MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-268P03
Chromosome	2 (Build37)
Map Location	87,294,801 - 87,448,678
singlet/doublet	doublet
Overlap gene	Olfr1126, Pramel7, Pramel6, LOC668439, Olfr1127-ps1, Olfr253-ps1, Olfr1128, LOC100042038, LOC668445, LOC668447, Olfr1129, Olfr1130
Upstream gene	Olfr1066, Olfr1069-ps1, Olfr1070-ps1, Olfr228, Olfr1073-ps1, Olfr1075-ps1, GA_x5J8B7W4CQV-104617-103730, Olfr1076, LOC625853, Olfr1078-ps1, GA_x5J8B7W4CQV-78329-78805, Olfr1079, Olfr1080, Olfr1081-ps1, Olfr1082, GA_x5J8B7W4CQV-18360-18784, Olfr1083, Olfr1084, Olfr1085, Olfr1086, Olfr1087, Olfr1088-ps1, Olfr1089, Olfr1090, Olfr1091-ps1, GA_x5J8B7W3Y5M-123838-124302, Olfr1093, Olfr141, Olfr1094, Olfr1095, Olfr1096-ps1, Olfr1097, Olfr1098, Olfr1099, Olfr1100, Olfr1101, Olfr1102, Olfr1103-ps1, Olfr1104, Olfr1105, Olfr1106, Olfr1107, GA_x5J8B7W3Y5M-419033-418135, Olfr1109, Olfr259, LOC668402, Olfr1110, Olfr1111, Olfr1112, LOC228238, Olfr1113, Olfr1114-ps1, LOC546767, Olfr1115, Olfr1521-ps1, LOC100041923, Olfr1117-ps1, GA_x5J8B7TY7N2-4-429, LOC668424, Olfr1118, Olfr1119-ps1, Olfr1120, Olfr1121, Olfr1122, LOC668432, Olfr1123, Olfr1125
Downstream gene	Olfr1131, Olfr1132, LOC100042076, Olfr1133, Olfr1134, Olfr1135, Olfr1136, Olfr1137, Olfr1138, GA_x5J8B7W3Y5M-1033291-1033773, Olfr1140, Olfr1141, Olfr152, Olfr1142-ps1, Olfr1143, GA_x5J8B7W3Y5M-1094074-1093275, Olfr1145, Olfr1146-ps1, Olfr1147-ps1, Olfr1148, Olfr1149-ps1, Olfr1150-ps1, Olfr1151, Olfr1152, Olfr1153, Olfr1154, Olfr1155, Olfr1156, Olfr1157, Olfr74, Olfr1158, Olfr1159-ps1, Olfr1160, Olfr1161, Olfr73, Olfr1162, Olfr1163, Olfr1164, Olfr1165, Olfr1166, Olfr1167, Olfr1168, Olfr1169-ps1, Olfr1170, Olfr1171-ps1, Olfr1172-ps1, Olfr1173, Olfr1174, Olfr1175, Olfr1176, Olfr1177, Olfr1178, Olfr1179, Olfr1180, Olfr1181, Olfr1182, Olfr1183, Olfr1184, Olfr1185-ps1, Olfr1186, Olfr1187-ps1, Olfr1188, LOC668528, Olfr1189, GA_x5J8B7W4NS2-37772-38277
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr1066 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257880 MGI:3030900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1069-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404465 MGI:3030903
definition	gene_synonym : MOR189-8_p note : olfactory receptor 1069, pseudogene 1 pseudo : _no_value

name	Olfr1070-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404466 MGI:3030904
definition	note : olfactory receptor 1070, pseudogene 1 pseudo : _no_value

name	Olfr228 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258400 MGI:3030062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1073-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257989 MGI:3030907
definition	gene_synonym : MOR188-6P note : olfactory receptor 1073, pseudogene 1 pseudo : _no_value

name	Olfr1075-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404470 MGI:3030909
definition	note : olfactory receptor 1075, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W4CQV-104617-103730 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257829
definition	note : olfactory receptor GA_x5J8B7W4CQV-104617-103730 pseudo : _no_value

name	Olfr1076 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258401 MGI:3030910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625853 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins

name	Olfr1078-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404471 MGI:3030912
definition	note : olfactory receptor 1078, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W4CQV-78329-78805 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257825
definition	note : olfactory receptor GA_x5J8B7W4CQV-78329-78805 pseudo : _no_value

name	Olfr1079 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258402 MGI:3030913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1080 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258404 MGI:3030914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1081-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404472 MGI:3030915
definition	gene_synonym : MOR191-4_p note : olfactory receptor 1081, pseudogene 1 pseudo : _no_value

name	Olfr1082 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404473 MGI:3030916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W4CQV-18360-18784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257826
definition	note : olfactory receptor GA_x5J8B7W4CQV-18360-18784 pseudo : _no_value

name	Olfr1083 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404326 MGI:3030917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1084 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258235 MGI:3030918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1085 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258583 MGI:3030919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1086 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258585 MGI:3030920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1087 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258843 MGI:3030921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1088-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404474 MGI:3030922
definition	note : olfactory receptor 1088, pseudogene 1 pseudo : _no_value

name	Olfr1089 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257933 MGI:3030923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1090 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258844 MGI:3030924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1091-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404475 MGI:3030925
definition	note : olfactory receptor 1091, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W3Y5M-123838-124302 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257832
definition	note : olfactory receptor GA_x5J8B7W3Y5M-123838-124302 pseudo : _no_value

name	Olfr1093 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258363 MGI:3030927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr141 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257913 MGI:2177524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1094 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258362 MGI:3030928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1095 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258725 MGI:3030929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1096-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257901 MGI:3030930
definition	gene_synonym : MOR206-6 note : olfactory receptor 1096, pseudogene 1 pseudo : _no_value

name	Olfr1097 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258840 MGI:3030931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1098 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258842 MGI:3030932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1099 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258764 MGI:3030933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1100 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258587 MGI:3030934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258584 MGI:3030935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1102 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228228 MGI:3030936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1103-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258084 MGI:3030937
definition	gene_synonym : MOR206-5P note : olfactory receptor 1103, pseudogene 1 pseudo : _no_value

name	Olfr1104 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258763 MGI:3030938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1105 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258085 MGI:3030939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258747 MGI:3030940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258841 MGI:3030941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3Y5M-419033-418135 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257831
definition	note : olfactory receptor GA_x5J8B7W3Y5M-419033-418135 pseudo : _no_value

name	Olfr1109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258762 MGI:3030943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr259 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258766 MGI:3030093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668402 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668402
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	Olfr1110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258765 MGI:3030944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1111 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258586 MGI:3030945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1112 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258655 MGI:3030946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC228238 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:228238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Olfr1113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404327 MGI:3030947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1114-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404478 MGI:3030948
definition	note : olfactory receptor 1114, pseudogene 1 pseudo : _no_value

name	LOC546767 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Olfr1115 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258294 MGI:3030949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1521-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258190 MGI:3031355
definition	gene_synonym : MOR264-8P note : olfactory receptor 1521, pseudogene 1 pseudo : _no_value

name	LOC100041923 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr1117-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258110 MGI:3030951
definition	gene_synonym : MOR264-10P note : olfactory receptor 1117, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7TY7N2-4-429 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257859
definition	note : olfactory receptor GA_x5J8B7TY7N2-4-429 pseudo : _no_value

name	LOC668424 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr1118 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404328 MGI:3030952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1119-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258002 MGI:3030953
definition	gene_synonym : MOR264-15P note : olfactory receptor 1119, pseudogene 1 pseudo : _no_value

name	Olfr1120 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259031 MGI:3030954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258345 MGI:3030955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1122 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259033 MGI:3030956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 243 ESTs, 9 Proteins pseudo : _no_value

name	Olfr1123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258347 MGI:3030957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1125 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259030 MGI:3030959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1126 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258834 MGI:3030960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pramel7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:347712 MGI:2156391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pramel6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:347711 MGI:2156390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668439 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Olfr1127-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258108 MGI:3030961
definition	gene_synonym : MOR211-5P note : olfactory receptor 1127, pseudogene 1 pseudo : _no_value

name	Olfr253-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258651 MGI:3030087
definition	gene_synonym : MOR177-15; MOR177-5 note : olfactory receptor 253, pseudogene 1 pseudo : _no_value

name	Olfr1128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258346 MGI:3030962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042038 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042038
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 4 Proteins pseudo : _no_value

name	LOC668445 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC668447 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 4 Proteins pseudo : _no_value

name	Olfr1129 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258111 MGI:3030963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1130 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258835 MGI:3030964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1131 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258652 MGI:3030965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1132 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258833 MGI:3030966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042076 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Olfr1133 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258348 MGI:3030967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1134 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259032 MGI:3030968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1135 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258654 MGI:3030969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1136 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258653 MGI:3030970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1137 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258101 MGI:3030971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1138 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258632 MGI:3030972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3Y5M-1033291-1033773 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257834
definition	note : olfactory receptor GA_x5J8B7W3Y5M-1033291-1033773 pseudo : _no_value

