MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-245P04
Chromosome	2 (Build37)
Map Location	24,197,180 - 24,328,595
singlet/doublet	doublet
Overlap gene	Il1rn, Psd4, Pax8
Upstream gene	Nxph2, LOC664822, 4921517N04Rik, LOC100039149, Sh3d2c-ps1, Hnmt, Tbpl2, Il1f8, LOC215253, Il1f9, Il1f6, LOC620156, Il1f5, Il1f10
Downstream gene	LOC433410, LOC664938, Cacna1b, Ehmt1, Arrdc1, Zmynd19, Wdr85, Mrpl41, Pnpla7, Nelf, Entpd8, Noxa1, Nrarp, A830007P12Rik, A730008L03Rik, 4933433C11Rik, BC061039, Tubb2c, Slc34a3, Gm757, 2310002J15Rik, Rnf208, LOC100039232, Ndor1, C730025P13Rik, C430004E15Rik, Ssna1, Anapc2, 4930571C24Rik, BC004853, Grin1, Man1b1, Dpp7, Uap1l1, 2010317E24Rik, Entpd2, Npdc1, Fut7, Abca2, Clic3, BC029214, Ptgds
Link	Open Mouse BAC browser

Click to get alignment info.

name	Nxph2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18232 MGI:107491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 126 ESTs, 26 Proteins pseudo : _no_value

name	4921517N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76857 MGI:1924107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039149 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Sh3d2c-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20406 MGI:1313300
definition	note : SH3 domain protein 2C, pseudogene 1 pseudo : _no_value

name	Hnmt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140483 MGI:2153181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbpl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227606 MGI:2684058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1f8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69677 MGI:1916927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC215253 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:215253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins pseudo : _no_value

name	Il1f9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215257 MGI:2449929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1f6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54448 MGI:1859324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620156 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Il1f5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54450 MGI:1859325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1f10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215274 MGI:2652548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1rn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16181 MGI:96547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Psd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215632 MGI:2674093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pax8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18510 MGI:97492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433410 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 13 Proteins pseudo : _no_value

name	LOC664938 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 39 ESTs, 4 Proteins pseudo : _no_value

name	Cacna1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12287 MGI:88296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ehmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77683 MGI:1924933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Arrdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215705 MGI:2446136
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zmynd19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67187 MGI:1914437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr85 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67228 MGI:1914478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107733 MGI:1333816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnpla7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241274 MGI:2385325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nelf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56876 MGI:1861755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Entpd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72090 MGI:1919340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Noxa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241275 MGI:2449980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrarp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67122 MGI:1914372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830007P12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227612 MGI:2442720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A730008L03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58202 MGI:1931035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933433C11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74472 MGI:1921722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 2 Proteins

name	BC061039 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68222 MGI:3605773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tubb2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227613 MGI:1915472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc34a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:142681 MGI:2159410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm757 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329360 MGI:2685603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310002J15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67859 MGI:1915109
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf208 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68846 MGI:1916096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039232 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 1 Protein

name	Ndor1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78797 MGI:1926047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	C730025P13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227615 MGI:2443597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C430004E15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97031 MGI:2139535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68475 MGI:1915725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anapc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99152 MGI:2139135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930571C24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78217 MGI:1925467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	BC004853 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227618 MGI:2385129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14810 MGI:95819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Man1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227619 MGI:2684954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83768 MGI:1933213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uap1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227620 MGI:2443318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010317E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72080 MGI:1919330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Entpd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12496 MGI:1096863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18146 MGI:1099802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fut7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14347 MGI:107692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11305 MGI:99606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clic3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69454 MGI:1916704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC029214 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227622 MGI:2442831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptgds (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19215 MGI:99261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nxph2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379890 GeneID:18232 MGI:107491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurexophilin 2 transcript_id : NM_008752.2

name	4921517N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079700 GeneID:76857 MGI:1924107
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921517N04 gene transcript_id : NM_029773.1

name	LOC100039149 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249219 GeneID:100039149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100039149 transcript_id : XM_001472660.1

name	Hnmt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922616 GeneID:140483 MGI:2153181
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histamine N-methyltransferase transcript_id : NM_080462.2

name	Tbpl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39979629 GeneID:227606 MGI:2684058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TATA box binding protein like 2 transcript_id : NM_199059.1

name	Il1f8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382420 GeneID:69677 MGI:1916927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 family, member 8 transcript_id : NM_027163.3

name	Il1f9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375036 GeneID:215257 MGI:2449929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 family, member 9 transcript_id : NM_153511.2

name	Il1f6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892651 GeneID:54448 MGI:1859324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 family, member 6 transcript_id : NM_019450.3

name	Il1f5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506806 GeneID:54450 MGI:1859325
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 family, member 5 (delta) transcript_id : NM_019451.1

name	Il1f10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130161 GeneID:215274 MGI:2652548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 family, member 10 transcript_id : NM_153077.2

name	Il1rn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560856 GeneID:16181 MGI:96547
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 receptor antagonist transcript_id : NM_031167.3

name	Il1rn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386158 GeneID:16181 MGI:96547
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 receptor antagonist transcript_id : NM_001039701.2

name	Psd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402517 GeneID:215632 MGI:2674093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin and Sec7 domain containing 4 transcript_id : NM_177611.3

name	Pax8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130210 GeneID:18510 MGI:97492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired box gene 8 transcript_id : NM_011040.3

name	Cacna1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225365 GeneID:12287 MGI:88296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, N type, alpha 1B subunit transcript_id : NM_007579.2

name	Cacna1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225367 GeneID:12287 MGI:88296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, N type, alpha 1B subunit transcript_id : NM_001042528.1

name	Ehmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369397 GeneID:77683 MGI:1924933
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : euchromatic histone methyltransferase 1 transcript_id : NM_172545.2

name	Ehmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60302889 GeneID:77683 MGI:1924933
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : euchromatic histone methyltransferase 1 transcript_id : NM_001012518.1

name	Arrdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341544 GeneID:215705 MGI:2446136
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin domain containing 1 transcript_id : NM_178408.2

