MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-263E20
Chromosome	2 (Build37)
Map Location	28,708,107 - 28,873,110
singlet/doublet	doublet
Overlap gene	Ddx31, Barhl1, LOC100033452, 1700101E01Rik
Upstream gene	Col5a1, Fcnb, Olfm1, Gm347, 1700007K13Rik, Mrps2, LOC665412, Gbgt1, Ralgds, Cel, Gtf3c5, Gfi1b, Tsc1, 1700026L06Rik, 1190002A17Rik, LOC665643, Gtf3c4
Downstream gene	LOC100039666, Ttf1, Setx, Ntng2, Crsp8, Rapgef1, LOC433415, OTTMUSG00000012686, Trub2, Coq4, Slc27a4, Urm1, LOC100041002, Ceecam1, Odf2, Gle1l, Spna2, LOC665532
Link	Open Mouse BAC browser

Click to get alignment info.

name	Col5a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12831 MGI:88457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcnb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14134 MGI:1341158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56177 MGI:1860437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Gm347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241289 MGI:2685193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700007K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69327 MGI:1916577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:118451 MGI:2153089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665412 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 2722 ESTs, 6 Proteins pseudo : _no_value

name	Gbgt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227671 MGI:2449143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ralgds (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19730 MGI:107485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cel (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12613 MGI:88374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtf3c5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70239 MGI:1917489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfi1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14582 MGI:1276578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64930 MGI:1929183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700026L06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69987 MGI:1917237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190002A17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68870 MGI:1916120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665643 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665643
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Gtf3c4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269252 MGI:2138937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227674 MGI:2682639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Barhl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54422 MGI:1859288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100033452 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100033452
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	1700101E01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329375 MGI:2685669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	LOC100039666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ttf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22130 MGI:105044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Setx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269254 MGI:2443480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ntng2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171171 MGI:2159341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Crsp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68975 MGI:1916225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rapgef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107746 MGI:104580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC433415 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	OTTMUSG00000012686 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433416 MGI:3650473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trub2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227682 MGI:2442186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coq4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227683 MGI:1098826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc27a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26569 MGI:1347347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Urm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68205 MGI:1915455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Ceecam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99151 MGI:2139134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Odf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18286 MGI:1098824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gle1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74412 MGI:1921662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spna2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20740 MGI:98386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665532 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs

name	Col5a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7656986 GeneID:12831 MGI:88457
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type V, alpha 1 transcript_id : NM_015734.1

name	Fcnb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404439 GeneID:14134 MGI:1341158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ficolin B transcript_id : NM_010190.1

name	Olfm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370352 GeneID:56177 MGI:1860437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin 1 transcript_id : NM_001038613.1

name	Olfm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370358 GeneID:56177 MGI:1860437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin 1 transcript_id : NM_001038614.1

name	Olfm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370356 GeneID:56177 MGI:1860437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin 1 transcript_id : NM_019498.2

name	Olfm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370348 GeneID:56177 MGI:1860437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin 1 transcript_id : NM_001038612.1

name	Gm347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53749209 GeneID:241289 MGI:2685193
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 347, (NCBI) transcript_id : NM_001005420.1

name	1700007K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625741 GeneID:69327 MGI:1916577
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700007K13 gene transcript_id : NM_027040.1

name	Mrps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543264 GeneID:118451 MGI:2153089
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S2 transcript_id : NM_080452.2

name	Gbgt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21105858 GeneID:227671 MGI:2449143
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 transcript_id : NM_139197.1

name	Ralgds (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677734 GeneID:19730 MGI:107485
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ral guanine nucleotide dissociation stimulator transcript_id : NM_009058.1

name	Cel (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753405 GeneID:12613 MGI:88374
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxyl ester lipase transcript_id : NM_009885.1

name	Gtf3c5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22507322 GeneID:70239 MGI:1917489
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor IIIC, polypeptide 5 transcript_id : NM_148928.1

name	Gfi1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328121 GeneID:14582 MGI:1276578
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor independent 1B transcript_id : NM_008114.2

name	Tsc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922702 GeneID:64930 MGI:1929183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tuberous sclerosis 1 transcript_id : NM_022887.3

name	1700026L06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037188 GeneID:69987 MGI:1917237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700026L06 gene transcript_id : NM_027283.1

name	1190002A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76443657 GeneID:68870 MGI:1916120
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190002A17 gene transcript_id : NM_001033874.1

name	Gtf3c4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385912 GeneID:269252 MGI:2138937
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor IIIC, polypeptide 4 transcript_id : NM_172977.2

name	Ddx31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802168 GeneID:227674 MGI:2682639
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31 transcript_id : NM_001033294.2

name	Barhl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346452 GeneID:54422 MGI:1859288
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BarH-like 1 (Drosophila) transcript_id : NM_019446.3

name	1700101E01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366337 GeneID:329375 MGI:2685669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : RIKEN cDNA 1700101E01 gene, transcript variant 1 transcript_id : XM_986644.1

