgtcgtccatgtgatgacag gggtcagtattgtgcttttgtttttaatgatacggctcctggtgacacaa ttataaagcctcgctggggactctcatcagttaactaagacctcagaagc aaatgatccatcttctaatctagtggaacgagggtttggaaaaatggaaa agggatcttcatttctcaacttccttagtagctgcggggcactgtgtgat cttgtgcacatgagggttaacccaaagatgagctgaaaacagctacattt gacaaagctcctgtgtcatagcaaaataacatgttatcatcggtgagtag ctcagagcaggaaggccaggcaatggtcactgaatgggaagaagaagaaa tataaacaagggaggaaattgtgggcaatacaaactaaatgtaccaactg ttctatcaaaagattaaatgagccgggcgtggtggcgcacgcctttaatc ccagcactcgggaggcagaggcaggaggatttctgagttcgaggccagcc tggtctacaagtgagttacaggacagccagagctagacagagaaacctgt ctcgaaaaccaaaaaaatataaaaaagtcaaagatttaatgagacaaaat tctataaaataaagagtcacttgcagaaattcaatcctctggggtcaagc actttctgaatcaaaatatatgtttatttcaattctcctctgcattcgcc atcatcccacagtg	gaattcctggagacacagcagcccacttgaggctgggagtcccatgctaa ggatgggagagtggaaagatggggcagttgagtctctgatgactctttaa agagccatagtagcctctgtacaacgtcttcaaagcctgatgtggtcatg actctcctgtaatcacctgaataaacccaatgtgcacaagattgagctaa tcaacagtctatcgtggagtggggagggcctcgtgagacctcatccctcc tggcagctaatggttgttggggaagggagagacgtttcccctctgtggta tagatgttcataagttgctgtgcttgggcagacagtctcttacatatgct cctgtaagcagtctgacgaagccattgcataatacatgcaagtgtgtact tcctggggagatgcaacacaaatctcttcatcccagatcgggaacccgtg acataccaaagtgtgggtacaaccaaagttcaactgggtgaaccaatgag ttttattgaggttacttatacaagcatggatgaggggttacttactggaa cagaaattacccaaagacatcttcatcagcaaagcccatcccagcactgg tgtcagatgacagagatgggaacttggagcacactgcagacaactcaaca ggctggacagtgtcctttgcagtgactctggtataaacctcttccataca gcttggctggtttgtcaccgtggcttggctgagactcttctttgtagctt agctcagctcctctgagaggaactctcagcgttttattgcttgctctagt tggtaggggaggcctagtgaatacgtcagtttcagggacttcctgaagct attttgagttgcttagcttcctgtttaaggagctttcctacaggatggaa gctgtgctcagaggactagttgggaagggaagggacatcattagagtggg gggatagagaaggaacagggttgactatacaaaattatatgacatacatg aaaataattggtggtcaggcatacggacaagctctgggtactgggtacag gtga
quality values	Open. Hide. 58 26 24 34 58 34 23 34 58 58 54 34 30 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 53 62 62 62 49 62 47 44 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 62 59 59 59 62 59 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 59 59 62 62 59 62 62 59 62 59 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 45 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 49 58 58 54 41 58 54 58 58 54 58 58 53 54 58 54 54 54 58 54 58 58 54 58 47 58 58 58 58 54 58 54 52 58 54 58 58 58 58 54 54 58 54 50 58 58 58 58 58 42 49 58 58 58 54 51 52 58 58 44 58 58 50 54 58 49 58 58 51 58 58 58 58 58 58 58 58 41 38 58 58 58 58 58 54 29 41 58 46 47 58 58 58 54 40 51 58 58 54 52 52 50 49 58 58 58 50 58 51 49 51 46 49 58 50 58 53 58 58 38 58 58 58 52 41 49 58 51 39 54 58 58 41 41 53 53 58 58 53 53 52 50 51 37 54 58 53 41 58 51 50 52 50 58 50 58 51 31 58 50 52 53 32 49 58 40 58 51 50 58 29 29 33 50 32 52 51 51 41 54 22 51 58 51 52 53 45 39 54 51 39 52 54 53 53 52 54 45 51 50 44 30 52 41 37 39 28 54 54 54 49 51 39 42 24 50 54 35 32 51 47 53 43 52 53 37 51 51 53 46 24 52 53 37 46 53 53 43 32 54 30 53 34 13 54 33 31 9 25 31 49 31 31 29 30 27 27 37 54 51 39 43 37 45 45 52 35 38 32 47 49 47 41 35 32 47 32 28 41 47 31 53 47 32 45 33 41 36 53 25 40 19 40 32 49 34 41 10 53 32 52 26 26 