name	Zmynd19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364884 GeneID:67187 MGI:1914437
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MYND domain containing 19 transcript_id : NM_026021.2

name	Wdr85 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369415 GeneID:67228 MGI:1914478
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD40 repeat domain 85 transcript_id : NM_026044.2

name	Mrpl41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461979 GeneID:107733 MGI:1333816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L41 transcript_id : NM_001031808.2

name	Pnpla7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345054 GeneID:241274 MGI:2385325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : patatin-like phospholipase domain containing 7 transcript_id : NM_146251.3

name	Nelf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476081 GeneID:56876 MGI:1861755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nasal embryonic LHRH factor transcript_id : NM_001039386.1

name	Nelf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476085 GeneID:56876 MGI:1861755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nasal embryonic LHRH factor transcript_id : NM_020276.3

name	Nelf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476078 GeneID:56876 MGI:1861755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nasal embryonic LHRH factor transcript_id : NM_001039387.1

name	Entpd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821697 GeneID:72090 MGI:1919340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 8 transcript_id : NM_028093.1

name	Noxa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802449 GeneID:241275 MGI:2449980
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADPH oxidase activator 1 transcript_id : NM_172204.3

name	Nrarp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815819 GeneID:67122 MGI:1914372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Notch-regulated ankyrin repeat protein transcript_id : NM_025980.2

name	A830007P12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370326 GeneID:227612 MGI:2442720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830007P12 gene transcript_id : NM_146115.3

name	A730008L03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946737 GeneID:58202 MGI:1931035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A730008L03 gene transcript_id : NM_021393.1

name	4933433C11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249232 GeneID:74472 MGI:1921722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 2 Proteins product : RIKEN cDNA 4933433C11 gene, transcript variant 1 transcript_id : XM_130141.5

name	BC061039 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802505 GeneID:68222 MGI:3605773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC061039 transcript_id : NM_026624.2

name	Tubb2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165383 GeneID:227613 MGI:1915472
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, beta 2c transcript_id : NM_146116.1

name	Slc34a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18252793 GeneID:142681 MGI:2159410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 34 (sodium phosphate), member 3 transcript_id : NM_080854.1

name	Gm757 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803138 GeneID:329360 MGI:2685603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 757, (NCBI) transcript_id : NM_001033410.2

name	2310002J15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353513 GeneID:67859 MGI:1915109
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310002J15 gene transcript_id : NM_026415.2

name	Rnf208 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119395755 GeneID:68846 MGI:1916096
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 208 transcript_id : NM_176834.2

name	LOC100039232 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249222 GeneID:100039232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 1 Protein product : similar to ring finger protein 183 transcript_id : XM_001472503.1

name	Ndor1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723292 GeneID:78797 MGI:1926047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADPH dependent diflavin oxidoreductase 1 transcript_id : NM_001082476.1

name	C730025P13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001544 GeneID:227615 MGI:2443597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C730025P13 gene transcript_id : NM_177344.3

name	C430004E15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129853 GeneID:97031 MGI:2139535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C430004E15 gene transcript_id : NM_175286.3

name	Ssna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311553 GeneID:68475 MGI:1915725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sjogren's syndrome nuclear autoantigen 1 transcript_id : NM_023464.2

name	Anapc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803257 GeneID:99152 MGI:2139135
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anaphase promoting complex subunit 2 transcript_id : NM_175300.3

name	4930571C24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366279 GeneID:78217 MGI:1925467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930571C24 gene transcript_id : XM_884900.2

name	BC004853 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122636 GeneID:227618 MGI:2385129
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC004853 transcript_id : NM_146117.1

name	Grin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680094 GeneID:14810 MGI:95819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, NMDA1 (zeta 1) transcript_id : NM_008169.1

name	Man1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71534294 GeneID:227619 MGI:2684954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase, alpha, class 1B, member 1 transcript_id : NM_001029983.1

name	Dpp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981424 GeneID:83768 MGI:1933213
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dipeptidylpeptidase 7 transcript_id : NM_031843.2

name	Uap1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383016 GeneID:227620 MGI:2443318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acteylglucosamine pyrophosphorylase 1-like 1 transcript_id : NM_001033293.2

name	2010317E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487324 GeneID:72080 MGI:1919330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010317E24 gene transcript_id : NM_001081085.1

name	Entpd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753347 GeneID:12496 MGI:1096863
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 2 transcript_id : NM_009849.1

name	Npdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130668 GeneID:18146 MGI:1099802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neural proliferation, differentiation and control gene 1 transcript_id : NM_008721.3

name	Fut7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129912 GeneID:14347 MGI:107692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fucosyltransferase 7 transcript_id : NM_013524.2

name	Abca2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225378 GeneID:11305 MGI:99606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 2 transcript_id : NM_007379.2

name	Clic3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375574 GeneID:69454 MGI:1916704
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride intracellular channel 3 transcript_id : NM_027085.2

name	BC029214 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956329 GeneID:227622 MGI:2442831
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC029214 transcript_id : NM_153557.1

name	Ptgds (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226207 GeneID:19215 MGI:99261
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin D2 synthase (brain) transcript_id : NM_008963.2

name	Nxph2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468865 CCDS:CCDS15729.1 GeneID:18232 MGI:107491
definition	GO_function : GO:0005102 - receptor binding [Evidence TAS] codon_start : 1 product : neurexophilin 2 protein_id : NP_032778.1

name	4921517N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079701 CCDS:CCDS15730.1 GeneID:76857 MGI:1924107
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC76857 protein_id : NP_084049.1

name	LOC100039149 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249220 GeneID:100039149
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472710.1

name	Hnmt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17978276 CCDS:CCDS15731.1 GeneID:140483 MGI:2153181
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046539 - histamine N-methyltransferase activity [Evidence IEA]; GO:0008170 - N-methyltransferase activity [Evidence IDA] GO_process : GO:0001505 - regulation of neurotransmitter levels [Evidence TAS] codon_start : 1 product : histamine N-methyltransferase protein_id : NP_536710.1

