MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-276C07
Chromosome	2 (Build37)
Map Location	27,934,162 - 28,058,931
singlet/doublet	doublet
Overlap gene	Fcnb, Olfm1
Upstream gene	Adamtsl2, C630035N08Rik, Dbh, Sardh, Vav2, D2Bwg1423e, Brd3, Wdr5, Rxra, Col5a1
Downstream gene	Gm347, 1700007K13Rik, Mrps2, LOC665412, Gbgt1, Ralgds, Cel, Gtf3c5, Gfi1b, Tsc1, 1700026L06Rik, 1190002A17Rik, LOC665643, Gtf3c4, Ddx31, Barhl1, LOC100033452, 1700101E01Rik, LOC100039666, Ttf1, Setx, Ntng2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Adamtsl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77794 MGI:1925044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C630035N08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109349 MGI:1926106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dbh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13166 MGI:94864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sardh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192166 MGI:2183102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vav2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22325 MGI:102718
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D2Bwg1423e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329372 MGI:106557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 26 ESTs

name	Brd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67382 MGI:1914632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140858 MGI:2155884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rxra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20181 MGI:98214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col5a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12831 MGI:88457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcnb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14134 MGI:1341158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56177 MGI:1860437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Gm347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241289 MGI:2685193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700007K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69327 MGI:1916577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:118451 MGI:2153089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665412 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 2722 ESTs, 6 Proteins pseudo : _no_value

name	Gbgt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227671 MGI:2449143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ralgds (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19730 MGI:107485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cel (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12613 MGI:88374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtf3c5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70239 MGI:1917489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfi1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14582 MGI:1276578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64930 MGI:1929183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700026L06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69987 MGI:1917237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190002A17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68870 MGI:1916120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665643 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665643
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Gtf3c4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269252 MGI:2138937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227674 MGI:2682639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Barhl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54422 MGI:1859288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100033452 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100033452
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	1700101E01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329375 MGI:2685669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	LOC100039666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ttf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22130 MGI:105044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Setx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269254 MGI:2443480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ntng2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171171 MGI:2159341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Adamtsl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037506 GeneID:77794 MGI:1925044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADAMTS-like 2 transcript_id : NM_029981.1

name	C630035N08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359024 GeneID:109349 MGI:1926106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C630035N08 gene transcript_id : NM_175427.3

name	Dbh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815860 GeneID:13166 MGI:94864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dopamine beta hydroxylase transcript_id : NM_138942.3

name	Sardh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149747 GeneID:192166 MGI:2183102
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sarcosine dehydrogenase transcript_id : NM_138665.1

name	Vav2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678554 GeneID:22325 MGI:102718
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vav 2 oncogene transcript_id : NM_009500.1

name	D2Bwg1423e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249234 GeneID:329372 MGI:106557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 26 ESTs product : DNA segment, Chr 2, Brigham & Women's Genetics 1423 expressed transcript_id : XM_001473037.1

name	Brd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364270 GeneID:67382 MGI:1914632
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 3 transcript_id : NM_023336.3

name	Wdr5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18252789 GeneID:140858 MGI:2155884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 5 transcript_id : NM_080848.1

name	Rxra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579898 GeneID:20181 MGI:98214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoid X receptor alpha transcript_id : NM_011305.3

name	Col5a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7656986 GeneID:12831 MGI:88457
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type V, alpha 1 transcript_id : NM_015734.1

name	Fcnb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404439 GeneID:14134 MGI:1341158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ficolin B transcript_id : NM_010190.1

name	Olfm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370352 GeneID:56177 MGI:1860437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin 1 transcript_id : NM_001038613.1

name	Olfm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370358 GeneID:56177 MGI:1860437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin 1 transcript_id : NM_001038614.1

name	Olfm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370356 GeneID:56177 MGI:1860437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin 1 transcript_id : NM_019498.2

name	Olfm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370348 GeneID:56177 MGI:1860437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin 1 transcript_id : NM_001038612.1

name	Gm347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53749209 GeneID:241289 MGI:2685193
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 347, (NCBI) transcript_id : NM_001005420.1