name	Ttf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111154069 GeneID:22130 MGI:105044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription termination factor 1 transcript_id : NM_009442.2

name	Setx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113722130 GeneID:269254 MGI:2443480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : senataxin transcript_id : NM_198033.2

name	Ntng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19424139 GeneID:171171 MGI:2159341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : netrin G2 transcript_id : NM_133500.1

name	Ntng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281647 GeneID:171171 MGI:2159341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : netrin G2 transcript_id : NM_133501.1

name	Crsp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386722 GeneID:68975 MGI:1916225
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 8 transcript_id : NM_026896.2

name	Rapgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875505 GeneID:107746 MGI:104580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF) 1 transcript_id : NM_001039087.1

name	Rapgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875507 GeneID:107746 MGI:104580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF) 1 transcript_id : NM_054050.2

name	Rapgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875503 GeneID:107746 MGI:104580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF) 1 transcript_id : NM_001039086.1

name	LOC433415 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94366325 GeneID:433415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to NG5 protein transcript_id : XM_484985.3

name	OTTMUSG00000012686 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360716 GeneID:433416 MGI:3650473
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000012686 transcript_id : NM_001034887.2

name	Trub2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803129 GeneID:227682 MGI:2442186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TruB pseudouridine (psi) synthase homolog 2 (E. coli) transcript_id : NM_145520.3

name	Coq4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365161 GeneID:227683 MGI:1098826
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coenzyme Q4 homolog (yeast) transcript_id : NM_178693.3

name	Slc27a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374126 GeneID:26569 MGI:1347347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 27 (fatty acid transporter), member 4 transcript_id : NM_011989.2

name	Urm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365925 GeneID:68205 MGI:1915455
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin related modifier 1 homolog (S. cerevisiae) transcript_id : NM_026615.3

name	LOC100041002 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249261 GeneID:100041002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100041002 transcript_id : XM_001477254.1

name	Ceecam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131058 GeneID:99151 MGI:2139134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cerebral endothelial cell adhesion molecule 1 transcript_id : NM_207298.2

name	Odf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129797 GeneID:18286 MGI:1098824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : outer dense fiber of sperm tails 2 transcript_id : NM_013615.2

name	Gle1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130556 GeneID:74412 MGI:1921662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GLE1 RNA export mediator-like (yeast transcript_id : NM_028923.2

name	Spna2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115496849 GeneID:20740 MGI:98386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spectrin alpha 2 transcript_id : NM_001076554.1

name	LOC665532 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94366329 GeneID:665532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs product : hypothetical LOC665532 transcript_id : XM_977598.1

name	Col5a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7656987 CCDS:CCDS15831.1 GeneID:12831 MGI:88457
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : pro-alpha1(V) collagen; procollagen type V alpha 1 product : procollagen, type V, alpha 1 protein_id : NP_056549.1

name	Fcnb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404440 CCDS:CCDS15832.1 GeneID:14134 MGI:1341158
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : ficolin B protein_id : NP_034320.1

name	Olfm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370353 CCDS:CCDS15833.1 GeneID:56177 MGI:1860437
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0051259 - protein oligomerization [Evidence IDA] codon_start : 1 note : isoform c is encoded by transcript variant 3; Noelin 1; Noelin 2; Pancortin 1-4; olfactomedin related ER localized protein product : olfactomedin 1 isoform c protein_id : NP_001033702.1

name	Olfm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370359 GeneID:56177 MGI:1860437
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0051259 - protein oligomerization [Evidence IDA] codon_start : 1 note : isoform d is encoded by transcript variant 4; Noelin 1; Noelin 2; Pancortin 1-4; olfactomedin related ER localized protein product : olfactomedin 1 isoform d protein_id : NP_001033703.1

name	Olfm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370357 CCDS:CCDS15834.1 GeneID:56177 MGI:1860437
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0051259 - protein oligomerization [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1; Noelin 1; Noelin 2; Pancortin 1-4; olfactomedin related ER localized protein product : olfactomedin 1 isoform a protein_id : NP_062371.2

name	Olfm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370349 CCDS:CCDS15835.1 GeneID:56177 MGI:1860437
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0051259 - protein oligomerization [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2; Noelin 1; Noelin 2; Pancortin 1-4; olfactomedin related ER localized protein product : olfactomedin 1 isoform b protein_id : NP_001033701.1

name	Gm347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53749210 CCDS:CCDS15836.1 GeneID:241289 MGI:2685193
definition	codon_start : 1 product : hypothetical protein LOC241289 protein_id : NP_001005420.1

name	1700007K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625742 CCDS:CCDS15837.1 GeneID:69327 MGI:1916577
definition	codon_start : 1 product : hypothetical protein LOC69327 protein_id : NP_081316.1

name	Mrps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543265 CCDS:CCDS15838.1 GeneID:118451 MGI:2153089
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mitochondrial ribosomal protein S2 protein_id : NP_536700.2