name	Tbpl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39979630 CCDS:CCDS15732.1 GeneID:227606 MGI:2684058
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006367 - transcription initiation from RNA polymerase II promoter [Evidence IEA] codon_start : 1 note : TBP-related factor 3 (Trf3) product : TBP-related factor 3 protein_id : NP_951014.1

name	Il1f8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601193 GeneID:69677 MGI:1916927
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 product : interleukin 1 family, member 8 protein_id : NP_081439.1

name	Il1f9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943830 GeneID:215257 MGI:2449929
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : IL-1F9 product : interleukin 1 family, member 9 protein_id : NP_705731.1

name	Il1f6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506601 CCDS:CCDS15734.1 GeneID:54448 MGI:1859324
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005152 - interleukin-1 receptor antagonist activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence ISS] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence TAS] codon_start : 1 note : Fil1epsilon; interleukin 1 family, member 6 (epsilon); interleukin 1 family, member 9 product : interleukin 1 family, member 6 protein_id : NP_062323.1

name	Il1f5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506807 GeneID:54450 MGI:1859325
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005152 - interleukin-1 receptor antagonist activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 note : interleukin 1 receptor antagonist homolog 1 product : interleukin 1 family, member 5 protein_id : NP_062324.1

name	Il1f10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346487 CCDS:CCDS15735.1 GeneID:215274 MGI:2652548
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005152 - interleukin-1 receptor antagonist activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 note : IL-1F10; interleukin 1 family, member 7 product : interleukin 1 family, member 10 protein_id : NP_694717.1

name	Il1rn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624317 CCDS:CCDS15736.1 GeneID:16181 MGI:96547
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005152 - interleukin-1 receptor antagonist activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0030073 - insulin secretion [Evidence IMP]; GO:0006629 - lipid metabolism [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : interleukin 1 receptor antagonist isoform 1 protein_id : NP_112444.1

name	Il1rn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89257344 GeneID:16181 MGI:96547
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005152 - interleukin-1 receptor antagonist activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0030073 - insulin secretion [Evidence IMP]; GO:0006629 - lipid metabolism [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : interleukin 1 receptor antagonist isoform 2 protein_id : NP_001034790.1

name	Psd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243984 CCDS:CCDS15737.1 GeneID:215632 MGI:2674093
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 note : SEC7 homolog product : pleckstrin and Sec7 domain containing 4 protein_id : NP_808279.1

name	Pax8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754990 CCDS:CCDS15738.1 GeneID:18510 MGI:97492
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0001656 - metanephros development [Evidence IGI]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006350 - transcription [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 product : paired box gene 8 protein_id : NP_035170.1

name	Cacna1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225366 CCDS:CCDS15739.1 GeneID:12287 MGI:88296
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IMP]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0008217 - blood pressure regulation [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007269 - neurotransmitter secretion [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; calcium channel, voltage-dependent, L type, alpha 1B subunit; brain calcium channel III product : calcium channel, voltage-dependent, N type, alpha 1B subunit isoform 2 protein_id : NP_031605.2

name	Cacna1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225368 GeneID:12287 MGI:88296
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IMP]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0008217 - blood pressure regulation [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007269 - neurotransmitter secretion [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; calcium channel, voltage-dependent, L type, alpha 1B subunit; brain calcium channel III product : calcium channel, voltage-dependent, N type, alpha 1B subunit isoform 1 protein_id : NP_001035993.1

name	Ehmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60302890 CCDS:CCDS15740.1 GeneID:77683 MGI:1924933
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0018024 - histone-lysine N-methyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] [Evidence ISS]; GO:0016571 - histone methylation [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1 product : euchromatic histone methyltransferase 1 isoform 1 protein_id : NP_001012536.1

name	Ehmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369762 GeneID:77683 MGI:1924933
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0018024 - histone-lysine N-methyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] [Evidence ISS]; GO:0016571 - histone methylation [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : euchromatic histone methyltransferase 1 isoform 2 protein_id : NP_766133.1

name	Arrdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410732 CCDS:CCDS15741.1 GeneID:215705 MGI:2446136
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : arrestin domain containing 1 protein_id : NP_848495.1

name	Zmynd19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385526 CCDS:CCDS15742.1 GeneID:67187 MGI:1914437
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger MYND domain containing 19 product : melanin concentrating hormone receptor interacting zinc finger protein protein_id : NP_080297.1

name	Wdr85 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313066 CCDS:CCDS15743.1 GeneID:67228 MGI:1914478
definition	codon_start : 1 note : novel protein containing WD40 domains product : WD40 repeat domain 85 protein_id : NP_080320.1

name	Mrpl41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113461980 CCDS:CCDS15744.1 GeneID:107733 MGI:1333816
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L41 protein_id : NP_001026978.2

name	Pnpla7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542202 GeneID:241274 MGI:2385325
definition	GO_process : GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 product : patatin-like phospholipase domain containing 7 protein_id : NP_666363.2

name	Nelf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476082 CCDS:CCDS15745.1 GeneID:56876 MGI:1861755
definition	codon_start : 1 note : isoform A is encoded by transcript variant 1; Jacob protein product : nasal embryonic LHRH factor isoform A protein_id : NP_001034475.1

name	Nelf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10190662 CCDS:CCDS15747.1 GeneID:56876 MGI:1861755
definition	codon_start : 1 note : isoform C is encoded by transcript variant 3; Jacob protein product : nasal embryonic LHRH factor isoform C protein_id : NP_064672.2

name	Nelf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476079 CCDS:CCDS15746.1 GeneID:56876 MGI:1861755
definition	codon_start : 1 note : isoform B is encoded by transcript variant 2; Jacob protein product : nasal embryonic LHRH factor isoform B protein_id : NP_001034476.1

name	Entpd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821698 CCDS:CCDS15748.1 GeneID:72090 MGI:1919340
definition	GO_component : GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IDA] GO_process : GO:0009133 - nucleoside diphosphate biosynthesis [Evidence IDA]; GO:0009124 - nucleoside monophosphate biosynthesis [Evidence IDA] codon_start : 1 product : ectonucleoside triphosphate diphosphohydrolase 8 protein_id : NP_082369.1