32 51 31 51 51 51 31 31 23 33 35 31 32 46 26 31 39 30 51 27 31 45 29 28 31 32 13 31 42 36 42 26 17 31 31 31 35 31 30 48 48 33 27 32 23 36 31 48 33 26 27 37 19 31 42 28 47 46 28 31 21 31 46 17 32 32 28 25 31 29 30 27 30 30 36 48 44 15 25 36 37 46 21 12 31 34 19 25 31 28 31 36 33 29 23 27 27 38 27 33 16 27 19 21 21 25 31 21 25 33 24 48 37 32 27 29 33 10 29 20 17 18 38 17 22 28 31 15 18 21 28 34 23 24 8 28 33 27 26 26 32 29 25 38 34 32 21 19 11 15 16 20 25 33 24 29 15 15 17 17 32 32 21 18 32 15 24 9 20 9 32 34 16 25 33 7 29 13 18 32 23 18 21 21 25 33 24 27 11 4 4 3 3 9 3 3 6 3 3 3 4 4 5 4 3 9 6 5 9 13 20 47 30 9 28 9 28 10 27 19 24 20 14 20 24 8 27 21 28 11 27 11 13 12 6 13 14 32 32 15 12 15 34 17 8 22 12 19 20 10 21 13 9 19 6 14 9 23 28 14 11 18 19 25 11 11 4 4 10 15 7 18 25 26 24 16 10 7 4 6 5 4 7 8 23 8 5 1 3 13 15 11 13 5 26 28 12 11 8 9 13 17 15 8 27 7 3 3 18 6 6 5 5 21 13 4 4 20 17 8 8 8 11 10 4 14 7 5 4 5 10 3 1 5 5 5 7 12 5 5 6 6 4 4 6	Open. Hide. 62 47 27 41 62 62 62 62 62 56 47 47 39 51 26 62 28 30 37 56 62 62 62 54 56 49 62 62 49 47 47 59 62 62 62 62 62 59 47 62 62 62 62 59 62 62 62 59 62 62 62 62 59 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 38 42 54 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 62 62 62 62 62 62 62 47 62 62 62 62 62 47 52 54 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 42 62 62 54 47 58 54 58 58 58 58 52 58 58 58 58 58 58 58 58 58 54 39 58 52 58 58 58 58 54 58 58 58 54 52 54 58 58 58 58 58 49 58 50 58 58 54 52 58 52 58 32 58 58 58 49 58 58 58 45 43 58 58 41 58 58 58 52 58 41 42 58 58 52 58 54 58 58 58 52 52 46 40 58 58 42 48 58 52 58 58 38 31 58 58 53 49 47 42 58 51 58 58 50 35 51 53 52 51 51 47 58 58 50 58 58 58 50 58 45 58 46 41 52 58 50 50 52 54 58 43 58 52 53 40 52 58 53 51 51 37 37 37 58 24 39 32 49 58 48 44 42 39 58 53 50 49 51 29 53 42 40 40 40 54 53 46 53 39 53 37 25 58 40 58 35 30 38 52 40 40 58 35 50 50 50 35 29 50 52 50 51 41 32 50 49 58 53 42 41 39 42 40 50 39 39 53 53 42 54 49 31 43 40 27 54 41 37 54 53 53 53 39 40 33 32 42 32 41 35 35 39 53 35 52 53 42 35 40 54 29 54 53 38 19 45 28 31 52 39 33 37 54 38 52 33 37 45 30 39 37 42 10 28 16 45 42 43 37 53 34 54 45 45 40 37 26 42 51 24 37 13 35 34 37 40 16 33 42 31 53 32 32 31 26 41 13 51 25 16 35 32 32 45 43 43 34 31 23 40 31 41 51 53 35 12 9 46 22 26 35 52 37 32 37 32 32 31 31 37 31 46 27 23 32 32 46 41 22 27 10 51 22 33 37 43 31 25 31 33 33 31 23 6 10 5 32 25 17 12 51 29 31 16 19 46 20 31 23 30 31 25 19 12 32 12 22 15 33 31 31 31 48 48 30 26 31 24 29 42 31 28 31 29 34 21 27 31 19 13 33 26 16 11 39 36 14 21 29 23 22 13 25 25 48 31 21 19 30 30 32 31 29 22 26 35 16 31 18 32 18 27 31 20 8 12 27 36 33 11 30 25 15 11 26 23 33 22 21 18 15 17 29 26 15 12 9 43 15 14 20 19 36 26 7 20 18 34 20 28 9 9 7 5 7 9 14 19 37 44 20 44 19 7 7 22 10 31 13 24 5 19 18 15 23 24 7 18 30 14 10 10 11 10 11 14 8 13 31 25 28 32 39 21 34 30 7 9 6 12 6 10 6 6 24 6 4 5 7 8 24 29 27 26 26 10 6 4 3 4 7 7 18 11 14 15 6 7 28 7 16 10 14 6 18 11 4 7 9 13 11 23 14 7 19 13 28 13 7 6 4 3 5 3 3 6 8 7 5 8 6 5 10 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_151814787_151815924
seq2: B6Ng01-244I16.b_45_1158