name	Gbgt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21105859 CCDS:CCDS15839.1 GeneID:227671 MGI:2449143
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence TAS] GO_function : GO:0047277 - globoside alpha-N-acetylgalactosaminyltransferase activity [Evidence IDA] [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0030259 - lipid glycosylation [Evidence TAS] codon_start : 1 exception : mismatches in translation note : forssman glycolipid synthetase product : globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 protein_id : NP_631936.1

name	Ralgds (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677735 CCDS:CCDS15840.1 GeneID:19730 MGI:107485
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ral guanine nucleotide dissociation stimulator protein_id : NP_033084.1

name	Cel (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753406 CCDS:CCDS15841.1 GeneID:12613 MGI:88374
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0004104 - cholinesterase activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA]; GO:0004771 - sterol esterase activity [Evidence IEA]; GO:0004806 - triacylglycerol lipase activity [Evidence IEA] GO_process : GO:0046514 - ceramide catabolism [Evidence IMP]; GO:0006707 - cholesterol catabolism [Evidence ISS]; GO:0009062 - fatty acid catabolism [Evidence ISS]; GO:0044258 - intestinal lipid catabolism [Evidence ISS]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0018350 - protein amino acid esterification [Evidence ISS] codon_start : 1 product : carboxyl ester lipase protein_id : NP_034015.1

name	Gtf3c5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507323 CCDS:CCDS15842.1 GeneID:70239 MGI:1917489
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TFIIICepsilon product : general transcription factor III polypeptide 5 protein_id : NP_683730.1

name	Gfi1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679991 CCDS:CCDS15843.1 GeneID:14582 MGI:1276578
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : growth factor independent 1B protein_id : NP_032140.1

name	Tsc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:79750409 CCDS:CCDS15844.1 GeneID:64930 MGI:1929183
definition	codon_start : 1 product : tuberous sclerosis 1 protein_id : NP_075025.2

name	1700026L06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037189 CCDS:CCDS15845.1 GeneID:69987 MGI:1917237
definition	codon_start : 1 product : Rsb-66 protein protein_id : NP_081559.1

name	1190002A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76443658 CCDS:CCDS15846.1 GeneID:68870 MGI:1916120
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0019201 - nucleotide kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68870 protein_id : NP_001029046.1

name	Gtf3c4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370486 CCDS:CCDS15847.1 GeneID:269252 MGI:2138937
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004402 - histone acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : general transcription factor IIIC, polypeptide 4 protein_id : NP_766565.1

name	Ddx31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677496 CCDS:CCDS15848.1 GeneID:227674 MGI:2682639
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31 protein_id : NP_001028466.1

name	Barhl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506423 CCDS:CCDS15849.1 GeneID:54422 MGI:1859288
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0001764 - neuron migration [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : transcription factor product : BarH-like 1 protein_id : NP_062319.1

name	1700101E01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366338 GeneID:329375 MGI:2685669
definition	codon_start : 1 product : similar to FLJ46082 protein isoform 1 protein_id : XP_991738.1

name	Ttf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111154070 GeneID:22130 MGI:105044
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003716 - RNA polymerase I transcription termination factor activity [Evidence IDA] GO_process : GO:0006338 - chromatin remodeling [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006361 - transcription initiation from RNA polymerase I promoter [Evidence IDA] codon_start : 1 product : transcription termination factor 1 protein_id : NP_033468.2

name	Setx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113722131 GeneID:269254 MGI:2443480
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : amyotrophic lateral sclerosis 4 homolog product : senataxin protein_id : NP_932150.2

name	Ntng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19424140 CCDS:CCDS15851.1 GeneID:171171 MGI:2159341
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant a; laminet 2 product : netrin G2 isoform a protein_id : NP_598007.1

name	Ntng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281648 CCDS:CCDS15852.1 GeneID:171171 MGI:2159341
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant b; laminet 2 product : netrin G2 isoform b protein_id : NP_598008.1

name	Crsp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76253678 CCDS:CCDS15853.1 GeneID:68975 MGI:1916225
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0003713 - transcription coactivator activity [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence ISS] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcriptional co-activator CRSP8 homolog protein_id : NP_081172.2

name	Rapgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875506 GeneID:107746 MGI:104580
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence TAS] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0048008 - platelet-derived growth factor receptor signaling pathway [Evidence IMP]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; guanine nucleotide releasing factor 2 product : Rap guanine nucleotide exchange factor (GEF) 1 isoform 1 protein_id : NP_001034176.1

name	Rapgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905083 CCDS:CCDS15854.1 GeneID:107746 MGI:104580
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence TAS] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0048008 - platelet-derived growth factor receptor signaling pathway [Evidence IMP]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; guanine nucleotide releasing factor 2 product : Rap guanine nucleotide exchange factor (GEF) 1 isoform 3 protein_id : NP_473391.1

name	Rapgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875504 GeneID:107746 MGI:104580
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence TAS] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0048008 - platelet-derived growth factor receptor signaling pathway [Evidence IMP]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; guanine nucleotide releasing factor 2 product : Rap guanine nucleotide exchange factor (GEF) 1 isoform 2 protein_id : NP_001034175.1