name	Noxa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982024 CCDS:CCDS15749.1 GeneID:241275 MGI:2449980
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016176 - superoxide-generating NADPH oxidase activator activity [Evidence IDA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006801 - superoxide metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : NADPH oxidase activator 1 protein_id : NP_757341.2

name	Nrarp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815820 GeneID:67122 MGI:1914372
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : Notch-regulated ankyrin repeat protein protein_id : NP_080256.2

name	A830007P12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981884 CCDS:CCDS15750.1 GeneID:227612 MGI:2442720
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC227612 protein_id : NP_666227.2

name	A730008L03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946738 CCDS:CCDS15751.1 GeneID:58202 MGI:1931035
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : negative elongation factor B product : cofactor of BRCA1 protein_id : NP_067368.1

name	4933433C11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249233 GeneID:74472 MGI:1921722
definition	codon_start : 1 product : hypothetical protein LOC74472 isoform 1 protein_id : XP_130141.6

name	BC061039 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311859 CCDS:CCDS15752.1 GeneID:68222 MGI:3605773
definition	codon_start : 1 note : 4931415M17 mRNA product : hypothetical protein LOC68222 protein_id : NP_080900.1

name	Tubb2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165384 CCDS:CCDS15753.1 GeneID:227613 MGI:1915472
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA]; GO:0045298 - tubulin [Evidence NAS] GO_function : GO:0005525 - GTP binding [Evidence NAS] [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 note : novel tubulin protein product : tubulin, beta, 2 protein_id : NP_666228.1

name	Slc34a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252794 CCDS:CCDS15754.1 GeneID:142681 MGI:2159410
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005903 - brush border [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015321 - sodium-dependent phosphate transporter activity [Evidence IDA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IDA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sodium-phosphate cotransporter IIC product : type IIc Na+/Pi-cotransporter protein_id : NP_543130.1

name	Gm757 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701917 CCDS:CCDS15755.1 GeneID:329360 MGI:2685603
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC329360 protein_id : NP_001028582.1

name	2310002J15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385910 GeneID:67859 MGI:1915109
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67859 protein_id : NP_080691.1

name	Rnf208 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119395756 CCDS:CCDS15757.1 GeneID:68846 MGI:1916096
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 208 protein_id : NP_789804.2

name	LOC100039232 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249223 GeneID:100039232
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472553.1

name	Ndor1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723293 GeneID:78797 MGI:1926047
definition	GO_function : GO:0010181 - FMN binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] codon_start : 1 product : NADPH dependent diflavin oxidoreductase 1 protein_id : NP_001075945.1

name	C730025P13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001545 GeneID:227615 MGI:2443597
definition	codon_start : 1 product : hypothetical protein LOC227615 protein_id : NP_796318.2

name	C430004E15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424950 CCDS:CCDS15759.1 GeneID:97031 MGI:2139535
definition	codon_start : 1 product : hypothetical protein LOC97031 protein_id : NP_780495.1

name	Ssna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963687 GeneID:68475 MGI:1915725
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence IPI] codon_start : 1 product : Sjogren's syndrome nuclear autoantigen 1 protein_id : NP_075953.1

name	Anapc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424970 CCDS:CCDS15761.1 GeneID:99152 MGI:2139135
definition	GO_process : GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : anaphase-promoting complex subunit 2 protein_id : NP_780509.1

name	4930571C24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82884213 GeneID:78217 MGI:1925467
definition	codon_start : 1 product : hypothetical protein LOC78217 protein_id : XP_889993.1

name	BC004853 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122637 CCDS:CCDS15763.1 GeneID:227618 MGI:2385129
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : novel protein containing a tandem array of leucine rich repeats product : hypothetical protein LOC227618 protein_id : NP_666229.1

name	Grin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680095 CCDS:CCDS15764.1 GeneID:14810 MGI:95819
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030425 - dendrite [Evidence ISS]; GO:0030426 - growth cone [Evidence NAS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0017146 - N-methyl-D-aspartate selective glutamate receptor complex [Evidence ISS]; GO:0045211 - postsynaptic membrane [Evidence IDA]; GO:0045202 - synapse [Evidence ISS]; GO:0008021 - synaptic vesicle [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016595 - glutamate binding [Evidence ISS]; GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0016594 - glycine binding [Evidence NAS] [Evidence ISS]; GO:0016933 - glycine-gated ion channel activity [Evidence ISS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0003774 - motor activity [Evidence ISS]; GO:0004972 - N-methyl-D-aspartate selective glutamate receptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence IDA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence ISS]; GO:0006812 - cation transport [Evidence ISS]; GO:0007215 - glutamate signaling pathway [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0007611 - learning and/or memory [Evidence ISS]; GO:0048167 - regulation of synaptic plasticity [Evidence ISS]; GO:0045471 - response to ethanol [Evidence NAS]; GO:0007268 - synaptic transmission [Evidence TAS] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : glutamate receptor ionotropic NMDA1 (zeta 1) product : glutamate receptor, ionotropic, NMDA1 (zeta 1) protein_id : NP_032195.1

name	Man1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71534295 CCDS:CCDS15765.1 GeneID:227619 MGI:2684954
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004571 - mannosyl-oligosaccharide 1,2-alpha-mannosidase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030433 - ER-associated protein catabolism [Evidence IMP] codon_start : 1 note : mannosidase alpha class 1B member 1 product : mannosidase, alpha, class 1B, member 1 protein_id : NP_001025154.1

name	Dpp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981425 CCDS:CCDS15766.1 GeneID:83768 MGI:1933213
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : dipeptidyl peptidase 7; dipeptidyl peptidase II product : dipeptidylpeptidase 7 protein_id : NP_114031.2

name	Uap1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794548 CCDS:CCDS15767.1 GeneID:227620 MGI:2443318
definition	GO_function : GO:0016779 - nucleotidyltransferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : UDP-N-acteylglucosamine pyrophosphorylase 1-like 1 protein_id : NP_001028465.1

name	2010317E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487325 GeneID:72080 MGI:1919330
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC72080 protein_id : NP_001074554.1