name	Olfr1140 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258635 MGI:3030974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1141 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258630 MGI:3030975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr152 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258640 MGI:1313139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1142-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258003 MGI:3030976
definition	gene_synonym : MOR177-13P note : olfactory receptor 1142, pseudogene 1 pseudo : _no_value

name	Olfr1143 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258290 MGI:3030977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3Y5M-1094074-1093275 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257833
definition	note : olfactory receptor GA_x5J8B7W3Y5M-1094074-1093275 pseudo : _no_value

name	Olfr1145 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258317 MGI:3030979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1146-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258102 MGI:3030980
definition	gene_synonym : MOR264-12P note : olfactory receptor 1146, pseudogene 1 pseudo : _no_value

name	Olfr1147-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258100 MGI:3030981
definition	gene_synonym : MOR264-13P note : olfactory receptor 1147, pseudogene 1 pseudo : _no_value

name	Olfr1148 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258220 MGI:3030982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1149-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258099 MGI:3030983
definition	gene_synonym : MOR264-14P note : olfactory receptor 1149, pseudogene 1 pseudo : _no_value

name	Olfr1150-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258104 MGI:3030984
definition	gene_synonym : MOR264-11 note : olfactory receptor 1150, pseudogene 1 pseudo : _no_value

name	Olfr1151 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258631 MGI:3030985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1152 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258103 MGI:3030986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1153 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258633 MGI:3030987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1154 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258641 MGI:3030988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1155 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258636 MGI:3030989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258814 MGI:3030990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1157 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258846 MGI:3030991
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr74 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117005 MGI:2151909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1158 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258639 MGI:3030992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1159-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258012 MGI:3030993
definition	gene_synonym : MOR135-23P note : olfactory receptor 1159, pseudogene 1 pseudo : _no_value

name	Olfr1160 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258643 MGI:3030994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1161 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258845 MGI:3030995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr73 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117004 MGI:2151908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1162 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258105 MGI:3030996
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1163 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258638 MGI:3030997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1164 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258634 MGI:3030998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1165 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258642 MGI:3030999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258644 MGI:3031000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258291 MGI:3031001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1168 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258524 MGI:3031002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1169-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404482 MGI:3031003
definition	note : olfactory receptor 1169, pseudogene 1 pseudo : _no_value

name	Olfr1170 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258525 MGI:3031004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1171-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257896 MGI:3031005
definition	gene_synonym : MOR174-17P note : olfactory receptor 1171, pseudogene 1 pseudo : _no_value

name	Olfr1172-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404483 MGI:3031006
definition	note : olfactory receptor 1172, pseudogene 1 pseudo : _no_value

name	Olfr1173 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404329 MGI:3031007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1174 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546769 MGI:3031008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 389 Proteins

name	Olfr1175 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546770 MGI:3031009
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2079 Proteins

name	Olfr1176 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258767 MGI:3031010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1177 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545443 MGI:3031011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1347 Proteins

name	Olfr1178 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258203 MGI:3031012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258919 MGI:3031013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1180 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258920 MGI:3031014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1181 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258060 MGI:3031015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1182 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258167 MGI:3031016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1183 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258522 MGI:3031017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1184 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258820 MGI:3031018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1185-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258059 MGI:3031019
definition	gene_synonym : MOR230-10P; MOR230-11 note : olfactory receptor 1185, pseudogene 1 pseudo : _no_value

name	Olfr1186 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258523 MGI:3031020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1187-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404484 MGI:3031021
definition	note : olfactory receptor 1187, pseudogene 1 pseudo : _no_value

name	Olfr1188 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258921 MGI:3031022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668528 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Olfr1189 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258768 MGI:3031023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W4NS2-37772-38277 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257726
definition	note : olfactory receptor GA_x5J8B7W4NS2-37772-38277 pseudo : _no_value

name	Olfr1066 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801263 GeneID:257880 MGI:3030900
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1066 transcript_id : NM_001011735.1

name	Olfr228 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174771 GeneID:258400 MGI:3030062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 228 transcript_id : NM_146405.2

name	Olfr1076 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239151 GeneID:258401 MGI:3030910
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1076 transcript_id : NM_146406.1

name	LOC625853 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249879 GeneID:625853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins product : similar to olfactory receptor MOR189-2 transcript_id : XM_001476746.1

name	Olfr1079 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239157 GeneID:258402 MGI:3030913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1079 transcript_id : NM_146407.1

name	Olfr1080 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665724 GeneID:258404 MGI:3030914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1080 transcript_id : NM_146409.2

name	Olfr1082 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983510 GeneID:404473 MGI:3030916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1082 transcript_id : NM_207674.2

name	Olfr1083 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056732 GeneID:404326 MGI:3030917
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1083 transcript_id : NM_207564.2

name	Olfr1084 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953201 GeneID:258235 MGI:3030918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1084 transcript_id : NM_207135.2

name	Olfr1085 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129470 GeneID:258583 MGI:3030919
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1085 transcript_id : NM_146590.1

name	Olfr1086 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129466 GeneID:258585 MGI:3030920
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1086 transcript_id : NM_146592.1

name	Olfr1087 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129174 GeneID:258843 MGI:3030921
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1087 transcript_id : NM_146846.1

name	Olfr1089 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801319 GeneID:257933 MGI:3030923
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1089 transcript_id : NM_001011771.1

name	Olfr1090 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129168 GeneID:258844 MGI:3030924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1090 transcript_id : NM_146847.1

name	Olfr1093 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129566 GeneID:258363 MGI:3030927
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1093 transcript_id : NM_146366.1

name	Olfr141 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444915 GeneID:257913 MGI:2177524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 141 transcript_id : NM_181818.2

name	Olfr1094 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129572 GeneID:258362 MGI:3030928
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1094 transcript_id : NM_146365.1

name	Olfr1095 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056734 GeneID:258725 MGI:3030929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1095 transcript_id : NM_146730.2

name	Olfr1097 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129176 GeneID:258840 MGI:3030931
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1097 transcript_id : NM_146843.1

name	Olfr1098 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174765 GeneID:258842 MGI:3030932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1098 transcript_id : NM_146845.2

name	Olfr1099 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129310 GeneID:258764 MGI:3030933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1099 transcript_id : NM_146768.1

name	Olfr1100 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129462 GeneID:258587 MGI:3030934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1100 transcript_id : NM_146594.1

name	Olfr1101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195673 GeneID:258584 MGI:3030935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1101 transcript_id : NM_146591.2

name	Olfr1102 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47131204 GeneID:228228 MGI:3030936
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1102 transcript_id : NM_207154.1

name	Olfr1104 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583684 GeneID:258763 MGI:3030938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1104 transcript_id : NM_146767.2

name	Olfr1105 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801413 GeneID:258085 MGI:3030939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1105 transcript_id : NM_001011825.1

name	Olfr1106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129344 GeneID:258747 MGI:3030940
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1106 transcript_id : NM_146752.1

name	Olfr1107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129178 GeneID:258841 MGI:3030941
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1107 transcript_id : NM_146844.1

name	Olfr1109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671318 GeneID:258762 MGI:3030943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1109 transcript_id : NM_146766.2

name	Olfr259 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735417 GeneID:258766 MGI:3030093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 259 transcript_id : NM_146770.2

name	Olfr1110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129312 GeneID:258765 MGI:3030944
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1110 transcript_id : NM_146769.1

name	Olfr1111 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129460 GeneID:258586 MGI:3030945
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1111 transcript_id : NM_146593.1

name	Olfr1112 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238903 GeneID:258655 MGI:3030946
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1112 transcript_id : NM_146661.1

name	Olfr1113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430589 GeneID:404327 MGI:3030947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1113 transcript_id : NM_207565.1

name	Olfr1115 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129694 GeneID:258294 MGI:3030949
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1115 transcript_id : NM_146297.1

name	Olfr1118 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46518533 GeneID:404328 MGI:3030952
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1118 transcript_id : NM_207632.1

name	Olfr1120 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128890 GeneID:259031 MGI:3030954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1120 transcript_id : NM_147029.1

name	Olfr1121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129605 GeneID:258345 MGI:3030955
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1121 transcript_id : NM_146348.1

name	Olfr1122 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128886 GeneID:259033 MGI:3030956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1122 transcript_id : NM_147031.1

name	Olfr1123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583710 GeneID:258347 MGI:3030957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1123 transcript_id : NM_146350.2

name	Olfr1125 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529457 GeneID:259030 MGI:3030959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1125 transcript_id : NM_147028.2