name	1700007K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625741 GeneID:69327 MGI:1916577
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700007K13 gene transcript_id : NM_027040.1

name	Mrps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543264 GeneID:118451 MGI:2153089
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S2 transcript_id : NM_080452.2

name	Gbgt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21105858 GeneID:227671 MGI:2449143
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 transcript_id : NM_139197.1

name	Ralgds (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677734 GeneID:19730 MGI:107485
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ral guanine nucleotide dissociation stimulator transcript_id : NM_009058.1

name	Cel (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753405 GeneID:12613 MGI:88374
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxyl ester lipase transcript_id : NM_009885.1

name	Gtf3c5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22507322 GeneID:70239 MGI:1917489
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor IIIC, polypeptide 5 transcript_id : NM_148928.1

name	Gfi1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328121 GeneID:14582 MGI:1276578
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor independent 1B transcript_id : NM_008114.2

name	Tsc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922702 GeneID:64930 MGI:1929183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tuberous sclerosis 1 transcript_id : NM_022887.3

name	1700026L06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037188 GeneID:69987 MGI:1917237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700026L06 gene transcript_id : NM_027283.1

name	1190002A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76443657 GeneID:68870 MGI:1916120
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190002A17 gene transcript_id : NM_001033874.1

name	Gtf3c4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385912 GeneID:269252 MGI:2138937
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor IIIC, polypeptide 4 transcript_id : NM_172977.2

name	Ddx31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802168 GeneID:227674 MGI:2682639
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31 transcript_id : NM_001033294.2

name	Barhl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346452 GeneID:54422 MGI:1859288
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BarH-like 1 (Drosophila) transcript_id : NM_019446.3

name	1700101E01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366337 GeneID:329375 MGI:2685669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : RIKEN cDNA 1700101E01 gene, transcript variant 1 transcript_id : XM_986644.1

name	Ttf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111154069 GeneID:22130 MGI:105044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription termination factor 1 transcript_id : NM_009442.2

name	Setx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113722130 GeneID:269254 MGI:2443480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : senataxin transcript_id : NM_198033.2

name	Ntng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19424139 GeneID:171171 MGI:2159341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : netrin G2 transcript_id : NM_133500.1

name	Ntng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281647 GeneID:171171 MGI:2159341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : netrin G2 transcript_id : NM_133501.1

name	Adamtsl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037507 CCDS:CCDS15824.1 GeneID:77794 MGI:1925044
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0031012 - extracellular matrix [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : TSP1-repeats containing protein product : ADAMTS-like 2 protein_id : NP_084257.1

name	C630035N08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425144 GeneID:109349 MGI:1926106
definition	codon_start : 1 product : hypothetical protein LOC109349 protein_id : NP_780636.1

name	Dbh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815861 GeneID:13166 MGI:94864
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0004500 - dopamine beta-monooxygenase activity [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008306 - associative learning [Evidence IMP]; GO:0048149 - behavioral response to ethanol [Evidence IMP]; GO:0001974 - blood vessel remodeling [Evidence IMP]; GO:0042423 - catecholamine biosynthesis [Evidence IEA]; GO:0006584 - catecholamine metabolism [Evidence IEA]; GO:0001816 - cytokine production [Evidence IMP]; GO:0042420 - dopamine catabolism [Evidence IMP]; GO:0042596 - fear response [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0006548 - histidine catabolism [Evidence IEA]; GO:0042309 - homoiothermy [Evidence IMP]; GO:0002443 - leukocyte mediated immunity [Evidence IMP]; GO:0050900 - leukocyte migration [Evidence IMP]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0042711 - maternal behavior [Evidence IMP]; GO:0007613 - memory [Evidence IMP]; GO:0042421 - norepinephrine biosynthesis [Evidence IMP]; GO:0045907 - positive regulation of vasoconstriction [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IMP]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0001975 - response to amphetamine [Evidence IMP]; GO:0048265 - response to pain [Evidence IMP]; GO:0008542 - visual learning [Evidence IMP] codon_start : 1 product : dopamine beta hydroxylase protein_id : NP_620392.2