name	LOC433415 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94366326 GeneID:433415
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484985.3

name	OTTMUSG00000012686 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702238 GeneID:433416 MGI:3650473
definition	codon_start : 1 product : hypothetical protein LOC433416 protein_id : NP_001030059.1

name	Trub2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560759 CCDS:CCDS15856.1 GeneID:227682 MGI:2442186
definition	codon_start : 1 exception : mismatches in translation product : TruB pseudouridine (psi) synthase homolog 2 protein_id : NP_663495.2

name	Coq4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520093 CCDS:CCDS15857.1 GeneID:227683 MGI:1098826
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : coenzyme Q4 homolog protein_id : NP_848808.1

name	Slc27a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45597453 CCDS:CCDS15858.1 GeneID:26569 MGI:1347347
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0001676 - long-chain fatty acid metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fatty acid transport protein 4 product : solute carrier family 27 (fatty acid transporter), member 4 protein_id : NP_036119.1

name	Urm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311875 CCDS:CCDS15859.1 GeneID:68205 MGI:1915455
definition	codon_start : 1 product : ubiquitin related modifier 1 homolog protein_id : NP_080891.1

name	LOC100041002 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249262 GeneID:100041002
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477304.1

name	Ceecam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46411176 CCDS:CCDS15860.1 GeneID:99151 MGI:2139134
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007155 - cell adhesion [Evidence ISS] codon_start : 1 product : cerebral endothelial cell adhesion molecule 1 protein_id : NP_997181.1

name	Odf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305339 CCDS:CCDS15861.1 GeneID:18286 MGI:1098824
definition	GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence TAS] codon_start : 1 note : cenexin product : outer dense fiber of sperm tails 2 protein_id : NP_038643.1

name	Gle1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037369 CCDS:CCDS15862.1 GeneID:74412 MGI:1921662
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0016973 - poly(A)+ mRNA export from nucleus [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : GLE1 RNA export mediator-like (yeast protein_id : NP_083199.1

name	LOC665532 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94366330 GeneID:665532
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982692.1

name	Spna2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115496850 GeneID:20740 MGI:98386
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA] codon_start : 1 note : alpha-spectrin 2, brain; alpha-fodrin product : spectrin alpha 2 protein_id : NP_001070022.1

name	LOC665643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665643
definition	number : 1 pseudo : _no_value

name	LOC100039666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039666
definition	number : 1 pseudo : _no_value

name	LOC665412 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249258 GeneID:665412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 2722 ESTs, 6 Proteins product : similar to hCG1997137 pseudo : _no_value transcript_id : XR_032795.1