name	Olfr1126 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583682 GeneID:258834 MGI:3030960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1126 transcript_id : NM_146837.2

name	Pramel7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342428 GeneID:347712 MGI:2156391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preferentially expressed antigen in melanoma like 7 transcript_id : NM_178250.2

name	Pramel6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342427 GeneID:347711 MGI:2156390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preferentially expressed antigen in melanoma like 6 transcript_id : NM_178249.2

name	Olfr1128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129599 GeneID:258346 MGI:3030962
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1128 transcript_id : NM_146349.1

name	Olfr1129 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60115718 GeneID:258111 MGI:3030963
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1129 transcript_id : NM_001011836.1

name	Olfr1130 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129186 GeneID:258835 MGI:3030964
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1130 transcript_id : NM_146838.1

name	Olfr1131 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671320 GeneID:258652 MGI:3030965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1131 transcript_id : NM_146658.2

name	Olfr1132 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129190 GeneID:258833 MGI:3030966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1132 transcript_id : NM_146836.1

name	Olfr1133 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129594 GeneID:258348 MGI:3030967
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1133 transcript_id : NM_146351.1

name	Olfr1134 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128884 GeneID:259032 MGI:3030968
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1134 transcript_id : NM_147030.1

name	Olfr1135 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529280 GeneID:258654 MGI:3030969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1135 transcript_id : NM_146660.2

name	Olfr1136 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239175 GeneID:258653 MGI:3030970
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1136 transcript_id : NM_146659.1

name	Olfr1137 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801429 GeneID:258101 MGI:3030971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1137 transcript_id : NM_001011833.1

name	Olfr1138 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239169 GeneID:258632 MGI:3030972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1138 transcript_id : NM_146639.1

name	Olfr1140 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239173 GeneID:258635 MGI:3030974
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1140 transcript_id : NM_146642.1

name	Olfr1141 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239179 GeneID:258630 MGI:3030975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1141 transcript_id : NM_146637.1

name	Olfr152 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056739 GeneID:258640 MGI:1313139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 152 transcript_id : NM_146646.2

name	Olfr1143 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983469 GeneID:258290 MGI:3030977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1143 transcript_id : NM_146293.2

name	Olfr1145 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121247418 GeneID:258317 MGI:3030979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1145 transcript_id : NM_146320.2

name	Olfr1148 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372117 GeneID:258220 MGI:3030982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1148 transcript_id : NM_001011519.1

name	Olfr1151 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239163 GeneID:258631 MGI:3030985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1151 transcript_id : NM_146638.1

name	Olfr1152 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801431 GeneID:258103 MGI:3030986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1152 transcript_id : NM_001011834.1

name	Olfr1153 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056737 GeneID:258633 MGI:3030987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1153 transcript_id : NM_146640.2

name	Olfr1154 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239201 GeneID:258641 MGI:3030988
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1154 transcript_id : NM_146647.1

name	Olfr1155 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671322 GeneID:258636 MGI:3030989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1155 transcript_id : NM_146643.2

name	Olfr1156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286813 GeneID:258814 MGI:3030990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1156 transcript_id : NM_146817.2

name	Olfr1157 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129164 GeneID:258846 MGI:3030991
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1157 transcript_id : NM_146849.1

name	Olfr74 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821674 GeneID:117005 MGI:2151909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 74 transcript_id : NM_054091.2

name	Olfr1158 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239203 GeneID:258639 MGI:3030992
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1158 transcript_id : NM_146645.1

name	Olfr1160 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983621 GeneID:258643 MGI:3030994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1160 transcript_id : NM_146649.2

name	Olfr1161 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129170 GeneID:258845 MGI:3030995
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1161 transcript_id : NM_146848.1

name	Olfr73 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905122 GeneID:117004 MGI:2151908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 73 transcript_id : NM_054090.1

name	Olfr1162 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801433 GeneID:258105 MGI:3030996
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1162 transcript_id : NM_001011835.1

name	Olfr1163 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239189 GeneID:258638 MGI:3030997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1163 transcript_id : NM_146644.1

name	Olfr1164 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380650 GeneID:258634 MGI:3030998
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1164 transcript_id : NM_146641.1

name	Olfr1165 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239187 GeneID:258642 MGI:3030999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1165 transcript_id : NM_146648.1

name	Olfr1166 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56118304 GeneID:258644 MGI:3031000
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1166 transcript_id : NM_146650.2

name	Olfr1167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129696 GeneID:258291 MGI:3031001
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1167 transcript_id : NM_146294.1

name	Olfr1168 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239193 GeneID:258524 MGI:3031002
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1168 transcript_id : NM_146531.1

name	Olfr1170 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239199 GeneID:258525 MGI:3031004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1170 transcript_id : NM_146532.1

name	Olfr1173 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430583 GeneID:404329 MGI:3031007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1173 transcript_id : NM_207566.1

name	Olfr1174 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249885 GeneID:546769 MGI:3031008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 389 Proteins product : olfactory receptor 1174 transcript_id : XM_621554.4

name	Olfr1175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249887 GeneID:546770 MGI:3031009
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2079 Proteins product : olfactory receptor 1175 transcript_id : XM_621555.3

name	Olfr1176 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129308 GeneID:258767 MGI:3031010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1176 transcript_id : NM_146771.1

name	Olfr1177 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249889 GeneID:545443 MGI:3031011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1347 Proteins product : olfactory receptor 1177 transcript_id : XM_619781.4

name	Olfr1178 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801497 GeneID:258203 MGI:3031012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1178 transcript_id : NM_001011868.1

name	Olfr1179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735415 GeneID:258919 MGI:3031013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1179 transcript_id : NM_146917.2

name	Olfr1180 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129058 GeneID:258920 MGI:3031014
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1180 transcript_id : NM_146918.1

name	Olfr1181 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801397 GeneID:258060 MGI:3031015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1181 transcript_id : NM_001011816.1

name	Olfr1182 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372147 GeneID:258167 MGI:3031016
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1182 transcript_id : NM_001011535.1

name	Olfr1183 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983490 GeneID:258522 MGI:3031017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1183 transcript_id : NM_146529.2

name	Olfr1184 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129210 GeneID:258820 MGI:3031018
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1184 transcript_id : NM_146823.1

name	Olfr1186 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239039 GeneID:258523 MGI:3031020
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1186 transcript_id : NM_146530.1

name	Olfr1188 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129052 GeneID:258921 MGI:3031022
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1188 transcript_id : NM_146919.1

name	Olfr1189 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735419 GeneID:258768 MGI:3031023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1189 transcript_id : NM_146772.2

name	Olfr1066 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801264 CCDS:CCDS16257.1 GeneID:257880 MGI:3030900
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47925557-47924616; olfactory receptor MOR256-52P product : olfactory receptor 1066 protein_id : NP_001011735.1

name	Olfr228 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174772 CCDS:CCDS16258.1 GeneID:258400 MGI:3030062
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T0101M-139-669 product : olfactory receptor 228 protein_id : NP_666517.2

name	Olfr1076 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239152 CCDS:CCDS16259.1 GeneID:258401 MGI:3030910
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47993761-47994702; olfactory receptor MOR189-2 product : olfactory receptor 1076 protein_id : NP_666518.1

name	LOC625853 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249880 GeneID:625853
definition	codon_start : 1 product : similar to olfactory receptor MOR189-2 protein_id : XP_001476796.1

name	Olfr1079 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239158 CCDS:CCDS16260.1 GeneID:258402 MGI:3030913
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48024195-48023254; olfactory receptor MOR189-1 product : olfactory receptor 1079 protein_id : NP_666519.1

name	Olfr1080 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665725 CCDS:CCDS16261.1 GeneID:258404 MGI:3030914
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48039418-48038477; olfactory receptor MOR192-1 product : olfactory receptor 1080 protein_id : NP_666521.2

name	Olfr1082 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983511 GeneID:404473 MGI:3030916
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48079993-48079157; olfactory receptor 1082, pseudogene 1 product : olfactory receptor 1082 protein_id : NP_997557.2

name	Olfr1083 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056733 GeneID:404326 MGI:3030917
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-48092599-48091658 product : olfactory receptor 1083 protein_id : NP_997447.2

name	Olfr1084 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953202 GeneID:258235 MGI:3030918
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48121788-48120847; olfactory receptor MOR192-2 product : olfactory receptor 1084 protein_id : NP_997018.2

name	Olfr1085 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129471 CCDS:CCDS16263.1 GeneID:258583 MGI:3030919
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48147264-48146323; olfactory receptor MOR191-1 product : olfactory receptor 1085 protein_id : NP_666801.1

name	Olfr1086 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129467 CCDS:CCDS16264.1 GeneID:258585 MGI:3030920
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48168771-48167839; olfactory receptor MOR179-2 product : olfactory receptor 1086 protein_id : NP_666803.1