name	Sardh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149748 CCDS:CCDS15826.1 GeneID:192166 MGI:2183102
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008480 - sarcosine dehydrogenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006546 - glycine catabolism [Evidence IEA] codon_start : 1 product : sarcosine dehydrogenase protein_id : NP_619606.1

name	Vav2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678555 CCDS:CCDS15827.1 GeneID:22325 MGI:102718
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0005154 - epidermal growth factor receptor binding [Evidence IPI]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IMP]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016477 - cell migration [Evidence IGI]; GO:0030031 - cell projection biogenesis [Evidence IGI]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0030032 - lamellipodium biogenesis [Evidence IGI]; GO:0043552 - positive regulation of phosphoinositide 3-kinase activity [Evidence IGI]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IMP] codon_start : 1 product : Vav2 oncogene protein_id : NP_033526.1

name	D2Bwg1423e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249235 GeneID:329372 MGI:106557
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473087.1

name	Brd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981064 CCDS:CCDS15828.1 GeneID:67382 MGI:1914632
definition	codon_start : 1 exception : mismatches in translation note : bromodomain-containing 3 product : bromodomain containing 3 protein_id : NP_075825.2

name	Wdr5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252790 CCDS:CCDS15829.1 GeneID:140858 MGI:2155884
definition	GO_component : GO:0005622 - intracellular [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001501 - skeletal development [Evidence IDA] codon_start : 1 note : Bmp2-induced product : WD repeat domain 5 protein_id : NP_543124.1

name	Rxra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755384 CCDS:CCDS15830.1 GeneID:20181 MGI:98214
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IPI] [Evidence ISS] [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : RXR alpha 1 product : retinoid X receptor alpha protein_id : NP_035435.1

name	Col5a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7656987 CCDS:CCDS15831.1 GeneID:12831 MGI:88457
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : pro-alpha1(V) collagen; procollagen type V alpha 1 product : procollagen, type V, alpha 1 protein_id : NP_056549.1

name	Fcnb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404440 CCDS:CCDS15832.1 GeneID:14134 MGI:1341158
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : ficolin B protein_id : NP_034320.1

name	Olfm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370353 CCDS:CCDS15833.1 GeneID:56177 MGI:1860437
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0051259 - protein oligomerization [Evidence IDA] codon_start : 1 note : isoform c is encoded by transcript variant 3; Noelin 1; Noelin 2; Pancortin 1-4; olfactomedin related ER localized protein product : olfactomedin 1 isoform c protein_id : NP_001033702.1

name	Olfm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370359 GeneID:56177 MGI:1860437
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0051259 - protein oligomerization [Evidence IDA] codon_start : 1 note : isoform d is encoded by transcript variant 4; Noelin 1; Noelin 2; Pancortin 1-4; olfactomedin related ER localized protein product : olfactomedin 1 isoform d protein_id : NP_001033703.1

name	Olfm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370357 CCDS:CCDS15834.1 GeneID:56177 MGI:1860437
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0051259 - protein oligomerization [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1; Noelin 1; Noelin 2; Pancortin 1-4; olfactomedin related ER localized protein product : olfactomedin 1 isoform a protein_id : NP_062371.2

name	Olfm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370349 CCDS:CCDS15835.1 GeneID:56177 MGI:1860437
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0051259 - protein oligomerization [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2; Noelin 1; Noelin 2; Pancortin 1-4; olfactomedin related ER localized protein product : olfactomedin 1 isoform b protein_id : NP_001033701.1

name	Gm347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53749210 CCDS:CCDS15836.1 GeneID:241289 MGI:2685193
definition	codon_start : 1 product : hypothetical protein LOC241289 protein_id : NP_001005420.1

name	1700007K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625742 CCDS:CCDS15837.1 GeneID:69327 MGI:1916577
definition	codon_start : 1 product : hypothetical protein LOC69327 protein_id : NP_081316.1

name	Mrps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543265 CCDS:CCDS15838.1 GeneID:118451 MGI:2153089
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mitochondrial ribosomal protein S2 protein_id : NP_536700.2