clone name	MSMg01-158D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483A05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-130J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-266H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-358B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B10
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-263E20.b	B6Ng01-263E20.g
ACC	GA067506	GA067507
length	1,108	1,157
definition	B6Ng01-263E20.b	B6Ng01-263E20.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(28,708,107 - 28,709,213)	(28,871,950 - 28,873,110)
sequence	gaattccaaggatatatagggtagaaccaaagcctcaccttccccaggca ggttgtctcttctgaggggcggcctgtcccagtcatcaaagaggattgca cactttcccgtcacctttttatgcggagtcctttgtttctgctttgtgct aagcacacaggtgtttgtatatgctatcacttgccctcttttgataagga tgtggtctagaccaacctcaccctgttcttgtggattgcagttgtgctgc tgttgtcaagccttgggtagtttgtcactgtgtcacctggttgtgctgct tgcttgtattgctgctttgtggcagggtctcatgtagctctgaccttgct cctcctcctttgcctttcattatgtgagtgtcataaattactgagccttg cccatattggcaagtggcattcatacattacgtccagtattgtgccgcag acaacagttacaattctgggcatctgtgaaatattcttcagctcctttac acacatgtggctgtgtaggaataattcctggaagtgggattagttttgtg ttaatagctaatgccaacattgatctgttaggggttttactgctgtgtat gccttccagcagtgtggtatctggtcacggcccatcagtacacgaatgct ttacaagtctttctgtatttgattctattccaaacccaagttgctcttgt aacctctatgtgtggtgctgccttaggactgctacagctttaagtcactt catgtgggatgttttctcataagtgtgtcttagtggcttcccgggacatc tggtaggactggactgccttatagtttgaactcatttagggggagggagc agtcacggtgatactgattcttctcgaggagagaatacatctttcctttc aaaaaattctgcccctcgggtgtgttttagttgttcttcatctagaataa cttcctcatcactttttatattgagtccttttttttttttgaaattttcc cactgtgtgatccaggtctaacactagactccagatttcccctcctcagt ttcctaagtgcttggatgtaaacaccagcaatcattctataaactttcaa tatatttt	gaattcatccctttcctcccacaggttgtcctctgacttctcccgtcctg cgtgcatgcaaatacccctcacatgaacaggcgagcgtgcatgcatacac atgggtcaattttacatttttgtaatctcttacctaaataaaaatgttta cgtattaaataacatgaacactgactagcatgaagctcttggcacagtgc ctgggttattgtgacagacacaggcatcatagagcatgtgtcctatgctc atggcgatctttgcttctgactcttatgaccactcgtgatgttcgggccc catggacgtgggtggtgctcagaggtgcttgcaggttggacacgtgaggc gggacagcctctaagttagacagaacccacaatgcgtgttcgaggacata tgtaggtgcaaggctctgctctcacctaccgccatgatggcagagtcagt agcaccagcaggcttcccttggcttggggaccacacttcccctcctgccc tgtccccagcagccaagggggacaagccttagaagcgggagcagcttgct tcctcaagccaagcaagctataaatctcaaggtttaatcatgacttcatg atcattcagcaaagagcagcagaggattcattctaccgggaactgcagag gggagaccgcggggggctgttgtgggggttattggtttagcagaggcaga actgttcccctgggcccttctggagaccgccgatgaacgatgacaccgat ggccgtaacaaggcaattactggtgtgcacagcaatgctttgttaatgac agacaggcttctgtgagtgccgggtggtggcctttgttgtgaggcggctg cgtcaatctgcctggcagagcagagtgactgggaaccctcccatggctgt gctagagcctgcgtccttgagaatgtagtaagcattttttaaaagcccca aagggttcctttccagtcttctctgcaaatgttaagaggaagagaaatca agaaatccagagaggactctggtggtcccttgcacgcggcagtactaata tctgtttacttgaacatctcggctcgtcatttatggaaagaagaatagag tccagagagggagcgaattagtactgtcacagtcggcctccaatctcaga gtgagtc
quality values	Open. Hide. 49 31 28 31 62 62 31 11 47 62 62 37 31 42 47 62 62 49 62 62 49 62 62 62 62 62 62 59 46 62 62 62 51 56 48 40 28 32 54 59 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 48 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 49 31 62 62 62 62 62 62 62 62 62 62 62 47 58 58 54 58 58 58 58 58 58 54 58 46 54 46 58 58 54 58 58 58 54 54 58 58 58 54 58 52 54 58 58 58 48 58 58 54 52 54 58 58 58 58 58 54 58 54 54 52 58 58 58 58 58 52 46 35 52 58 52 52 52 58 54 54 49 52 53 49 58 58 58 58 50 51 50 51 50 58 39 43 47 50 58 58 49 43 49 52 54 50 50 48 58 48 48 58 52 51 58 58 40 50 52 58 50 51 51 58 58 46 47 58 58 50 50 51 58 58 47 51 39 58 53 49 52 39 53 37 41 19 58 58 50 58 43 32 51 46 58 52 50 49 47 50 39 50 51 38 41 29 41 58 51 47 42 50 53 58 49 58 39 58 39 31 47 32 47 52 42 52 51 50 50 30 41 53 29 52 53 41 38 34 42 37 37 53 53 54 42 39 53 32 42 39 37 52 34 54 39 37 32 53 39 54 54 50 38 24 49 24 54 54 41 41 40 45 35 40 29 47 40 40 51 30 49 31 38 28 40 53 22 39 46 35 30 32 29 33 49 35 40 54 42 18 24 32 45 31 32 29 51 35 24 8 52 34 29 24 16 49 27 18 32 31 28 33 33 26 32 31 31 40 45 53 40 34 42 28 32 31 32 32 38 51 18 25 13 51 51 51 46 32 21 51 30 31 19 35 31 28 28 29 26 22 21 24 13 33 33 23 25 26 31 31 43 32 31 27 36 19 17 29 26 10 43 17 19 31 15 32 14 31 13 21 16 31 28 34 32 31 48 42 31 30 29 41 33 15 19 46 48 48 48 14 22 29 28 27 21 15 46 46 23 16 22 8 46 48 26 31 24 31 31 46 48 31 38 27 29 21 34 17 20 28 24 21 26 14 15 29 29 32 17 34 22 28 31 28 33 17 32 21 34 31 24 27 31 32 27 31 23 48 44 41 13 19 7 22 16 31 29 30 18 31 18 24 22 48 39 39 31 39 29 34 11 28 31 14 6 24 47 10 30 39 39 18 12 47 18 12 32 17 20 9 21 22 22 28 27 21 22 14 31 11 18 22 22 14 7 7 14 25 7 5 3 17 9 8 6 5 6 7 21 3 21 11 24 28 31 18 15 21 9 10 13 24 16 13 27 10 17 18 18 20 14 6 7 21 17 10 13 12 7 4 5 7 9 21 23 10 18 8 15 25 17 4 3 4 10 9 21 7 18 5 3 2 2 5 6 12 16 10 6 24 8 16 8 16 6 15 8 12 12 17 17 9	Open. Hide. 62 47 51 59 62 59 50 59 62 59 51 51 32 32 32 32 48 56 56 59 49 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 35 43 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 42 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 45 42 58 58 58 58 58 58 54 58 52 58 58 54 58 58 58 58 54 58 58 58 58 58 58 58 49 58 58 58 54 58 58 54 54 58 58 58 58 43 52 58 58 54 58 58 58 58 58 58 54 58 58 58 54 58 51 49 50 58 58 51 58 49 48 58 54 58 50 58 58 58 58 58 58 58 41 58 58 58 51 54 50 51 58 53 49 50 54 51 58 58 52 58 39 51 51 40 58 41 47 39 14 58 28 32 51 51 49 51 58 53 49 49 51 53 47 51 58 58 29 33 54 58 51 52 39 58 40 58 58 58 51 46 36 29 43 35 44 51 51 58 58 58 58 42 44 51 47 39 50 50 54 58 58 58 43 51 52 31 33 40 46 27 44 54 42 40 32 51 53 31 54 15 51 37 49 42 54 28 34 53 53 40 54 40 50 50 42 29 33 40 46 35 35 26 41 52 42 37 46 44 46 19 29 40 32 37 40 52 24 54 35 39 46 28 31 29 53 37 39 35 32 34 40 36 34 52 34 47 51 26 47 39 32 42 32 52 32 31 31 51 31 40 31 32 40 32 32 36 51 47 32 52 40 53 33 29 32 34 32 30 23 29 31 40 21 31 51 52 41 32 28 26 31 31 39 31 31 32 31 35 32 34 32 46 31 29 22 31 35 45 30 30 41 25 31 30 20 25 18 51 25 17 12 32 29 45 34 14 27 31 41 16 25 33 18 27 26 31 32 10 31 16 32 38 32 43 28 25 25 30 28 14 6 9 31 36 23 9 15 11 7 16 21 30 17 35 9 31 26 12 32 9 30 39 26 23 31 31 47 29 31 39 7 41 13 21 19 46 31 32 30 31 30 13 21 22 31 25 27 11 14 20 39 21 22 30 31 34 32 31 34 28 30 26 27 31 32 18 34 31 32 25 10 19 16 18 23 30 18 31 24 27 48 44 48 44 14 17 28 38 25 18 29 44 44 13 8 30 12 32 43 26 8 11 30 14 24 28 32 10 12 19 10 10 20 8 24 13 11 19 31 32 31 21 48 25 32 34 13 24 16 29 12 19 6 11 27 18 10 33 11 21 48 25 20 13 7 3 3 3 28 21 5 15 17 4 5 22 9 14 8 23 13 5 14 18 13 8 5 7 11 21 6 14 28 18 9 13 24 16 5 9 5 11 7 21 11 15 34 5 7 23 9 15 28 27 20 26 14 12 10 17 34 20 21 21 7 10 7 16 10 12 6 7 7 12 13 7 10 11 9 3 1 3 11 5 5 13 17 9 11 16 7 3 14 8 4 10 11 5 14 16 6 4 5 12 14 6 7 12 8 5 22 6 7 4 14 3 5 4 5 6 23 5 8 12 5 14 7 8 8 4 6 4 3 3 5 4 1 1 3 3 12 15 8 7 4 10 3 3 7 3 4 9 8 6 16 7 8 9 20 7 9 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_28708107_28709213
seq2: B6Ng01-263E20.b_42_1149