name	Entpd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753348 CCDS:CCDS15770.1 GeneID:12496 MGI:1096863
definition	GO_component : GO:0005605 - basal lamina [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0030168 - platelet activation [Evidence IDA]; GO:0009181 - purine ribonucleoside diphosphate catabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation note : CD39 antigen-like 1 product : ectonucleoside triphosphate diphosphohydrolase 2 protein_id : NP_033979.1

name	Npdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982836 CCDS:CCDS15771.1 GeneID:18146 MGI:1099802
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : neural proliferation differentiation control-1 protein; neural proliferation differentiation and control gene 1 product : neural proliferation, differentiation and control gene 1 protein_id : NP_032747.2

name	Fut7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305073 CCDS:CCDS15772.1 GeneID:14347 MGI:107692
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008417 - fucosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 product : fucosyltransferase 7 protein_id : NP_038552.1

name	Abca2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225379 CCDS:CCDS15773.1 GeneID:11305 MGI:99606
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005765 - lysosomal membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATP-binding cassette 2; ATP-binding cassette sub-family A (ABC1) member 2 product : ATP-binding cassette, sub-family A (ABC1), member 2 protein_id : NP_031405.2

name	Clic3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229085 CCDS:CCDS15774.1 GeneID:69454 MGI:1916704
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA] codon_start : 1 product : chloride intracellular channel 3 protein_id : NP_081361.1

name	BC029214 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956330 CCDS:CCDS15775.1 GeneID:227622 MGI:2442831
definition	codon_start : 1 product : hypothetical protein LOC227622 protein_id : NP_705785.1

name	Ptgds (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119226208 GeneID:19215 MGI:99261
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005576 - extracellular region [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0005791 - rough endoplasmic reticulum [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0004667 - prostaglandin-D synthase activity [Evidence IEA] [Evidence ISS]; GO:0005501 - retinoid binding [Evidence ISS]; GO:0005215 - transporter activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0001516 - prostaglandin biosynthesis [Evidence IEA] [Evidence ISS]; GO:0045187 - regulation of circadian sleep/wake cycle, sleep [Evidence IDA]; GO:0006810 - transport [Evidence ISS] [Evidence IEA] codon_start : 1 note : prostaglandin D2 synthase (brain) (MGD\|MGI:99261 GB\|NM_008963, evidence: BLASTN, 99%, match=785); putative; lipocalin-type prostaglandin-D synthase; glutathione-independent PGD synthetase; prostaglandin D2 synthase (21 kDa, brain); prostaglandin-H2 D-isomerase product : prostaglandin H2 D-isomerase protein_id : NP_032989.2

name	LOC620156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620156
definition	number : 4 pseudo : _no_value

name	LOC620156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620156
definition	number : 3 pseudo : _no_value

name	LOC620156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620156
definition	number : 2 pseudo : _no_value

name	LOC620156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620156
definition	number : 1 pseudo : _no_value

name	LOC664822 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249218 GeneID:664822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 126 ESTs, 26 Proteins product : similar to ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) pseudo : _no_value transcript_id : XR_030808.1

name	LOC215253 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249221 GeneID:215253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins product : similar to DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 pseudo : _no_value transcript_id : XR_030867.1

name	LOC433410 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249224 GeneID:433410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 13 Proteins product : similar to Heterogeneous nuclear ribonucleoprotein A1 pseudo : _no_value transcript_id : XR_031006.1

name	LOC664938 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249225 GeneID:664938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 39 ESTs, 4 Proteins product : similar to Wwp1 protein pseudo : _no_value transcript_id : XR_002289.2