name	Gbgt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21105859 CCDS:CCDS15839.1 GeneID:227671 MGI:2449143
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence TAS] GO_function : GO:0047277 - globoside alpha-N-acetylgalactosaminyltransferase activity [Evidence IDA] [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0030259 - lipid glycosylation [Evidence TAS] codon_start : 1 exception : mismatches in translation note : forssman glycolipid synthetase product : globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 protein_id : NP_631936.1

name	Ralgds (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677735 CCDS:CCDS15840.1 GeneID:19730 MGI:107485
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ral guanine nucleotide dissociation stimulator protein_id : NP_033084.1

name	Cel (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753406 CCDS:CCDS15841.1 GeneID:12613 MGI:88374
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0004104 - cholinesterase activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA]; GO:0004771 - sterol esterase activity [Evidence IEA]; GO:0004806 - triacylglycerol lipase activity [Evidence IEA] GO_process : GO:0046514 - ceramide catabolism [Evidence IMP]; GO:0006707 - cholesterol catabolism [Evidence ISS]; GO:0009062 - fatty acid catabolism [Evidence ISS]; GO:0044258 - intestinal lipid catabolism [Evidence ISS]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0018350 - protein amino acid esterification [Evidence ISS] codon_start : 1 product : carboxyl ester lipase protein_id : NP_034015.1

name	Gtf3c5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507323 CCDS:CCDS15842.1 GeneID:70239 MGI:1917489
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TFIIICepsilon product : general transcription factor III polypeptide 5 protein_id : NP_683730.1

name	Gfi1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679991 CCDS:CCDS15843.1 GeneID:14582 MGI:1276578
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : growth factor independent 1B protein_id : NP_032140.1

name	Tsc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:79750409 CCDS:CCDS15844.1 GeneID:64930 MGI:1929183
definition	codon_start : 1 product : tuberous sclerosis 1 protein_id : NP_075025.2

name	1700026L06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037189 CCDS:CCDS15845.1 GeneID:69987 MGI:1917237
definition	codon_start : 1 product : Rsb-66 protein protein_id : NP_081559.1

name	1190002A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76443658 CCDS:CCDS15846.1 GeneID:68870 MGI:1916120
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0019201 - nucleotide kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68870 protein_id : NP_001029046.1

name	Gtf3c4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370486 CCDS:CCDS15847.1 GeneID:269252 MGI:2138937
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004402 - histone acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : general transcription factor IIIC, polypeptide 4 protein_id : NP_766565.1

name	Ddx31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677496 CCDS:CCDS15848.1 GeneID:227674 MGI:2682639
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31 protein_id : NP_001028466.1

name	Barhl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506423 CCDS:CCDS15849.1 GeneID:54422 MGI:1859288
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0001764 - neuron migration [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : transcription factor product : BarH-like 1 protein_id : NP_062319.1

name	1700101E01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366338 GeneID:329375 MGI:2685669
definition	codon_start : 1 product : similar to FLJ46082 protein isoform 1 protein_id : XP_991738.1

name	Ttf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111154070 GeneID:22130 MGI:105044
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003716 - RNA polymerase I transcription termination factor activity [Evidence IDA] GO_process : GO:0006338 - chromatin remodeling [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006361 - transcription initiation from RNA polymerase I promoter [Evidence IDA] codon_start : 1 product : transcription termination factor 1 protein_id : NP_033468.2

name	Setx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113722131 GeneID:269254 MGI:2443480
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : amyotrophic lateral sclerosis 4 homolog product : senataxin protein_id : NP_932150.2

name	Ntng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19424140 CCDS:CCDS15851.1 GeneID:171171 MGI:2159341
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant a; laminet 2 product : netrin G2 isoform a protein_id : NP_598007.1

name	Ntng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281648 CCDS:CCDS15852.1 GeneID:171171 MGI:2159341
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant b; laminet 2 product : netrin G2 isoform b protein_id : NP_598008.1

name	LOC665643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665643
definition	number : 1 pseudo : _no_value

name	LOC100039666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039666
definition	number : 1 pseudo : _no_value

name	LOC665412 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249258 GeneID:665412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 2722 ESTs, 6 Proteins product : similar to hCG1997137 pseudo : _no_value transcript_id : XR_032795.1