seq1  GAATTCCAAGGATATATAGGGTAGAACCAAAGCCTCACCTTCCCCAGGCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAAGGATATATAGGGTAGAACCAAAGCCTCACCTTCCCCAGGCA  50

seq1  GGTTGTCTCTTCTGAGGGGCGGCCTGTCCCAGTCATCAAAGAGGATTGCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTGTCTCTTCTGAGGGGCGGCCTGTCCCAGTCATCAAAGAGGATTGCA  100

seq1  CACTTTCCCGTCACCTTTTTATGCGGAGTCCTTTGTTTCTGCTTTGTGCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTTTCCCGTCACCTTTTTATGCGGAGTCCTTTGTTTCTGCTTTGTGCT  150

seq1  AAGCACACAGGTGTTTGTATATGCTATCACTTGCCCTCTTTTGATAAGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCACACAGGTGTTTGTATATGCTATCACTTGCCCTCTTTTGATAAGGA  200

seq1  TGTGGTCTAGACCAACCTCACCCTGTTCTTGTGGATTGCAGTTGTGCTGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGTCTAGACCAACCTCACCCTGTTCTTGTGGATTGCAGTTGTGCTGC  250

seq1  TGTTGTCAAGCCTTGGGTAGTTTGTCACTGTGTCACCTGGTTGTGCTGCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGTCAAGCCTTGGGTAGTTTGTCACTGTGTCACCTGGTTGTGCTGCT  300

seq1  TGCTTGTATTGCTGCTTTGTGGCAGGGTCTCATGTAGCTCTGACCTTGCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTGTATTGCTGCTTTGTGGCAGGGTCTCATGTAGCTCTGACCTTGCT  350

seq1  CCTCCTCCTTTGCCTTTCATTATGTGAGTGTCATAAATTACTGAGCCTTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTCCTTTGCCTTTCATTATGTGAGTGTCATAAATTACTGAGCCTTG  400