clone name	MSMg01-485K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396O04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-516D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029O09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-245P04.b	B6Ng01-245P04.g
ACC	GA054699	GA054700
length	1,088	989
definition	B6Ng01-245P04.b	B6Ng01-245P04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(24,197,180 - 24,198,254)	(24,327,636 - 24,328,595)
sequence	gaattctcatagcaacccacatcatggtttccagtattaaacctggttaa tgggtaatgaaactgagatctagagagtctgggcaccctgtctgaggcag tgatgtttcagaatgatgtaagaggattgaaacgtgaggtcagcccaaga actcctttcctgcacactcggaaagaacatactgctggcctttgtggagg tgagagtggtcatgggaagaaggcacagacgaggggagtctgggagccca atctgtccaacctctaggaatagtgtcttcccatctgaatttgggctgag atcagagaaacattactcatcagctatcatgtgggggcaggggggaagga tttcacttggatagctgtctgagggcagctatggagcctcgccattcacc tgccaagtcacatctcttccacagtcttcaagaatgtttgagatgatgat actgatcagatgttctagcaaagtctcgccagtttgctaaagtttggctc ctttagacacttatcctcattaagaatctctagttttcattcaccgctat atcagtagccaccaaaacttcggttttcaaaaaaacaacattctataaaa atctgaaaatggaatgaaaagaataacaaaccctaatatggtaaattaca tattaagaaactgaaagaatgtataacttaatgacattcttgtatcctgc atatagaaatcacatcacttgtaaatatcataatcacaggacaatgtgat ataaataatttgtgcttcacttcaactatattgtcttgtttttcttgtgt taatttttgtcttcctatgaatgcataattaataagaagttgaatatatt taaaggcatagcttaaacatcgtgttataagtttgcagaatattcaccat aatcaaggcttaattaacacatcttcctccttcacataggatccattttc tttctccttcctttttccctccctcctttccccattctggtccctctcaa ttttcttctccttcctttagaaggggaagaggttagttgaaaggctactc accaaccactcttgtcaagtttccagtggtctagtaaa	tagctagcccctcttggctttttgtttgtttgtttgtttttgtcgttttg aaaacccattctttgggttcagagactggtccacaagtccgttgtcatcc caatttctgtagtgatgccacatggagtctgcgggtgtgaagttttctgt ggcgcatacaccagagcgcaagcaacctctctttggttttcgccaaagcc aggccgcctagtatcccctggtacagccatcccagccgcctcagcaaaag tttcctttgcactggggcctgggcggaggcagctcacccttcaccttcca accttccactcatccccgggctaatctagtcttgtagaaaggtctcaaca tctttacagctttattctcaagaatggttcgtgtttcagtgaattatttt gacatctgtaggtcagcattgggctgagcggtctgtaaaccagcagaatt ttttttttttttttttttttttttttgttgcaccggggacaaacttctct aaaagcagaaatttaaaaaaaaaatattttaaaaagatgcgtgagaattt attggtgccacttaaatattaaaatgtaaataataatgtttctatgacca agagagtgtggcaaaaagcaagcagattgtcattaatagaaacactgtaa aacctgcggagaacctgtccctccatacattctgaaaaacctgtcattct agcagcagatgagaagatcaaagaacgcatttgatttgcctgccatcaaa cacctaaaaccggggcgcctcctgagaaagagggggaagttcagccggaa aagatctattttctttgccaggttcctttgctcggcttttgagggggatg agggagggagagttttctttggggaggaagaacttggtgttcaaaaatat aaaagaagttatttgggggttccctcaatttcattcttttgtttcaggga cagtcttatctttcccacccgctctggcaagtttaattt
quality values	Open. Hide. 58 33 33 28 58 54 58 31 26 52 54 58 39 33 58 62 62 42 42 54 46 62 47 47 62 62 62 62 62 32 33 31 14 16 18 23 31 24 50 56 56 46 56 56 62 62 62 59 62 62 49 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 59 51 59 48 48 59 56 62 54 54 62 62 62 62 62 59 54 54 62 62 62 59 59 59 62 62 59 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 56 56 51 32 32 26 37 43 56 62 43 62 47 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 56 62 62 62 47 62 42 62 56 52 62 62 62 52 62 62 62 62 62 54 62 47 39 62 62 62 54 43 62 62 62 62 62 62 62 62 62 62 62 42 52 62 62 52 62 62 62 62 54 54 58 52 58 54 46 54 58 54 58 58 58 50 54 54 46 54 58 54 54 58 58 54 39 49 47 58 58 54 41 39 58 58 58 50 52 48 43 52 52 54 52 54 52 54 54 54 54 54 58 58 58 54 47 50 58 58 58 58 58 54 50 58 52 58 52 52 58 52 58 58 54 52 58 39 35 58 34 41 52 58 54 58 58 58 49 58 50 50 52 50 58 45 30 49 58 48 40 53 50 51 36 53 46 42 38 49 58 41 51 58 58 50 53 53 51 58 34 41 58 35 38 46 31 50 47 41 46 40 50 54 41 54 52 58 41 50 27 49 48 46 49 50 53 31 50 52 41 51 50 53 52 50 39 31 41 29 50 58 58 29 35 52 40 37 32 58 50 36 39 52 50 49 37 33 58 35 39 23 50 39 34 42 39 31 33 40 16 43 28 21 58 33 25 41 42 40 54 39 42 35 31 40 45 53 54 51 35 33 53 39 54 51 51 40 52 53 54 22 20 25 21 33 42 39 28 49 42 39 53 45 50 39 31 54 21 44 24 30 54 27 54 54 54 32 46 24 29 54 22 33 32 23 44 32 37 54 54 51 27 51 26 38 19 33 26 33 26 53 36 39 35 42 29 40 34 28 53 32 26 26 33 33 35 35 51 46 15 22 53 21 13 25 28 32 52 31 32 34 24 42 45 31 34 30 12 13 27 19 24 34 7 6 12 22 33 18 45 14 31 24 45 30 26 9 28 20 33 22 16 29 31 32 34 46 8 16 31 22 24 46 35 28 26 27 35 38 17 37 18 18 20 24 14 22 30 10 7 34 31 14 7 9 42 14 35 30 32 20 12 15 10 9 30 31 27 32 37 21 27 25 33 20 14 19 10 13 12 10 17 7 9 25 16 32 15 19 22 46 48 17 13 10 27 26 16 7 14 30 22 27 19 33 14 42 31 36 32 12 36 13 10 21 31 14 10 16 13 7 25 17 24 29 36 26 6 32 10 17 8 29 23 17 32 32 15 20 27 15 12 11 11 31 33 32 22 16 6 11 20 7 5 16 9 12 6 23 33 48 38 32 10 15 10 6 37 25 21 8 11 6 20 9 22 8 10 11 14 9 11 20 10 28 9 14 21 10 7 11 27 24 28 15 7 6 17 11 31 14 9 18 6 5 17 11 10 5 12 19 8 6 12 38 19 13 12 7 6 5 5 9 8 7 9 5 5 3 9 25 17	Open. Hide. 62 62 18 24 23 16 18 25 25 27 28 28 38 32 32 56 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 49 50 48 32 45 46 59 59 56 56 46 54 54 62 62 62 62 59 62 62 62 62 62 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 50 56 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 23 30 14 15 19 17 17 27 42 27 30 27 20 20 21 19 23 24 28 24 25 17 18 27 27 23 35 28 35 27 28 24 22 52 46 22 31 52 40 27 34 33 37 58 58 58 52 34 32 24 29 34 50 52 49 46 52 52 34 33 24 34 25 32 26 17 19 25 22 16 33 30 26 34 35 28 41 52 32 26 19 26 22 34 21 33 34 35 33 37 34 33 37 39 39 33 47 47 47 27 35 16 17 19 23 37 34 24 22 29 34 16 33 16 21 19 25 25 24 33 21 30 24 28 17 19 12 30 13 29 18 21 31 19 42 39 21 32 35 46 37 37 24 24 25 29 25 27 19 9 31 22 21 20 14 21 18 31 40 26 31 22 24 16 31 33 44 36 26 47 33 44 25 27 31 37 38 32 33 27 39 23 16 31 39 17 29 23 11 31 26 40 30 25 30 30 29 17 42 16 35 21 19 18 37 49 32 40 39 41 46 44 35 29 15 37 29 38 29 31 31 37 42 31 42 32 19 15 13 18 22 23 13 24 30 26 29 13 42 21 15 28 19 21 26 25 34 15 46 37 27 23 39 32 52 31 24 19 30 30 30 33 24 24 27 24 42 31 36 16 37 32 19 39 45 26 18 29 32 27 33 52 40 40 32 28 11 32 47 38 25 23 31 27 21 27 29 32 35 29 18 32 32 53 12 32 11 32 37 40 29 21 29 6 16 18 28 11 10 27 46 18 30 28 46 43 41 9 23 29 20 31 15 28 30 39 31 15 13 32 7 21 9 33 18 26 32 30 25 26 20 6 25 12 31 16 23 28 14 22 22 31 46 46 6 6 25 7 26 30 31 8 15 19 8 6 6 26 6 14 6 16 13 32 11 43 11 21 46 46 18 19 18 31 7 8 31 25 13 29 14 11 6 10 8 20 14 10 15 11 30 9 6 27 10 9 22 6 9 6 12 32 24 11 14 10 23 26 27 12 9 14 10 9 14 6 16 24 8 23 32 41 38 18 26 11 21 13 5 6 10 24 18 26 31 18 13 8 10 8 14 9 37 35 12 9 10 29 28 19 13 24 27 9 6 11 12 16 25 9 6 5 10 10 7 6 32 22 8 21 20 15 19 23 11 10 5 8 5 13 11 10 13 20 18 7 20 23 13 17 10 7 15 30