clone name	MSMg01-292O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174L07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-341O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483A05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-130J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224J08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-276C07.b	B6Ng01-276C07.g
ACC	GA076996	GA076997
length	1,124	1,112
definition	B6Ng01-276C07.b	B6Ng01-276C07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(28,057,806 - 28,058,931)	(27,934,162 - 27,935,268)
sequence	gaattcagagtttgaaacagtgaagctttggtctggtcaagtagtcccag gaacaagtaggtagcctttcgtaccactggccaggaactgtctcccaccc tcacctcaacaggtcactgtggaatgacaaagatttgacctccagctcat acttcttctaagcctatgtagggagccagaggttcaaggcttccctaaga aatggattagaagcactcaacgtagttgatcaactcacatagaatgcctc agagtggaactggctgttgagaaccaagctgacatcgaagggcaatcagt aggccaggtggaaggaaattctaaccctacccacactgatgcttgtcgaa actggtcacctcagaatgtgtctaaattgacagagaactgaagaaacaca catctgatcatttcctaatgcgattggaacagaggtgtacagtgaataca gaattgccctttcagctctagctcaagtttttccaccccacccccacccc cgaagcctgtacacctgcagccacacctgagcctctaacttgaatccagg tctctcgacttgcacctgcatttgtgtctttccacatgtacctgaacctc tccacttgcatccatacctgagcccctctcatgtaaattgagcctcttga cttatacctgagtcctcctgctccacctgctcctgtgtgtctccaccttt atcaacacctgagtctcccttacctgaatttgaacctctccacctgcatc tgagcctctccatctgcatctgagcctctccacctgcacctgagcctctc cacctgcacctgagcctctccacctgcacctgagcctctccatctgcacc tgagcctctccacctgcacctgagcctctccacctgcacctgagcctctc cacctgcacctgagcctctccacctgcacctgagcctctccacctgcacc tgagcctctccacctgcacctgaacctcttcacctgtattccaatctcct ccaactgtaccctagcctcttctcacctgtaccaagttgcctctgacttt cactgggctgaaagctcagctatttctgccttactcttcagtctaagcca aagtctacttcagtcttttacaga	gaattctcccagagggctgtgctttctaatgcagtagcctgaacctggat gtgcaaggttttagatttttttttttaaattggaagcacagaagcagaca caataaggtgtcctggtagtgagtaagtggcaaaaggctatgtgattttc agtgggaggagaagggactaagagagcttgctttctctgtggcttgtaga ggcaaaggggacttttgtagaacccagaggcaagtgttctggatgaatta acagctagagatgaaaaacaatgtccccaagacattggctgggtcctgag aagtcatatcccacagtttagaggaggcccttatcccctgactttcaccc agcagaagggcacagctgtgatctcactccctggggtgactttgctgagc attgcatactctaaccatgggggactcttgccccatgacccagggtccca aggttaccccatctggccggcattacctaccctgggtggttagagcgtgg atattatcattccccagccagaactcccctagttggctgccaaagcccct cttgtatgaggtccagtcccgaaagaagtccacagagccgtcaagcctcc tctggaagacctgagaccgtgaaatatacacagaagtcaacacaaggaac caagcctcaaagcagagcaggaatccaagattctcagaagactgggaacc tagtgccataaacaggtcatggcagaccccatacacctgagggtcagcta tgagaataggcatcatgacccaagccacacagcaggaagaggagtggcct tcccttcaacgtgtgctctctcacacaggttacctgtcagcatttctgat tctctatcttcaaagagtaaagggctccctctggggtacaaaggatcaga atcctacatagctcattttctgctgaccatggaatttggggttctgaaag ttcagtgaccaggggctagctcaacactcacggtcccagcctccaccatc tgtgtccatgtcacaacaagcaacagtcaggggctgcagtctgcagatag atgtattaccagccagtggagaaagtgccttggggtgagcacttccttgc cagttccgaggt
quality values	Open. Hide. 58 22 19 26 58 26 23 47 58 62 62 62 62 62 49 62 56 56 37 62 62 62 47 62 62 62 62 62 62 54 47 42 35 30 32 32 21 24 28 28 28 33 43 50 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 54 49 34 54 54 59 56 33 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 59 62 62 59 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 49 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 51 42 62 62 62 62 54 58 58 58 58 58 58 58 58 58 58 58 54 54 52 54 52 58 58 58 54 54 58 58 58 58 40 54 58 58 58 58 58 58 52 54 58 54 58 54 47 58 54 58 42 54 58 58 58 58 58 49 33 58 58 58 58 58 53 53 51 48 48 58 53 53 58 46 51 48 58 58 50 58 58 49 52 51 49 58 50 33 58 52 50 50 52 51 49 51 58 36 20 51 50 58 53 50 58 50 58 50 58 51 50 42 39 58 51 58 51 46 50 58 43 58 50 54 40 54 50 50 52 50 