name	Olfr1087 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129175 CCDS:CCDS16265.1 GeneID:258843 MGI:3030921
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48182406-48181465; olfactory receptor MOR188-5 product : olfactory receptor 1087 protein_id : NP_667057.1

name	Olfr1089 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801320 CCDS:CCDS16266.1 GeneID:257933 MGI:3030923
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48226321-48225386; olfactory receptor MOR193-1 product : olfactory receptor 1089 protein_id : NP_001011771.1

name	Olfr1090 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129169 CCDS:CCDS16267.1 GeneID:258844 MGI:3030924
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48247345-48246404; olfactory receptor MOR188-4 product : olfactory receptor 1090 protein_id : NP_667058.1

name	Olfr1093 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129567 CCDS:CCDS16268.1 GeneID:258363 MGI:3030927
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48278396-48279364; olfactory receptor MOR179-6 product : olfactory receptor 1093 protein_id : NP_666478.1

name	Olfr141 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444916 GeneID:257913 MGI:2177524
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48299679-48298702 product : olfactory receptor 141 protein_id : NP_861539.2

name	Olfr1094 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129573 CCDS:CCDS16269.1 GeneID:258362 MGI:3030928
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48321457-48322449; olfactory receptor MOR179-7 product : olfactory receptor 1094 protein_id : NP_666477.1

name	Olfr1095 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056735 CCDS:CCDS16270.1 GeneID:258725 MGI:3030929
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48336843-48335917; olfactory receptor MOR179-1 product : olfactory receptor 1095 protein_id : NP_666941.2

name	Olfr1097 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129177 CCDS:CCDS16271.1 GeneID:258840 MGI:3030931
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48376288-48375341; olfactory receptor MOR206-2 product : olfactory receptor 1097 protein_id : NP_667054.1

name	Olfr1098 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174766 GeneID:258842 MGI:3030932
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48410458-48409511; olfactory receptor MOR206-1 product : olfactory receptor 1098 protein_id : NP_667056.2

name	Olfr1099 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129311 CCDS:CCDS16272.1 GeneID:258764 MGI:3030933
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48446067-48445129; olfactory receptor MOR206-3 product : olfactory receptor 1099 protein_id : NP_666979.1

name	Olfr1100 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129463 CCDS:CCDS16273.1 GeneID:258587 MGI:3030934
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48465387-48464422; olfactory receptor MOR206-4 product : olfactory receptor 1100 protein_id : NP_666805.1

name	Olfr1101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195674 CCDS:CCDS16274.1 GeneID:258584 MGI:3030935
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48475870-48474938; olfactory receptor MOR179-3 product : olfactory receptor 1101 protein_id : NP_666802.2

name	Olfr1102 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47131205 CCDS:CCDS16275.1 GeneID:228228 MGI:3030936
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48487992-48488966 product : olfactory receptor 1102 protein_id : NP_997037.1

name	Olfr1104 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583685 CCDS:CCDS16276.1 GeneID:258763 MGI:3030938
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48508763-48507833; olfactory receptor MOR207-1 product : olfactory receptor 1104 protein_id : NP_666978.2

name	Olfr1105 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801414 CCDS:CCDS16277.1 GeneID:258085 MGI:3030939
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48521031-48520093; olfactory receptor MOR0-6P product : olfactory receptor 1105 protein_id : NP_001011825.1

name	Olfr1106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129345 CCDS:CCDS16278.1 GeneID:258747 MGI:3030940
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48541463-48540525; olfactory receptor MOR172-6 product : olfactory receptor 1106 protein_id : NP_666963.1

name	Olfr1107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129179 CCDS:CCDS16279.1 GeneID:258841 MGI:3030941
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48565383-48564445; olfactory receptor MOR172-2 product : olfactory receptor 1107 protein_id : NP_667055.1

name	Olfr1109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110671319 CCDS:CCDS16280.1 GeneID:258762 MGI:3030943
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48586461-48585523; olfactory receptor MOR172-5 product : olfactory receptor 1109 protein_id : NP_666977.2

name	Olfr259 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735418 CCDS:CCDS16281.1 GeneID:258766 MGI:3030093
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2N869-1820-882; olfactory receptor MOR172-3 product : olfactory receptor 259 protein_id : NP_666981.2

name	Olfr1110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129313 CCDS:CCDS16282.1 GeneID:258765 MGI:3030944
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48621299-48620361; olfactory receptor MOR172-4 product : olfactory receptor 1110 protein_id : NP_666980.1

name	Olfr1111 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129461 CCDS:CCDS16283.1 GeneID:258586 MGI:3030945
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48635468-48634530; olfactory receptor MOR181-2 product : olfactory receptor 1111 protein_id : NP_666804.1

name	Olfr1112 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238904 CCDS:CCDS16284.1 GeneID:258655 MGI:3030946
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48676316-48677272; olfactory receptor MOR264-6 product : olfactory receptor 1112 protein_id : NP_666872.1

name	Olfr1113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430590 CCDS:CCDS16285.1 GeneID:404327 MGI:3030947
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48697747-48698727 product : olfactory receptor 1113 protein_id : NP_997448.1

name	Olfr1115 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129695 CCDS:CCDS16286.1 GeneID:258294 MGI:3030949
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48736906-48737886; olfactory receptor MOR264-20 product : olfactory receptor 1115 protein_id : NP_666409.1

name	Olfr1118 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518534 GeneID:404328 MGI:3030952
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48795705-48796673; GA_x5J8B7TRNDT-725-75 product : olfactory receptor 1118 protein_id : NP_997515.1

name	Olfr1120 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128891 CCDS:CCDS16287.1 GeneID:259031 MGI:3030954
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48849180-48850100; olfactory receptor MOR264-2 product : olfactory receptor 1120 protein_id : NP_667240.1

name	Olfr1121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129606 CCDS:CCDS16288.1 GeneID:258345 MGI:3030955
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48863863-48864807; olfactory receptor MOR264-18 product : olfactory receptor 1121 protein_id : NP_666460.1

name	Olfr1122 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128887 CCDS:CCDS16289.1 GeneID:259033 MGI:3030956
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48880078-48881058; olfactory receptor MOR264-1 product : olfactory receptor 1122 protein_id : NP_667242.1

name	Olfr1123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583711 CCDS:CCDS16290.1 GeneID:258347 MGI:3030957
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48917235-48918206; olfactory receptor MOR264-17 product : olfactory receptor 1123 protein_id : NP_666462.2

name	Olfr1125 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529458 CCDS:CCDS16291.1 GeneID:259030 MGI:3030959
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48936945-48937901; olfactory receptor MOR264-3 product : olfactory receptor 1125 protein_id : NP_667239.2

name	Olfr1126 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583683 CCDS:CCDS16292.1 GeneID:258834 MGI:3030960
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48959068-48960012; olfactory receptor MOR264-5 product : olfactory receptor 1126 protein_id : NP_667048.2

name	Pramel7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142697 CCDS:CCDS16293.1 GeneID:347712 MGI:2156391
definition	codon_start : 1 product : preferentially expressed antigen in melanoma like 7 protein_id : NP_839981.1

name	Pramel6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142695 CCDS:CCDS16294.1 GeneID:347711 MGI:2156390
definition	codon_start : 1 product : preferentially expressed antigen in melanoma like 6 protein_id : NP_839980.1

name	Olfr1128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129600 CCDS:CCDS16295.1 GeneID:258346 MGI:3030962
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49048592-49047657; olfactory receptor MOR176-3 product : olfactory receptor 1128 protein_id : NP_666461.1

name	Olfr1129 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60115719 CCDS:CCDS16296.1 GeneID:258111 MGI:3030963
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49078087-49079031; olfactory receptor MOR264-9P product : olfactory receptor 1129 protein_id : NP_001011836.1

name	Olfr1130 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129187 CCDS:CCDS16297.1 GeneID:258835 MGI:3030964
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49112575-49113519; olfactory receptor MOR264-4 product : olfactory receptor 1130 protein_id : NP_667049.1

name	Olfr1131 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110671321 CCDS:CCDS16298.1 GeneID:258652 MGI:3030965
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49133664-49134593; olfactory receptor MOR177-4 product : olfactory receptor 1131 protein_id : NP_666869.2

name	Olfr1132 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129191 CCDS:CCDS16299.1 GeneID:258833 MGI:3030966
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49140947-49140021; olfactory receptor MOR177-1 product : olfactory receptor 1132 protein_id : NP_667047.1

name	Olfr1133 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129595 CCDS:CCDS16300.1 GeneID:258348 MGI:3030967
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49151278-49150337; olfactory receptor MOR176-2 product : olfactory receptor 1133 protein_id : NP_666463.1

name	Olfr1134 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128885 CCDS:CCDS16301.1 GeneID:259032 MGI:3030968
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005179 - hormone activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49162076-49161138; olfactory receptor MOR176-1 product : olfactory receptor 1134 protein_id : NP_667241.1