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_24197180_24198254
seq2: B6Ng01-245P04.b_46_1133

seq1  GAATTCTCATAGCAACCCACATCATGGTTTCCAGTATTAAACCTGGTTAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCATAGCAACCCACATCATGGTTTCCAGTATTAAACCTGGTTAA  50

seq1  TGGGTAATGAAACTGAGATCTAGAGAGTCTGGGCACCCTGTCTGAGGCAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGTAATGAAACTGAGATCTAGAGAGTCTGGGCACCCTGTCTGAGGCAG  100

seq1  TGATGTTTCAGAATGATGTAAGAGGATTGAAACGTGAGGTCAGCCCAAGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATGTTTCAGAATGATGTAAGAGGATTGAAACGTGAGGTCAGCCCAAGA  150

seq1  ACTCCTTTCCTGCACACTCGGAAAGAACATACTGCTGGCCTTTGTGGAGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCCTTTCCTGCACACTCGGAAAGAACATACTGCTGGCCTTTGTGGAGG  200

seq1  TGAGAGTGGTCATGGGAAGAAGGCACAGACGAGGGGAGTCTGGGAGCCCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAGTGGTCATGGGAAGAAGGCACAGACGAGGGGAGTCTGGGAGCCCA  250

seq1  ATCTGTCCAACCTCTAGGAATAGTGTCTTCCCATCTGAATTTGGGCTGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGTCCAACCTCTAGGAATAGTGTCTTCCCATCTGAATTTGGGCTGAG  300

seq1  ATCAGAGAAACATTACTCATCAGCTATCATGTGGGGGCAGGGGGGAAGGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGAGAAACATTACTCATCAGCTATCATGTGGGGGCAGGGGGGAAGGA  350

seq1  TTTCACTTGGATAGCTGTCTGAGGGCAGCTATGGAGCCTCGCCATTCACC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCACTTGGATAGCTGTCTGAGGGCAGCTATGGAGCCTCGCCATTCACC  400

seq1  TGCCAAGTCACATCTCTTCCACAGTCTTCAAGAATGTTTGAGATGATGAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAAGTCACATCTCTTCCACAGTCTTCAAGAATGTTTGAGATGATGAT  450

seq1  ACTGATCAGATGTTCTAGCAAAGTCTCGCCAGTTTGCTAAAGTTTGGCTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGATCAGATGTTCTAGCAAAGTCTCGCCAGTTTGCTAAAGTTTGGCTC  500

seq1  CTTTAGACACTTATCCTCATTAAGAATCTCTAGTTTTCATTCACCGCTAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAGACACTTATCCTCATTAAGAATCTCTAGTTTTCATTCACCGCTAT  550

seq1  ATCAGTAGCCACCAAAACTTCGGTTTTCAAAAAAACAACATTCTATAAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGTAGCCACCAAAACTTCGGTTTTCAAAAAAACAACATTCTATAAAA  600

seq1  ATCTGAAAATGGAATGAAAAGAATAACAAACCCTAATATGGTAAATTACA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGAAAATGGAATGAAAAGAATAACAAACCCTAATATGGTAAATTACA  650

seq1  TATTAAGAAACTGAAAGAATGTATAACTTAATGACATTCTTGTATCCTGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTAAGAAACTGAAAGAATGTATAACTTAATGACATTCTTGTATCCTGC  700

seq1  ATATAGAAATCACATCACTTGTAAATATCATAATCACAGGACAATGTGAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAGAAATCACATCACTTGTAAATATCATAATCACAGGACAATGTGAT  750

seq1  ATAAATAATTTGTGCTTCACTTCAACTATATTGTCTTGTTTTTCTTGTGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAATAATTTGTGCTTCACTTCAACTATATTGTCTTGTTTTTCTTGTGT  800

seq1  TAATTTTTGTCTTCCTATGAATGCATAATTAATAAGAAGTTGAATATATT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTTTTGTCTTCCTATGAATGCATAATTAATAAGAAGTTGAATATATT  850

seq1  T-AAGGCATAGGCTTAACATCGTGTTATAAG-TTGCAGAATATTCACCAT  898
      | |||||||||  | |||||||||||||||| ||||||||||||||||||
seq2  TAAAGGCATAGCTTAAACATCGTGTTATAAGTTTGCAGAATATTCACCAT  900

seq1  AATC-AGGC-TAATTAACACATCTTCCTCC-TCACATAGATCCCATTTTC  945
      |||| |||| |||||||||||||||||||| ||||||||   ||||||||
seq2  AATCAAGGCTTAATTAACACATCTTCCTCCTTCACATAGGATCCATTTTC  950

seq1  TTTCTCCTTCCTTTTT-CCTCCCTCCCTTTCCCCTTCT-GTCCCTCTCAT  993
      |||||||||||||||| ||||||||| || ||| |||| |||||||||| 
seq2  TTTCTCCTTCCTTTTTCCCTCCCTCCTTTCCCCATTCTGGTCCCTCTCAA  1000