seq1  CCCATATTGGCAAGTGGCATTCATACATTACGTCCAGTATTGTGCCGCAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATATTGGCAAGTGGCATTCATACATTACGTCCAGTATTGTGCCGCAG  450

seq1  ACAACAGTTACAATTCTGGGCATCTGTGAAATATTCTTCAGCTCCTTTAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAACAGTTACAATTCTGGGCATCTGTGAAATATTCTTCAGCTCCTTTAC  500

seq1  ACACATGTGGCTGTGTAGGAATAATTCCTGGAAGTGGGATTAGTTTTGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACATGTGGCTGTGTAGGAATAATTCCTGGAAGTGGGATTAGTTTTGTG  550

seq1  TTAATAGCTAATGCCAACATTGATCTGTTAGGGGTTTTACTGCTGTGTAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATAGCTAATGCCAACATTGATCTGTTAGGGGTTTTACTGCTGTGTAT  600

seq1  GCCTTCCAGCAGTGTGGTATCTGGTCACGGCCCATCAGTACACGAATGCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTCCAGCAGTGTGGTATCTGGTCACGGCCCATCAGTACACGAATGCT  650

seq1  TTACAAGTCTTTCTGTATTTGATTCTATTCCAAACCCAAGTTGCTCTTGT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACAAGTCTTTCTGTATTTGATTCTATTCCAAACCCAAGTTGCTCTTGT  700

seq1  AACCTCTATGTGTGGTGCTGCCTTAGGACTGCTACAGCTTTAAGTCACTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCTCTATGTGTGGTGCTGCCTTAGGACTGCTACAGCTTTAAGTCACTT  750

seq1  CATGTGGGATGTTTTCTCATAAGTGTGTCTTAGTGGCTTCCCGGGACATC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTGGGATGTTTTCTCATAAGTGTGTCTTAGTGGCTTCCCGGGACATC  800

seq1  TGGTAGGACTGGACTGCCTTATAGTTTGAACTCATTTAGGGGGAGGGAGC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTAGGACTGGACTGCCTTATAGTTTGAACTCATTTAGGGGGAGGGAGC  850

seq1  AGTCACGGTGATACTGATTCTTCTCGAGGAGAGAATACATCTTTCCTTTC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCACGGTGATACTGATTCTTCTCGAGGAGAGAATACATCTTTCCTTTC  900

seq1  AAAAAATTCTGCCCCTCGGGTGTGTTTTAGTTGTTCTTCATCTAGAATAA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAATTCTGCCCCTCGGGTGTGTTTTAGTTGTTCTTCATCTAGAATAA  950

seq1  CTTCCTCATCACTTTTTAATATTGAGTCCTTTTTTTTTTTTGAAATTTTC  1000
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  CTTCCTCATCACTTTTT-ATATTGAGTCCTTTTTTTTTTTTGAAATTTTC  999

seq1  CCACTGTGTGATCCAGGTCT-ACACTAGACT-CAGAATTCCCCTCCTCAG  1048
      |||||||||||||||||||| |||||||||| |||| |||||||||||||
seq2  CCACTGTGTGATCCAGGTCTAACACTAGACTCCAGATTTCCCCTCCTCAG  1049

seq1  -TTCCTAAGTGCTGGGATTGTAAACACCAGCCATCATTCCTTATAAACTT  1097
       |||||||||||| ||| ||||||||||||| |||||||  |||||||||
seq2  TTTCCTAAGTGCTTGGA-TGTAAACACCAGCAATCATTC--TATAAACTT  1096

seq1  --CATATATTTT  1107
         |||||||||
seq2  TCAATATATTTT  1108

seq1: chr2_28871950_28873110
seq2: B6Ng01-263E20.g_68_1224 (reverse)

seq1  GACTCACTCTGGGAATTGGGAGGCCGGCTGTGTGACAGTTACTAA-TCGC  49
      ||||||||||| ||  | |||||||| |  |||||||| |||||| ||||
seq2  GACTCACTCTGAGA--TTGGAGGCCGAC--TGTGACAG-TACTAATTCGC  45

seq1  TCCCTCTCTGGGCCTCT-TTCTTCTTTCCCATAAAATGAAGGAGCCGAGA  98
      ||||||||| || |||| ||||||||| |||| ||||| | |||||||||
seq2  TCCCTCTCT-GGACTCTATTCTTCTTT-CCAT-AAATG-ACGAGCCGAGA  91

seq1  TGTTC-AGTAAACAGATATTAGGTACCTGCCGCGTGCAAGGGACCA-CAG  146
      ||||| ||||||||||||||| ||| |||||||||||||||||||| |||
seq2  TGTTCAAGTAAACAGATATTA-GTA-CTGCCGCGTGCAAGGGACCACCAG  139

seq1  AGTCCTCTCTGGGTTTCCTTGATTTCTCTTCCTCTTTAACATTTGCAGAG  196
      |||||||||||| ||| ||||||||||||||||| |||||||||||||||
seq2  AGTCCTCTCTGGATTT-CTTGATTTCTCTTCCTC-TTAACATTTGCAGAG  187