51 32 41 58 53 54 53 38 35 39 37 51 53 38 54 50 50 49 54 23 50 52 53 37 54 44 51 52 32 35 51 49 51 54 52 32 54 54 42 53 53 41 49 51 37 39 25 31 27 45 52 52 45 45 37 53 45 45 52 51 14 47 52 53 53 46 31 31 33 45 52 45 47 42 26 45 52 34 41 46 18 36 25 33 53 39 31 42 35 31 45 31 41 43 31 31 37 32 32 27 9 45 46 45 51 42 31 51 36 36 51 30 30 42 34 37 33 27 27 28 12 32 46 34 31 37 33 43 37 31 46 30 31 31 31 31 42 31 38 33 12 42 43 39 39 37 26 31 31 31 31 29 39 29 30 31 31 31 31 37 12 36 32 31 31 37 30 33 23 20 38 31 32 33 31 20 31 29 25 26 6 33 30 25 29 37 26 31 17 18 31 19 31 31 32 23 24 30 32 36 21 37 25 42 38 37 23 33 31 27 30 31 30 31 21 23 25 28 29 25 7 26 23 33 29 29 21 25 25 18 22 21 32 31 27 19 23 22 26 28 8 29 25 32 23 30 17 22 22 18 25 30 29 27 32 20 15 9 14 24 10 21 15 20 20 25 16 21 19 16 15 27 23 21 19 12 24 11 14 11 13 23 28 24 28 10 31 13 14 8 24 12 12 11 25 16 25 9 13 9 20 26 19 9 5 10 28 13 21 6 18 19 27 22 15 19 21 47 14 14 26 8 18 12 21 12 7 6 4 4 4 6 6 18 11 13 7 5 9 15 7 13 8 16 12 16 9 5 6 13 19 18 15 9 8 27 12 13 7 14 4 5 6 8 15 12 19 18 12 10 15 4 4 4 9 7 9 10 3 3 13 5 6 4 6 8 9 6 7 7 6 7 16 5 17 4 6 3 1 5 1 3 9 12 5 6 15 22 9 7 14 18 10 15 5 9 7 6 9 5 4 6 8 17 30 22 6 12 9 8 5	Open. Hide. 62 59 44 43 62 62 62 62 62 59 49 24 49 23 32 32 25 32 32 56 54 43 54 54 56 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 59 62 62 62 62 51 51 51 49 38 49 54 59 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 54 59 62 59 59 62 62 62 62 62 59 59 59 62 62 46 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 59 44 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 49 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 35 56 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 62 62 62 62 62 54 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 54 54 54 54 58 58 58 58 54 58 58 54 54 52 52 54 42 58 54 52 52 58 54 54 58 54 54 52 54 45 54 50 58 58 58 58 58 58 58 58 54 46 58 58 54 58 58 58 58 54 54 58 58 58 54 39 41 58 58 19 58 52 54 54 47 54 58 49 58 58 49 58 58 58 49 58 51 52 51 54 58 50 54 51 47 41 37 50 58 50 51 53 50 49 50 54 58 58 54 58 54 53 58 54 58 58 50 28 44 33 58 54 58 46 39 39 33 58 58 47 49 51 51 51 46 52 51 51 58 52 58 51 54 58 58 40 49 52 39 48 51 46 47 46 39 37 58 58 49 30 40 33 50 42 44 46 51 39 37 58 58 52 50 58 37 38 16 50 39 29 58 58 33 50 41 50 40 51 52 32 15 58 39 41 40 52 31 49 50 27 38 24 47 54 54 50 51 41 35 54 37 42 37 32 49 49 53 32 53 33 50 44 40 37 42 54 35 42 37 30 54 49 34 45 32 53 32 51 51 54 32 51 39 41 32 51 42 33 46 31 13 54 42 37 42 37 34 37 27 32 37 38 53 24 53 45 36 52 34 38 30 30 39 40 31 32 42 31 16 40 27 31 32 32 37 39 31 40 32 42 32 32 42 33 7 46 32 45 30 31 8 36 35 16 31 51 37 32 32 32 36 23 47 30 18 24 30 28 31 37 30 30 51 30 42 34 43 31 32 30 41 31 27 43 31 30 31 23 31 21 30 22 12 29 31 35 30 31 34 35 43 28 42 48 31 31 31 30 31 21 29 25 31 32 31 31 32 31 23 20 25 28 41 32 32 41 18 31 31 46 34 26 46 32 26 34 27 48 25 19 33 29 32 41 28 19 21 31 30 31 44 15 16 11 31 27 31 31 27 36 29 25 21 18 31 34 34 23 31 32 16 34 26 31 34 32 43 43 33 33 32 32 25 29 32 32 34 13 15 34 29 25 15 12 20 48 26 10 34 34 13 33 21 27 31 21 26 48 27 19 19 15 34 32 11 21 28 27 16 21 26 18 30 40 16 3 6 24 24 28 22 24 16 21 18 15 20 20 13 15 18 11 21 17 13 33 9 20 13 20 13 14 13 18 9 15 24 20 16 12 13 20 15 20 28 10 20 20 24 14 21 16 6 11 4 5 6 5 8 6 10 12 6 5 16 16 18 19 7 9 22 26 3 3 3 19 18 17 11 18 18 12 8 2 3 4 11 10 6 6 8 4 3 2 3 5 6 3 3 11 16 11 17 8 9 7 5 18 8 13 5 22 17 16 6 5 3 3 2 4 5 14 19 28 13 11 7 6 1 3 5 7 5 4 11 16 7 6 10 7 5 7 21 8 9 6 15 3 5 6 19 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_28057806_28058931
seq2: B6Ng01-276C07.b_46_1169 (reverse)