name	Olfr1135 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529281 CCDS:CCDS16302.1 GeneID:258654 MGI:3030969
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49177531-49176599; olfactory receptor MOR177-2 product : olfactory receptor 1135 protein_id : NP_666871.2

name	Olfr1136 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239176 CCDS:CCDS16303.1 GeneID:258653 MGI:3030970
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49193051-49192119; olfactory receptor MOR177-3 product : olfactory receptor 1136 protein_id : NP_666870.1

name	Olfr1137 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801430 CCDS:CCDS16304.1 GeneID:258101 MGI:3030971
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49215724-49214792; olfactory receptor MOR40-9P product : olfactory receptor 1137 protein_id : NP_001011833.1

name	Olfr1138 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239170 CCDS:CCDS16305.1 GeneID:258632 MGI:3030972
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49242149-49241214; olfactory receptor MOR177-8 product : olfactory receptor 1138 protein_id : NP_666850.1

name	Olfr1140 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239174 CCDS:CCDS16306.1 GeneID:258635 MGI:3030974
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49250025-49250960; olfactory receptor MOR177-6 product : olfactory receptor 1140 protein_id : NP_666853.1

name	Olfr1141 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239180 CCDS:CCDS16307.1 GeneID:258630 MGI:3030975
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49257818-49256883; olfactory receptor MOR177-10 product : olfactory receptor 1141 protein_id : NP_666848.1

name	Olfr152 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056740 CCDS:CCDS16308.1 GeneID:258640 MGI:1313139
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor 4 cluster, gene 1; GA_x6K02T2Q125-49283184-49284128 product : olfactory receptor 152 protein_id : NP_666857.2

name	Olfr1143 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129703 CCDS:CCDS16309.1 GeneID:258290 MGI:3030977
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49303473-49304405; olfactory receptor MOR177-14 product : olfactory receptor 1143 protein_id : NP_666405.1

name	Olfr1145 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121247419 CCDS:CCDS16310.1 GeneID:258317 MGI:3030979
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49311440-49312384; olfactory receptor MOR264-19 product : olfactory receptor 1145 protein_id : NP_666432.2

name	Olfr1148 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372118 CCDS:CCDS16311.1 GeneID:258220 MGI:3030982
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49334566-49335510; olfactory receptor MOR264-7 product : olfactory receptor 1148 protein_id : NP_001011519.1

name	Olfr1151 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239164 CCDS:CCDS16312.1 GeneID:258631 MGI:3030985
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49358694-49359620; olfactory receptor MOR177-9 product : olfactory receptor 1151 protein_id : NP_666849.1

name	Olfr1152 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801432 CCDS:CCDS16313.1 GeneID:258103 MGI:3030986
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49372426-49373358; olfactory receptor MOR177-12 product : olfactory receptor 1152 protein_id : NP_001011834.1

name	Olfr1153 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056738 CCDS:CCDS16314.1 GeneID:258633 MGI:3030987
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49395950-49396882; olfactory receptor MOR177-7 product : olfactory receptor 1153 protein_id : NP_666851.2

name	Olfr1154 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239202 CCDS:CCDS16315.1 GeneID:258641 MGI:3030988
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49403456-49402524; olfactory receptor MOR173-2 product : olfactory receptor 1154 protein_id : NP_666858.1

name	Olfr1155 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239198 CCDS:CCDS16316.1 GeneID:258636 MGI:3030989
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49426894-49425950; olfactory receptor MOR174-10 product : olfactory receptor 1155 protein_id : NP_666854.1

name	Olfr1156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286814 GeneID:258814 MGI:3030990
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49433499-49432537; olfactory receptor MOR174-3 product : olfactory receptor 1156 protein_id : NP_667028.2

name	Olfr1157 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129165 CCDS:CCDS16317.1 GeneID:258846 MGI:3030991
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49446395-49445457; olfactory receptor MOR174-1 product : olfactory receptor 1157 protein_id : NP_667060.1

name	Olfr74 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821675 CCDS:CCDS16318.1 GeneID:117005 MGI:2151909
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005549 - odorant binding [Evidence IDA]; GO:0004984 - olfactory receptor activity [Evidence IDA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IDA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IDA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49458388-49457432; olfactory receptor MOR174-4 product : olfactory receptor 74 protein_id : NP_473432.2

name	Olfr1158 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239204 CCDS:CCDS16319.1 GeneID:258639 MGI:3030992
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49480812-49481753; olfactory receptor MOR173-3 product : olfactory receptor 1158 protein_id : NP_666856.1

name	Olfr1160 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983622 CCDS:CCDS16320.1 GeneID:258643 MGI:3030994
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49498697-49497765; olfactory receptor MOR173-1 product : olfactory receptor 1160 protein_id : NP_666860.2

name	Olfr1161 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129171 CCDS:CCDS16321.1 GeneID:258845 MGI:3030995
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49516664-49517629; olfactory receptor MOR174-2 product : olfactory receptor 1161 protein_id : NP_667059.1

name	Olfr73 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905123 CCDS:CCDS16322.1 GeneID:117004 MGI:2151908
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005549 - odorant binding [Evidence IDA]; GO:0004984 - olfactory receptor activity [Evidence IDA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IDA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IDA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49527073-49526132; olfactory receptor MOR174-9 product : olfactory receptor 73 protein_id : NP_473431.1

name	Olfr1162 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801434 CCDS:CCDS16323.1 GeneID:258105 MGI:3030996
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49542541-49541597; olfactory receptor MOR174-14 product : olfactory receptor 1162 protein_id : NP_001011835.1

name	Olfr1163 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239190 CCDS:CCDS16324.1 GeneID:258638 MGI:3030997
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49563265-49562315; olfactory receptor MOR174-8 product : olfactory receptor 1163 protein_id : NP_666855.1

name	Olfr1164 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380651 CCDS:CCDS16325.1 GeneID:258634 MGI:3030998
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49585842-49584862; olfactory receptor MOR174-11 product : olfactory receptor 1164 protein_id : NP_666852.1

name	Olfr1165 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239188 GeneID:258642 MGI:3030999
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-49593880-49592930; olfactory receptor MOR174-7 product : olfactory receptor 1165 protein_id : NP_666859.1

name	Olfr1166 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56118305 CCDS:CCDS16326.1 GeneID:258644 MGI:3031000
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49616865-49615915; olfactory receptor MOR174-6 product : olfactory receptor 1166 protein_id : NP_666861.2

name	Olfr1167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129697 CCDS:CCDS16327.1 GeneID:258291 MGI:3031001
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49641892-49640942; olfactory receptor MOR174-16 product : olfactory receptor 1167 protein_id : NP_666406.1

name	Olfr1168 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239194 CCDS:CCDS16328.1 GeneID:258524 MGI:3031002
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49669483-49670421; olfactory receptor MOR174-13 product : olfactory receptor 1168 protein_id : NP_666742.1

name	Olfr1170 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239200 CCDS:CCDS16329.1 GeneID:258525 MGI:3031004
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49709783-49708833; olfactory receptor MOR174-12 product : olfactory receptor 1170 protein_id : NP_666743.1

name	Olfr1173 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430584 CCDS:CCDS16330.1 GeneID:404329 MGI:3031007
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MOR174-20_p; GA_x6K02T2Q125-49759783-49758845 product : olfactory receptor 1173 protein_id : NP_997449.1

name	Olfr1174 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249886 GeneID:546769 MGI:3031008
definition	codon_start : 1 product : olfactory receptor 1174 protein_id : XP_621554.4

name	Olfr1175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249888 GeneID:546770 MGI:3031009
definition	codon_start : 1 product : olfactory receptor 1175 protein_id : XP_621555.3

name	Olfr1176 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129309 CCDS:CCDS16331.1 GeneID:258767 MGI:3031010
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49824309-49825256; olfactory receptor MOR174-5 product : olfactory receptor 1176 protein_id : NP_666982.1

name	Olfr1177 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249890 GeneID:545443 MGI:3031011
definition	codon_start : 1 product : olfactory receptor 1177 protein_id : XP_619781.4

name	Olfr1178 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801498 CCDS:CCDS16332.1 GeneID:258203 MGI:3031012
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49870417-49871388; olfactory receptor MOR225-6P product : olfactory receptor 1178 protein_id : NP_001011868.1

name	Olfr1179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735416 CCDS:CCDS16333.1 GeneID:258919 MGI:3031013
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49890854-49889931; olfactory receptor MOR225-2 product : olfactory receptor 1179 protein_id : NP_667128.2

name	Olfr1180 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129059 CCDS:CCDS16334.1 GeneID:258920 MGI:3031014
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49900552-49899623; olfactory receptor MOR225-1 product : olfactory receptor 1180 protein_id : NP_667129.1