seq1  GAATTCAAGGTCAACCTGGTCTATAGAGCAAGTTTCTGAACGGTCGAGGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAGGTCAACCTGGTCTATAGAGCAAGTTTCTGAACGGTCGAGGC  50

seq1  TACACAGAGAAACCCATTCTTAAAAAGAAAAGCAGAGGGTGGGGTGTTTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACAGAGAAACCCATTCTTAAAAAGAAAAGCAGAGGGTGGGGTGTTTC  100

seq1  TGGCTGTAGAATGGCCCTGACACTCCACTAGAGGGCCAAGAGGAGTTTAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTGTAGAATGGCCCTGACACTCCACTAGAGGGCCAAGAGGAGTTTAA  150

seq1  AGGCTGATGAGTTCAAGGCTAGGAACCAAATAGCAGAATTTGAGTTAGTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTGATGAGTTCAAGGCTAGGAACCAAATAGCAGAATTTGAGTTAGTA  200

seq1  CTGCTCTGAGCACCTACCATAAATTTGAGTATAGACTGGAAAGAAAATAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTCTGAGCACCTACCATAAATTTGAGTATAGACTGGAAAGAAAATAG  250

seq1  AGGCTGGATCTATTACATGTACTAAGTTATATTAGGGAGCTTTATCAAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTGGATCTATTACATGTACTAAGTTATATTAGGGAGCTTTATCAAGG  300

seq1  GTACAAATGACTGATTGGATATCATCTGGGATGGTGTGGGAAAACATACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACAAATGACTGATTGGATATCATCTGGGATGGTGTGGGAAAACATACC  350

seq1  AGCTCTAGACAGGACGTTAGCAGAAAAAGGTGTCGTCCATGTGATGACAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCTAGACAGGACGTTAGCAGAAAAAGGTGTCGTCCATGTGATGACAG  400

seq1  GGGTCAGTATTGTGCTTTTGTTTTTAATGATACGGCTCCTGGTGACACAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTCAGTATTGTGCTTTTGTTTTTAATGATACGGCTCCTGGTGACACAA  450

seq1  TTATAAAGCCTCGCTGGGGACTCTCATCAGTTAACTAAGACCTCAGAAGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAAAGCCTCGCTGGGGACTCTCATCAGTTAACTAAGACCTCAGAAGC  500

seq1  AAATGATCCATCTTCTAATCTAGTGGAACGAGGGTTTGGAAAAATGGAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGATCCATCTTCTAATCTAGTGGAACGAGGGTTTGGAAAAATGGAAA  550

seq1  AGGGATCTTCATTTCTCAACTTCCTTAGTAGCTGCGGGGCACTGTGTGAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGATCTTCATTTCTCAACTTCCTTAGTAGCTGCGGGGCACTGTGTGAT  600

seq1  CTTGTGCACATGAGGGTTAACCCAAAGATGAGCTGAAAACAGCTACATTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTGCACATGAGGGTTAACCCAAAGATGAGCTGAAAACAGCTACATTT  650

seq1  GACAAAGCTCCTGTGTCATAGCAAAATAACATGTTATCATCGGTGAGTAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAAAGCTCCTGTGTCATAGCAAAATAACATGTTATCATCGGTGAGTAG  700

seq1  CTCAGAGCAGGAAGGCCAGGCAATGGTCACTGAATGGGAAGAAGAAGAAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGAGCAGGAAGGCCAGGCAATGGTCACTGAATGGGAAGAAGAAGAAA  750

seq1  TATAAACAAGGGAGGAAATTGTGGGCAATACAAACTAAATGTACCAACTG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAAACAAGGGAGGAAATTGTGGGCAATACAAACTAAATGTACCAACTG  800

seq1  TTCTATCAAAAGATTAAATGAGCCGGGCGTGGTGGCGCACGCCTTTAATC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTATCAAAAGATTAAATGAGCCGGGCGTGGTGGCGCACGCCTTTAATC  850

seq1  CCAGCACTCGGGAGGCAGAGGCAGGAGGATTTCTGAGTTCGAGGCCAGCC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCACTCGGGAGGCAGAGGCAGGAGGATTTCTGAGTTCGAGGCCAGCC  900

seq1  TGGTCTACAAAGTGAGTTACAGGACAGCCAGAGCTAGACAGAGAAACCCT  950
      |||||||| ||||||||||||||||||||||||||||||||||||| |||
seq2  TGGTCTAC-AAGTGAGTTACAGGACAGCCAGAGCTAGACAGAGAAA-CCT  948