seq1  TCTGTAAAAAGACTG-AGTAGGACTTTGCTTTGGGCCTGGAAGAGT-AGG  48
      ||||| ||||||||| |||| |||||||  || | |   ||||||| |||
seq2  TCTGT-AAAAGACTGAAGTA-GACTTTGGCTTAGAC--TGAAGAGTAAGG  46

seq1  CAGAAATTAGCTTGAGCCTCTCAGCCCAGGTGAAGTCAGA-GCAACTTGG  97
      |||||| |||| |||| || |||||||||   |||||||| |||||||||
seq2  CAGAAA-TAGC-TGAG-CTTTCAGCCCAGTGAAAGTCAGAGGCAACTTGG  93

seq1  TACAGGTGAG-AGAGGCTAGGGTACAGTTGGA-GAGATTGGAATACAGGT  145
      |||||||||| ||||||||||||||||||||| |||||||||||||||||
seq2  TACAGGTGAGAAGAGGCTAGGGTACAGTTGGAGGAGATTGGAATACAGGT  143

seq1  GAAGAGGTTCAGGTGCAGGTGGAGAGGCTCAGGTGCAGGTGGAGAGGCTC  195
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAGGTTCAGGTGCAGGTGGAGAGGCTCAGGTGCAGGTGGAGAGGCTC  193

seq1  AGGTGCAGGTGGAGAGGCTCAGGTGCAGGTGGAGAGGCTCAGGTGCAGGT  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGCAGGTGGAGAGGCTCAGGTGCAGGTGGAGAGGCTCAGGTGCAGGT  243

seq1  GGAGAGGCTCAGGTGCAGGTGGAGAGGCTCAGGTGCAGATGGAGAGGCTC  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAGGCTCAGGTGCAGGTGGAGAGGCTCAGGTGCAGATGGAGAGGCTC  293