name	Olfr1181 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801398 CCDS:CCDS16335.1 GeneID:258060 MGI:3031015
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49911636-49910701; olfactory receptor MOR225-9P product : olfactory receptor 1181 protein_id : NP_001011816.1

name	Olfr1182 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372148 CCDS:CCDS16336.1 GeneID:258167 MGI:3031016
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49934557-49933640; MOR225-16_p; olfactory receptor MOR225-7P product : olfactory receptor 1182 protein_id : NP_001011535.1

name	Olfr1183 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239042 CCDS:CCDS16337.1 GeneID:258522 MGI:3031017
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49948903-49949814; olfactory receptor MOR230-6 product : olfactory receptor 1183 protein_id : NP_666740.1

name	Olfr1184 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129211 CCDS:CCDS16338.1 GeneID:258820 MGI:3031018
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49974190-49975125; olfactory receptor MOR225-3 product : olfactory receptor 1184 protein_id : NP_667034.1

name	Olfr1186 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239040 CCDS:CCDS16339.1 GeneID:258523 MGI:3031020
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50012960-50013871; olfactory receptor MOR230-5 product : olfactory receptor 1186 protein_id : NP_666741.1

name	Olfr1188 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129053 CCDS:CCDS16340.1 GeneID:258921 MGI:3031022
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50046879-50047784; olfactory receptor MOR238-2 product : olfactory receptor 1188 protein_id : NP_667130.1

name	Olfr1189 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735420 CCDS:CCDS16341.1 GeneID:258768 MGI:3031023
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50079044-50079964; olfactory receptor MOR237-2 product : olfactory receptor 1189 protein_id : NP_666983.2

name	LOC668402 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668402
definition	number : 1 pseudo : _no_value

name	LOC228238 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:228238
definition	number : 1 pseudo : _no_value

name	LOC546767 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546767
definition	number : 1 pseudo : _no_value

name	LOC100041923 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041923
definition	number : 1 pseudo : _no_value

name	LOC100041923 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041923
definition	number : 2 pseudo : _no_value

name	LOC668424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668424
definition	number : 1 pseudo : _no_value

name	LOC668424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668424
definition	number : 2 pseudo : _no_value

name	LOC668439 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668439
definition	number : 2 pseudo : _no_value

name	LOC668439 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668439
definition	number : 1 pseudo : _no_value

name	LOC668445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668445
definition	number : 1 pseudo : _no_value

name	LOC100042076 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042076
definition	number : 1 pseudo : _no_value

name	LOC668528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668528
definition	number : 1 pseudo : _no_value

name	LOC668528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668528
definition	number : 2 pseudo : _no_value

name	LOC668528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668528
definition	number : 3 pseudo : _no_value

name	LOC668432 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249881 GeneID:668432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 243 ESTs, 9 Proteins product : similar to Ss18 protein pseudo : _no_value transcript_id : XR_033170.1

name	LOC100042038 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249882 GeneID:100042038
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 4 Proteins product : similar to ribosomal protein pseudo : _no_value transcript_id : XR_033229.1

name	LOC668447 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249891 GeneID:668447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 4 Proteins product : similar to RWD domain containing 1 pseudo : _no_value transcript_id : XR_033443.1