seq1  GTCTCGAAAAACCAAAAAAAAAAAAAAAAAAAAAAAAAGTCAAAAGATTA  1000
      |||||||||| |          ||||||| | ||||||||| ||||||| 
seq2  GTCTCGAAAACC----------AAAAAAATATAAAAAAGTC-AAAGATTT  987

seq1  AATGAGACAAAAATTCTATTAAAAAAATAAAGAAGTCACTTGGCAGAAAT  1050
      |||||||| ||||||||||    ||||||||| |||||||| ||||||||
seq2  AATGAGAC-AAAATTCTAT----AAAATAAAG-AGTCACTT-GCAGAAAT  1030

seq1  TCAAATTCCTCTGGGGTC-AGCACTTCCTGAAATCAAAATATATGTTTAA  1099
      ||||  |||||||||||| ||||||| ||| ||||||||||||||||| |
seq2  TCAA--TCCTCTGGGGTCAAGCACTTTCTG-AATCAAAATATATGTTT-A  1076

seq1  TTTCATTTCTCCTCTGCATTCGCCAATCATCCCACAGTG  1138
      ||||| |||||||||||||||||| ||||||||||||||
seq2  TTTCAATTCTCCTCTGCATTCGCC-ATCATCCCACAGTG  1114

seq1: chr2_151960150_151960791
seq2: B6Ng01-244I16.g_480_1120 (reverse)

seq1  TCACCTGTACCAAGTAACCAGAGC-TGTCCCTTTGCCTGACCAC--ATTA  47
      ||||||||||| |||| ||||||| ||||| | |||||||||||  ||||
seq2  TCACCTGTACCCAGTACCCAGAGCTTGTCCGTATGCCTGACCACCAATTA  50

seq1  TTTTCATGTATGTC-TATAATTTTGTTATAGTCACCCCTGTTCCCTTCTC  96
      |||||||||||||| |||||||||| |||||||| ||||||| |||||||
seq2  TTTTCATGTATGTCATATAATTTTG-TATAGTCAACCCTGTT-CCTTCTC  98

seq1  TTATCCCCCACTCCTATTGATGTCCCTTCCCTTCCCAACTAGTCCTCCTG  146
      |   |||||||| ||| ||||||||||||||||||||||||||||| |||
seq2  TATCCCCCCACT-CTAATGATGTCCCTTCCCTTCCCAACTAGTCCT-CTG  146

seq1  AGCACAGCTTCCATCCTGTAGGAAAGCTCCTTAAACAGGAAGCTAAGCAA  196
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACAGCTTCCATCCTGTAGGAAAGCTCCTTAAACAGGAAGCTAAGCAA  196

seq1  CTCAAAATAGCTTCAGGAAGTCCCTGAAACTGACCGTATTCACTAGGCCT  246
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  CTCAAAATAGCTTCAGGAAGTCCCTGAAACTGA-CGTATTCACTAGGCCT  245

seq1  CCCCTACCAACTAGAGCAAGCAATAAAACGCTGAGAGTTCCTCTCAGAGG  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTACCAACTAGAGCAAGCAATAAAACGCTGAGAGTTCCTCTCAGAGG  295

seq1  AGCTGAGCTAAGCTACAAAGAAGAGTCTCAGCCAAGCCACGGTGACAAAC  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTGAGCTAAGCTACAAAGAAGAGTCTCAGCCAAGCCACGGTGACAAAC  345

seq1  CAGCCAAGCTGTATGGAAGAGGTTTATACCAGAGTCACTGCAAAGGACAC  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCAAGCTGTATGGAAGAGGTTTATACCAGAGTCACTGCAAAGGACAC  395

seq1  TGTCCAGCCTGTTGAGTTGTCTGCAGTGTGCTCCAAGTTCCCATCTCTGT  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCAGCCTGTTGAGTTGTCTGCAGTGTGCTCCAAGTTCCCATCTCTGT  445

seq1  CATCTGACACCAGTGCTGGGATGGGCTTTGCTGATGAAGATGTCTTTGGG  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTGACACCAGTGCTGGGATGGGCTTTGCTGATGAAGATGTCTTTGGG  495

seq1  TAATTTCTGTTCCAGTAAGTAACCCCTCATCCATGCTTGTATAAGTAACC  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTTCTGTTCCAGTAAGTAACCCCTCATCCATGCTTGTATAAGTAACC  545

seq1  TCAATAAAACTCATTGGTTCACCCAGTTGAACTTTGGTTGTACCCACACT  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATAAAACTCATTGGTTCACCCAGTTGAACTTTGGTTGTACCCACACT  595

seq1  TTGGTATGTCACGGGTTCCCGATCTGGGATGAAGAGATTTGTGTTG  642
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTATGTCACGGGTTCCCGATCTGGGATGAAGAGATTTGTGTTG  641

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information