seq1  TTTCCTTCTCCTTTCCTTTTAGA--GGGGAGAGG-TAGT--GAAGGCTAC  1038
      ||| |||||||||  | ||||||  ||| ||||| ||||   ||||||||
seq2  TTTTCTTCTCCTT--CCTTTAGAAGGGGAAGAGGTTAGTTGAAAGGCTAC  1048

seq1  TCAGCAACCACTCTTG-CAAGTTT-CAGT-GTTTAGTAAA  1075
      ||| |||||||||||| ||||||| |||| || |||||||
seq2  TCACCAACCACTCTTGTCAAGTTTCCAGTGGTCTAGTAAA  1088

seq1: chr2_24327636_24328595
seq2: B6Ng01-245P04.g_74_1062 (reverse)

seq1  AAATT-AACTTGC---AGACGGTGGG-AAGAT-AGACTGT-CCTGAAACA  43
      ||||| |||||||   ||  |||||| ||||| ||||||| |||||||||
seq2  AAATTAAACTTGCCAGAGCGGGTGGGAAAGATAAGACTGTCCCTGAAACA  50

seq1  AA--GATG-AATTGA-GGAACCCC--AATAACT--CTTTATATTTCTGGA  85
      ||   ||| |||||| ||||||||  |||||||   ||||||||| || |
seq2  AAAGAATGAAATTGAGGGAACCCCCAAATAACTTCTTTTATATTTTTGAA  100

seq1  CACC-AGTTC-TCCTCCC--AAG-AAACTCTCC--TCCTCAT-CCCCTC-  126
      |||| ||||| |||||||  ||| |||||||||   |||||| |||||| 
seq2  CACCAAGTTCTTCCTCCCCAAAGAAAACTCTCCCTCCCTCATCCCCCTCA  150

seq1  AAAGCCGAGC-AAGGAACCTGGCAA--GAAATAGATCTTTTCCGGCTGAA  173
      |||||||||| ||||||||||||||   ||||||||||||||||||||||
seq2  AAAGCCGAGCAAAGGAACCTGGCAAAGAAAATAGATCTTTTCCGGCTGAA  200

seq1  CTTCCCCCTCTTTCTCAGGAGGCG-CCCGGTTTTAGGTGTTTGATGGCAG  222
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  CTTCCCCCTCTTTCTCAGGAGGCGCCCCGGTTTTAGGTGTTTGATGGCAG  250

seq1  GCAAATCAAATGCGTTCTTTGATCTTCTCATCTGCTGCTAGAATGACAGG  272
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAATCAAATGCGTTCTTTGATCTTCTCATCTGCTGCTAGAATGACAGG  300

seq1  TTTTTCAGAATGTATGGAGGGACAGGTTCTCCGCAGGTTTTACAGTGTTT  322
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTCAGAATGTATGGAGGGACAGGTTCTCCGCAGGTTTTACAGTGTTT  350

seq1  CTATTAATGACAATCTGCTTGCTTTTTGCCACACTCTCTTGGTCATAGAA  372
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTAATGACAATCTGCTTGCTTTTTGCCACACTCTCTTGGTCATAGAA  400

seq1  ACATTATTATTTACATTTTAATATTTAAGTGGCACCAATAAATTCTCACG  422
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTATTATTTACATTTTAATATTTAAGTGGCACCAATAAATTCTCACG  450

seq1  CATCTTTTTAAAATATTTTTTTTTTAAATTTCTGCTTTTAGAGAAGTTTG  472
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTTTTTAAAATATTTTTTTTTTAAATTTCTGCTTTTAGAGAAGTTTG  500

seq1  TCCCCGGTGCAAC-AAAAAAAAAAAAAAAAAAAAAAAAAAATTCTGCTGG  521
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  TCCCCGGTGCAACAAAAAAAAAAAAAAAAAAAAAAAAAAAATTCTGCTGG  550

seq1  TTTACAGACCGCTCAGCCCAATGCTGACCTACAGATGTCAAAATAATTCA  571
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACAGACCGCTCAGCCCAATGCTGACCTACAGATGTCAAAATAATTCA  600

seq1  CTGAAACACGAACCATTCTTGAGAATAAAGCTGTAAAGATGTTGAGACCT  621
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAAACACGAACCATTCTTGAGAATAAAGCTGTAAAGATGTTGAGACCT  650

seq1  TTCTACAAGACTAGATTAGCCCGGGGATGAGTGGAAGGTTGGAAGGTGAA  671
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTACAAGACTAGATTAGCCCGGGGATGAGTGGAAGGTTGGAAGGTGAA  700

seq1  GGGTGAGCTGCCTCCGCCCAGGCCCCAGTGCAAAGGAAACTTTTGCTGAG  721
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGAGCTGCCTCCGCCCAGGCCCCAGTGCAAAGGAAACTTTTGCTGAG  750

seq1  GCGGCTGGGATGGCTGTACCAGGGGATACTAGGCGGCCTGGCTTTGGCGA  771
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGCTGGGATGGCTGTACCAGGGGATACTAGGCGGCCTGGCTTTGGCGA  800

seq1  AAACCAAAGAGAGGTTGCTTGCGCTCTGGTGTATGCGCCACAGAAAACTT  821
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCAAAGAGAGGTTGCTTGCGCTCTGGTGTATGCGCCACAGAAAACTT  850

seq1  CACACCCGCAGACTCCATGTGGCATCACTACAGAAATTGGGATGACAACG  871
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACCCGCAGACTCCATGTGGCATCACTACAGAAATTGGGATGACAACG  900

seq1  GACTTGTGGACCAGTCTCTGAACCCAAAGAATGGGTTTTCAAAACGACAA  921
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTTGTGGACCAGTCTCTGAACCCAAAGAATGGGTTTTCAAAACGACAA  950

seq1  AAACAAACAAACAAACAAAAAGCCAAGAGGGGCTAGCTA  960
      |||||||||||||||||||||||||||||||||||||||
seq2  AAACAAACAAACAAACAAAAAGCCAAGAGGGGCTAGCTA  989

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information