seq1  AAGACTGGAAAGGA--CCCTTGGGGCTTTTAAAAAATGCTTACTACATTC  244
      ||||||||||||||  || |||||||||||||||||||||||||||||||
seq2  AAGACTGGAAAGGAACCCTTTGGGGCTTTTAAAAAATGCTTACTACATTC  237

seq1  TCAAGGACGCAGGCTCTAGCACAGCCATGGGA-GGTTCCCAGTCACTCTG  293
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  TCAAGGACGCAGGCTCTAGCACAGCCATGGGAGGGTTCCCAGTCACTCTG  287

seq1  CTCTGCCAGGCAGA-TGACGCAGCCGCCTCACAACAAAGGCCACCA-CCG  341
      |||||||||||||| ||||||||||||||||||||||||||||||| |||
seq2  CTCTGCCAGGCAGATTGACGCAGCCGCCTCACAACAAAGGCCACCACCCG  337

seq1  GCACTCACAGAAGCCTGTCTGTCATTAACAAAGCATTGCTGTGCACACCA  391
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTCACAGAAGCCTGTCTGTCATTAACAAAGCATTGCTGTGCACACCA  387

seq1  GTAATTGCCTTGTTACGGCCATCGGTGTCATCGTTCATCGGCGGTCTCCA  441
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAATTGCCTTGTTACGGCCATCGGTGTCATCGTTCATCGGCGGTCTCCA  437

seq1  GAAGGGCCCAGGGGAACAGTTCTGCCTCTGCTAAACCAATAACCCCCACA  491
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGGCCCAGGGGAACAGTTCTGCCTCTGCTAAACCAATAACCCCCACA  487

seq1  ACAGCCCCCCGCGGTCTCCCCTCTGCAGTTCCCGGTAGAATGAATCCTCT  541
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCCCCCCGCGGTCTCCCCTCTGCAGTTCCCGGTAGAATGAATCCTCT  537

seq1  GCTGCTCTTTGCTGAATGATCATGAAGTCATGATTAAACCTTGAGATTTA  591
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCTCTTTGCTGAATGATCATGAAGTCATGATTAAACCTTGAGATTTA  587

seq1  TAGCTTGCTTGGCTTGAGGAAGCAAGCTGCTCCCGCTTCTAAGGCTTGTC  641
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTTGCTTGGCTTGAGGAAGCAAGCTGCTCCCGCTTCTAAGGCTTGTC  637

seq1  CCCCTTGGCTGCTGGGGACAGGGCAGGAGGGGAAGTGTGGTCCCCAAGCC  691
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTTGGCTGCTGGGGACAGGGCAGGAGGGGAAGTGTGGTCCCCAAGCC  687

seq1  AAGGGAAGCCTGCTGGTGCTACTGACTCTGCCATCATGGCGGTAGGTGAG  741
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGGAAGCCTGCTGGTGCTACTGACTCTGCCATCATGGCGGTAGGTGAG  737

seq1  AGCAGAGCCTTGCACCTACATATGTCCTCGAACACGCATTGTGGGTTCTG  791
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGAGCCTTGCACCTACATATGTCCTCGAACACGCATTGTGGGTTCTG  787

seq1  TCTAACTTAGAGGCTGTCCCGCCTCACGTGTCCAACCTGCAAGCACCTCT  841
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAACTTAGAGGCTGTCCCGCCTCACGTGTCCAACCTGCAAGCACCTCT  837

seq1  GAGCACCACCCACGTCCATGGGGCCCGAACATCACGAGTGGTCATAAGAG  891
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCACCACCCACGTCCATGGGGCCCGAACATCACGAGTGGTCATAAGAG  887

seq1  TCAGAAGCAAAGATCGCCATGAGCATAGGACACATGCTCTATGATGCCTG  941
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAAGCAAAGATCGCCATGAGCATAGGACACATGCTCTATGATGCCTG  937

seq1  TGTCTGTCACAATAACCCAGGCACTGTGCCAAGAGCTTCATGCTAGTCAG  991
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTGTCACAATAACCCAGGCACTGTGCCAAGAGCTTCATGCTAGTCAG  987

seq1  TGTTCATGTTATTTAATACGTAAACATTTTTATTTAGGTAAGAGATTACA  1041
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCATGTTATTTAATACGTAAACATTTTTATTTAGGTAAGAGATTACA  1037

seq1  AAAATGTAAAATTGACCCATGTGTATGCATGCACGCTCGCCTGTTCATGT  1091
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATGTAAAATTGACCCATGTGTATGCATGCACGCTCGCCTGTTCATGT  1087

seq1  GAGGGGTATTTGCATGCACGCAGGACGGGAGAAGTCAGAGGACAACCTGT  1141
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGGTATTTGCATGCACGCAGGACGGGAGAAGTCAGAGGACAACCTGT  1137

seq1  GGGAGGAAAGGGATGAATTC  1161
      ||||||||||||||||||||
seq2  GGGAGGAAAGGGATGAATTC  1157

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information