clone name	MSMg01-407O08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-502M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114N09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-137L11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-189E02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464P20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454D06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-396J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-199B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326C21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-046O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-150A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455M01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-326M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477F15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318H06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-511M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-155I13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367J08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-455D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-231D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-176M11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-269J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290P19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-261D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355H15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535E06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-142L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055P06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-148M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496E05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-376N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497A11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-058A17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-061O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-386I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544O11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-067O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508D07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-362J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541G21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-387G07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-415G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-452K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311E03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-159E05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447N01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-138H07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302K05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-120D19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-271B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-378B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-111B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140M06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-268P03.b	B6Ng01-268P03.g
ACC	GA071674	GA071675
length	1,194	1,124
definition	B6Ng01-268P03.b	B6Ng01-268P03.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(87,447,481 - 87,448,678)	(87,294,801 - 87,295,927)
sequence	gaattcagacatatttgcatgtatagattgtttcaaaagagaatatattt caggctattactcaaagcagcacaggcattatagaagcataaactgatta tactcccatgagaagaacaaaagctgatgcttttcttcagtaactgtgtt aagaatcaattcatcatttgttccagagctctaagcactacttgatacgt aacaattttctcagtgcagcaatcacctccttgtttctaagactgtatat cagaggatttaacatgggagtcacaatgctgtaaaacagagagaatagtt tgtcagttcctggagaatgggtggactttggcctcaagtaggtaatagta gctgatccaaaaaacaaaaacaccacaagcaagtgggaagaacatgttga gaaggcttttgcccgtcctgtggctgttggcaacttcagaatggtggcaa tgattttgccataagatgcaagaatcaacataaaagggactgcagcaaat aatatagccactaaatagacagatagctcatttattgacgtgtctccgca ggccagcttgagaatgggtggtatgtcacacaagaagtggttgatttggt tagaattgcagaaatgtagagaaaatatctgacaggtttgtcctatctgg actgggatgcctccaagccaggaggctgctgccagctgagtgcactttgt tgggttcatgaccaaaggatagtgcagagggttacagatggccacatagc ggtcataagacatcacagccagcaggaaacactcagtggctgccagcata aggaagaaacacaactgggtggcacagctgaggacagaaatctttctctc ttgagtagcaatgctaaacagaatcctagggagagtgactgaaacataac agatttccagagaagaaaaatttgccaggaaaaaatacatgggcttctgt agtgcaggatcaattctagttatcacaattatgaaactatttcaaccaat atgatcaagtaattatggagaacatccaaacaaatccctgtaagttagga aggtctgaaaatccagagggagaaactcttgttcaccagttgaaagcatt atccctctgcctgaatttctggtgaatttcatctttgatgatttcatagg aaatgacagatttcttggccatggatcaatttcatcggtgtata	gaattcatgtaaccatacaaaactttaaacatttatctcctctttttatg aatttagtcagagaaatacaagccctgtgcaccctccatgttacacgcat cagtcaagatcagagtaactggaggaaggccaatcattcactcaaagaag atgacagataaaaaagcatgaagtacttgaataaaacaaaagtgcctgta tttcaaaaaatgctagcggctttctttgttatagtattaattgtgttttc taaatgttttccatagtcagaaacagtagcaatcagggtaaacatcttag agacaccaagtttcataggcagaaaagctcaaggtatagttttctctcag cttgcttgcctagtgtgtgacagtcctaggctggaattgccatgtcaaag aaaaactatataagtcccatttgaatatatcagtatagttccaatatcgt gttactctgtaacattaaatgctcaagtcgcagaatgtgaataaaactga ggatggttttacaaatgaaaaattgagatatttcctccccaacctagaaa acaaacaaacaaacaaacaaacaacaaacaaacaaatggaaagagcagac tttgtacaaatataggaataaaattcaagctaatgctgatttccaattag tagtttggaagtatgattagactttgatttagaaatctactacaccatca cttttatatgggtacttttcaaacttctgggatgataattttgagggcaa taattatctatgaaaattcaatatgtataacacttatgaatatgccatga aataatttaaacaaatgattttctcttctatttcagtcaatgtctttata acaagttctagatttaattaagtagatgaaaataaacttaattattctgt tacttatatttaagaaaaaaaaaaaaaaacttgtagttcagcttttcccc cctggggaaccatagcttagcaatgccaggattcatttggaattttctat tctgcaatatatatatatgtgatatatatatataattttcctcaatataa tataattatcatgaaatatccatattttactgaagtattttaatttacaa ctagtacttgtaatctatttattt
quality values	Open. Hide. 62 31 33 34 62 41 37 54 54 56 43 62 62 54 62 62 49 54 62 54 62 62 62 62 59 62 59 59 62 59 62 62 56 59 30 28 43 40 48 49 59 62 62 59 62 62 62 62 62 62 59 59 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 59 62 59 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 56 62 62 46 62 62 62 62 62 62 62 46 46 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 52 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 49 58 54 58 58 58 58 58 58 58 58 54 58 41 41 58 54 54 54 52 58 58 58 58 54 54 58 58 52 58 58 58 58 58 58 52 54 45 58 58 58 52 58 52 58 52 58 58 58 54 54 54 58 54 47 58 58 58 42 58 58 58 58 52 51 54 54 58 58 31 58 58 52 51 53 58 58 47 54 58 53 58 49 58 52 58 58 58 37 42 42 45 58 58 58 58 33 42 41 58 50 58 50 58 51 49 58 50 51 50 52 58 58 58 51 40 51 58 58 58 46 39 49 41 58 53 52 41 24 58 46 53 54 46 58 58 39 28 58 40 48 44 49 51 50 50 58 52 51 58 51 50 53 32 53 51 50 50 47 58 58 43 50 43 24 58 58 58 39 53 53 39 41 51 49 50 47 31 58 40 43 58 39 34 53 41 52 58 53 53 32 44 23 49 39 27 54 32 50 40 42 53 32 54 49 23 49 23 44 32 49 35 27 49 50 51 34 42 37 45 53 45 39 42 29 39 52 43 32 47 40 39 54 54 29 42 40 31 7 49 41 54 32 40 33 53 53 45 39 52 37 47 46 37 53 45 41 53 31 29 53 32 40 32 47 26 53 33 32 25 49 47 32 32 29 52 29 52 45 32 40 49 47 25 47 46 24 18 31 32 35 53 47 40 46 16 53 32 29 39 25 46 46 51 32 42 45 51 31 31 30 31 31 37 15 29 37 30 30 31 31 32 37 21 31 18 43 29 31 35 51 35 34 34 26 41 31 32 36 36 36 34 27 48 42 30 29 30 16 30 31 18 24 34 37 28 47 28 32 24 25 13 31 31 25 27 32 21 48 32 20 37 29 35 41 15 31 27 13 44 46 46 46 32 25 46 32 31 27 24 23 32 19 31 48 48 47 47 39 31 31 42 18 26 35 48 33 31 30 21 29 27 33 24 27 20 24 32 20 21 29 21 34 24 27 17 25 23 30 31 31 31 29 34 22 25 34 28 28 31 15 14 17 22 17 24 31 37 40 29 12 13 19 21 39 21 34 5 19 25 24 13 21 32 25 27 32 26 27 27 22 18 17 33 29 12 23 20 17 18 32 31 29 13 13 25 20 24 14 17 22 7 34 17 6 15 40 12 14 21 34 21 29 14 9 20 16 24 14 14 7 11 10 21 18 11 18 6 22 8 18 16 28 21 25 14 25 27 9 20 15 11 29 13 28 9 13 15 28 18 14 16 9 11 18 9 13 9 4 10 7 9 12 5 5 16 4 27 15 16 26 13 20 15 19 13 19 25 13 10 7 9 5 7 6 11 16 8 6 23 30 8 8 8 10 4 4 7 9 17 4 26 12 11 9 10 18 10 20 3 4 2 2 7 16 5 22 5 10 4 4 7 4 3 5 20 8 2 3 7 4 6 5 3 3 13 12 8 3 3 5 3 2 4 4 7 6 14 21 6 6 7 4 17 22 17 9 14 5 3 3 2 6 7 6 4 4 8	Open. Hide. 62 47 56 47 62 47 47 62 62 54 62 62 51 44 21 24 27 28 28 34 46 59 62 62 62 49 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 62 59 59 59 59 62 62 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 59 62 62 62 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 58 58 58 58 58 52 58 54 48 58 58 58 58 58 54 58 58 58 58 58 58 58 46 42 58 45 34 58 58 48 58 58 58 54 54 50 58 58 58 58 54 58 58 58 58 54 58 58 58 54 54 52 54 54 58 58 58 58 58 58 54 58 44 42 54 58 58 58 58 58 58 58 58 58 58 49 58 58 58 50 58 58 58 53 58 58 58 51 58 58 58 51 58 58 58 42 58 58 51 58 58 58 51 45 58 58 50 58 48 58 58 58 51 58 47 50 58 52 51 52 52 58 39 48 58 49 58 51 50 51 50 58 52 54 49 52 52 58 54 58 47 42 50 58 58 44 40 58 53 50 49 51 51 39 36 58 49 58 40 58 51 41 37 58 44 50 52 36 58 50 52 53 51 50 51 52 52 58 42 58 43 51 51 50 52 42 49 51 39 39 50 50 53 53 39 58 58 58 52 41 39 58 50 50 41 35 36 35 49 53 45 45 51 53 45 53 37 51 47 31 53 53 32 49 49 54 54 37 52 45 52 40 54 54 54 37 32 38 51 54 54 51 35 27 54 47 45 37 47 52 37 54 51 26 15 23 53 42 24 33 52 23 54 54 51 32 53 24 54 41 31 52 33 33 53 39 53 45 33 32 54 40 52 32 40 53 52 49 47 25 38 40 32 46 30 47 32 52 31 45 45 31 53 34 32 35 36 38 32 36 32 35 38 36 32 32 42 31 32 34 31 42 30 51 38 29 31 43 36 51 40 24 33 31 31 32 46 32 28 42 41 30 46 46 37 45 31 42 31 31 31 30 26 22 46 15 29 31 31 31 31 35 27 32 46 31 43 31 47 30 36 37 27 31 33 27 27 31 31 37 31 31 31 34 31 26 47 38 32 32 31 31 19 19 25 28 25 26 25 18 31 31 46 46 24 29 25 46 21 30 37 34 32 30 29 31 27 24 27 31 28 44 17 20 29 31 31 31 32 29 33 32 48 33 22 31 21 38 42 44 44 41 41 41 41 44 44 44 44 44 44 19 27 29 28 31 24 34 35 21 30 20 31 20 24 33 43 43 22 29 39 39 39 37 18 6 17 43 34 21 22 22 12 24 12 23 31 27 32 20 17 18 9 32 15 17 27 32 12 21 23 20 11 22 14 23 34 25 30 43 24 11 25 10 10 13 47 38 18 14 4 5 7 21 11 11 29 15 13 5 3 3 8 16 24 13 8 8 12 14 20 21 12 22 28 12 19 14 20 19 22 21 27 15 18 21 20 22 7 19 13 11 8 10 6 14 28 17 5 15 6 21 11 5 3 6 4 3 2 5 10 11 23 6 5 3 3 16 6 4 7 14 9 18 6 4 6 8 27 11 17 10 22 6 9 11 16 12 6 4 21 30 11 3 1 2 10 17 27 6 6 10 19 19 8 10 6 7 8 22 5 1 1 2 2 14 4 7 11 4 8 23 7 7 9 17 22

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_87447481_87448678
seq2: B6Ng01-268P03.b_48_1241 (reverse)

seq1  TATACA-CGATGAAATGAATCCAATGACAAGAAAATTCTTGTCATTTTTC  49
      |||||| |||||||||  |||||  | |||||||  || ||||| ||| |
seq2  TATACACCGATGAAATTGATCCATGGCCAAGAAA--TC-TGTCA-TTTCC  46

seq1  TATG-AATCATCCAAAAGATGAAATTCA-CAGAAATCAGGGCAGA-GGAT  96
      |||| |||||||  |||||||||||||| |||||||   |||||| ||||
seq2  TATGAAATCATC--AAAGATGAAATTCACCAGAAATTCAGGCAGAGGGAT  94

seq1  AATGC-TTCCACT-GTGA--CAGAGTTTCTCCTCCTGGGATTTTCAGACC  142
      ||||| ||| ||| ||||   |||||||||||  || |||||||||||||
seq2  AATGCTTTCAACTGGTGAACAAGAGTTTCTCCCTCT-GGATTTTCAGACC  143

seq1  TTCCTAACTTACAAGGGATTTTGTTTGGGATGTTCTCCATAATTTACTTG  192
      |||||||||||| ||||| ||||||| ||||||||||||||| |||||||
seq2  TTCCTAACTTAC-AGGGA-TTTGTTT-GGATGTTCTCCATAA-TTACTTG  189

seq1  ATCATATTGGTTGGAAATAGTTTCATAATTGTGATAACTAGAATTGATCC  242
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  ATCATATTGGTT-GAAATAGTTTCATAATTGTGATAACTAGAATTGATCC  238

seq1  TGCACTACAGAAGCCCATGTATTTTTTCCTGGCAAATTTTTCTTCTCTGG  292
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACTACAGAAGCCCATGTATTTTTTCCTGGCAAATTTTTCTTCTCTGG  288

seq1  AAATCTGTTATGTTTCAGTCACTCTCCCTAGGATTCTGTTTAGCATTGCT  342
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCTGTTATGTTTCAGTCACTCTCCCTAGGATTCTGTTTAGCATTGCT  338

seq1  ACTCAAGAGAGAAAGATTTCTGTCCTCAGCTGTGCCACCCAGTTGTGTTT  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCAAGAGAGAAAGATTTCTGTCCTCAGCTGTGCCACCCAGTTGTGTTT  388

seq1  CTTCCTTATGCTGGCAGCCACTGAGTGTTTCCTGCTGGCTGTGATGTCTT  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCTTATGCTGGCAGCCACTGAGTGTTTCCTGCTGGCTGTGATGTCTT  438

seq1  ATGACCGCTATGTGGCCATCTGTAACCCTCTGCACTATCCTTTGGTCATG  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACCGCTATGTGGCCATCTGTAACCCTCTGCACTATCCTTTGGTCATG  488

seq1  AACCCAACAAAGTGCACTCAGCTGGCAGCAGCCTCCTGGCTTGGAGGCAT  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCCAACAAAGTGCACTCAGCTGGCAGCAGCCTCCTGGCTTGGAGGCAT  538

seq1  CCCAGTCCAGATAGGACAAACCTGTCAGATATTTTCTCTACATTTCTGCA  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGTCCAGATAGGACAAACCTGTCAGATATTTTCTCTACATTTCTGCA  588

seq1  ATTCTAACCAAATCAACCACTTCTTGTGTGACATACCACCCATTCTCAAG  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTAACCAAATCAACCACTTCTTGTGTGACATACCACCCATTCTCAAG  638

seq1  CTGGCCTGCGGAGACACGTCAATAAATGAGCTATCTGTCTATTTAGTGGC  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCCTGCGGAGACACGTCAATAAATGAGCTATCTGTCTATTTAGTGGC  688

seq1  TATATTATTTGCTGCAGTCCCTTTTATGTTGATTCTTGCATCTTATGGCA  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATTATTTGCTGCAGTCCCTTTTATGTTGATTCTTGCATCTTATGGCA  738

seq1  AAATCATTGCCACCATTCTGAAGTTGCCAACAGCCACAGGACGGGCAAAA  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCATTGCCACCATTCTGAAGTTGCCAACAGCCACAGGACGGGCAAAA  788

seq1  GCCTTCTCAACATGTTCTTCCCACTTGCTTGTGGTGTTTTTGTTTTTTGG  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTCTCAACATGTTCTTCCCACTTGCTTGTGGTGTTTTTGTTTTTTGG  838

seq1  ATCAGCTACTATTACCTACTTGAGGCCAAAGTCCACCCATTCTCCAGGAA  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGCTACTATTACCTACTTGAGGCCAAAGTCCACCCATTCTCCAGGAA  888

seq1  CTGACAAACTATTCTCTCTGTTTTACAGCATTGTGACTCCCATGTTAAAT  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACAAACTATTCTCTCTGTTTTACAGCATTGTGACTCCCATGTTAAAT  938

seq1  CCTCTGATATACAGTCTTAGAAACAAGGAGGTGATTGCTGCACTGAGAAA  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGATATACAGTCTTAGAAACAAGGAGGTGATTGCTGCACTGAGAAA  988

seq1  ATTGTTACGTATCAAGTAGTGCTTAGAGCTCTGGAACAAATGATGAATTG  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTTACGTATCAAGTAGTGCTTAGAGCTCTGGAACAAATGATGAATTG  1038

seq1  ATTCTTAACACAGTTACTGAAGAAAAGCATCAGCTTTTGTTCTTCTCATG  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTTAACACAGTTACTGAAGAAAAGCATCAGCTTTTGTTCTTCTCATG  1088

seq1  GGAGTATAATCAGTTTATGCTTCTATAATGCCTGTGCTGCTTTGAGTAAT  1142
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGTATAATCAGTTTATGCTTCTATAATGCCTGTGCTGCTTTGAGTAAT  1138

seq1  AGCCTGAAATATATTCTCTTTTGAAACAATCTATACATGCAAATATGTCT  1192
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTGAAATATATTCTCTTTTGAAACAATCTATACATGCAAATATGTCT  1188

seq1  GAATTC  1198
      ||||||
seq2  GAATTC  1194

seq1: chr2_87294801_87295927
seq2: B6Ng01-268P03.g_65_1188

seq1  GAATTCATGTAACCATACAAAACTTTAAACATTTATCTCCTCTTTTTATG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATGTAACCATACAAAACTTTAAACATTTATCTCCTCTTTTTATG  50

seq1  AATTTAGTCAGAGAAATACAAGCCCTGTGCACCCTCCATGTTACACGCAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTAGTCAGAGAAATACAAGCCCTGTGCACCCTCCATGTTACACGCAT  100

seq1  CAGTCAAGATCAGAGTAACTGGAGGAAGGCCAATCATTCACTCAAAGAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCAAGATCAGAGTAACTGGAGGAAGGCCAATCATTCACTCAAAGAAG  150

seq1  ATGACAGATAAAAAAGCATGAAGTACTTGAATAAAACAAAAGTGCCTGTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACAGATAAAAAAGCATGAAGTACTTGAATAAAACAAAAGTGCCTGTA  200

seq1  TTTCAAAAAATGCTAGCGGCTTTCTTTGTTATAGTATTAATTGTGTTTTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCAAAAAATGCTAGCGGCTTTCTTTGTTATAGTATTAATTGTGTTTTC  250

seq1  TAAATGTTTTCCATAGTCAGAAACAGTAGCAATCAGGGTAAACATCTTAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATGTTTTCCATAGTCAGAAACAGTAGCAATCAGGGTAAACATCTTAG  300

seq1  AGACACCAAGTTTCATAGGCAGAAAAGCTCAAGGTATAGTTTTCTCTCAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACACCAAGTTTCATAGGCAGAAAAGCTCAAGGTATAGTTTTCTCTCAG  350

seq1  CTTGCTTGCCTAGTGTGTGACAGTCCTAGGCTGGAATTGCCATGTCAAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCTTGCCTAGTGTGTGACAGTCCTAGGCTGGAATTGCCATGTCAAAG  400

seq1  AAAAACTATATAAGTCCCATTTGAATATATCAGTATAGTTCCAATATCGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACTATATAAGTCCCATTTGAATATATCAGTATAGTTCCAATATCGT  450

seq1  GTTACTCTGTAACATTAAATGCTCAAGTCGCAGAATGTGAATAAAACTGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTACTCTGTAACATTAAATGCTCAAGTCGCAGAATGTGAATAAAACTGA  500

seq1  GGATGGTTTTACAAATGAAAAATTGAGATATTTCCTCCCCAACCTAGAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGGTTTTACAAATGAAAAATTGAGATATTTCCTCCCCAACCTAGAAA  550

seq1  ACAAACAAACAAACAAACAAACAACAAACAAACAAATGGAAAGAGCAGAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACAAACAAACAAACAAACAACAAACAAACAAATGGAAAGAGCAGAC  600

seq1  TTTGTACAAATATAGGAATAAAATTCAAGCTAATGCTGATTTCCAATTAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTACAAATATAGGAATAAAATTCAAGCTAATGCTGATTTCCAATTAG  650

seq1  TAGTTTGGAAGTATGATTAGACTTTGATTTAGAAATCTACTACACCATCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTTGGAAGTATGATTAGACTTTGATTTAGAAATCTACTACACCATCA  700

seq1  CTTTTATATGGGTACTTTTCAAACTTCTGGGATGATAATTTTGAGGGCAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTATATGGGTACTTTTCAAACTTCTGGGATGATAATTTTGAGGGCAA  750

seq1  TAATTATCTATGAAAATTCAATATGTATAACACTTATGAATATGCCATGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTATCTATGAAAATTCAATATGTATAACACTTATGAATATGCCATGA  800

seq1  AATAATTTAAACAAATGATTTTCTCTTCTATTTCAGTCAATGTCTTTATA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAATTTAAACAAATGATTTTCTCTTCTATTTCAGTCAATGTCTTTATA  850

seq1  ACAAGTTCTAGATTTAATTAAGTAGATGAAAATAAACTTAATTATTCTGT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGTTCTAGATTTAATTAAGTAGATGAAAATAAACTTAATTATTCTGT  900

seq1  TACTTATATTTAAG-AAAAAAAAAAAAAACTTGTAGTTCAGCTTTTCCCC  949
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  TACTTATATTTAAGAAAAAAAAAAAAAAACTTGTAGTTCAGCTTTTCCCC  950

seq1  CCT-GGGAACCATAGCTTAGCAATGCCAGGATTCATTTGGAATTTTCTAT  998
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGGGAACCATAGCTTAGCAATGCCAGGATTCATTTGGAATTTTCTAT  1000

seq1  TCTGC-ATATATATATATGTGATATATATATATAATTTT-CTCAATATAA  1046
      ||||| ||||||||||||||||||||||||||||||||| ||||||||||
seq2  TCTGCAATATATATATATGTGATATATATATATAATTTTCCTCAATATAA  1050

seq1  TATTAAATTATCATTGAAATATCCATATTTTACTGAAAGTATTTTATATT  1096
      |||  |||||||| ||||||||||||||||||||| ||||||||  || |
seq2  TAT--AATTATCA-TGAAATATCCATATTTTACTG-AAGTATTT--TAAT  1094

seq1  TTACAAACTAGTACTAATTAATCTA-TTATTT  1127
      |||| ||||||||||   ||||||| ||||||
seq2  TTAC-AACTAGTACT-TGTAATCTATTTATTT  1124

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information