seq1  AGGTGCAGGTGGAGAGGCTCAGGTGCAGGTGGAGAGGCTCAGGTGCAGGT  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGCAGGTGGAGAGGCTCAGGTGCAGGTGGAGAGGCTCAGGTGCAGGT  343

seq1  GGAGAGGCTCAGATGCAGATGGAGAGGCTCAGATGCAGGTGGAGAGGTTC  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAGGCTCAGATGCAGATGGAGAGGCTCAGATGCAGGTGGAGAGGTTC  393

seq1  AAATTCAGGTAAGGGAGACTCAGGTGTTGATAAAGGTGGAGACACACAGG  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTCAGGTAAGGGAGACTCAGGTGTTGATAAAGGTGGAGACACACAGG  443

seq1  AGCAGGTGGAGCAGGAGGACTCAGGTATAAGTCAAGAGGCTCAATTTACA  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGTGGAGCAGGAGGACTCAGGTATAAGTCAAGAGGCTCAATTTACA  493

seq1  TGAGAGGGGCTCAGGTATGGATGCAAGTGGAGAGGTTCAGGTACATGTGG  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAGGGGCTCAGGTATGGATGCAAGTGGAGAGGTTCAGGTACATGTGG  543

seq1  AAAGACACAAATGCAGGTGCAAGTCGAGAGACCTGGATTCAAGTTAGAGG  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGACACAAATGCAGGTGCAAGTCGAGAGACCTGGATTCAAGTTAGAGG  593

seq1  CTCAGGTGTGGCTGCAGGTGTACAGGCTTCGGGGGTGGGGGTGGGGTGGA  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGGTGTGGCTGCAGGTGTACAGGCTTCGGGGGTGGGGGTGGGGTGGA  643

seq1  AAAACTTGAGCTAGAGCTGAAAGGGCAATTCTGTATTCACTGTACACCTC  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACTTGAGCTAGAGCTGAAAGGGCAATTCTGTATTCACTGTACACCTC  693

seq1  TGTTCCAATCGCATTAGGAAATGATCAGATGTGTGTTTCTTCAGTTCTCT  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCCAATCGCATTAGGAAATGATCAGATGTGTGTTTCTTCAGTTCTCT  743

seq1  GTCAATTTAGACACATTCTGAGGTGACCAGTTTCGACAAGCATCAGTGTG  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAATTTAGACACATTCTGAGGTGACCAGTTTCGACAAGCATCAGTGTG  793

seq1  GGTAGGGTTAGAATTTCCTTCCACCTGGCCTACTGATTGCCCTTCGATGT  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAGGGTTAGAATTTCCTTCCACCTGGCCTACTGATTGCCCTTCGATGT  843

seq1  CAGCTTGGTTCTCAACAGCCAGTTCCACTCTGAGGCATTCTATGTGAGTT  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTTGGTTCTCAACAGCCAGTTCCACTCTGAGGCATTCTATGTGAGTT  893

seq1  GATCAACTACGTTGAGTGCTTCTAATCCATTTCTTAGGGAAGCCTTGAAC  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCAACTACGTTGAGTGCTTCTAATCCATTTCTTAGGGAAGCCTTGAAC  943

seq1  CTCTGGCTCCCTACATAGGCTTAGAAGAAGTATGAGCTGGAGGTCAAATC  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGGCTCCCTACATAGGCTTAGAAGAAGTATGAGCTGGAGGTCAAATC  993

seq1  TTTGTCATTCCACAGTGACCTGTTGAGGTGAGGGTGGGAGACAGTTCCTG  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTCATTCCACAGTGACCTGTTGAGGTGAGGGTGGGAGACAGTTCCTG  1043

seq1  GCCAGTGGTACGAAAGGCTACCTACTTGTTCCTGGGACTACTTGACCAGA  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGTGGTACGAAAGGCTACCTACTTGTTCCTGGGACTACTTGACCAGA  1093

seq1  CCAAAGCTTCACTGTTTCAAACTCTGAATTC  1126
      |||||||||||||||||||||||||||||||
seq2  CCAAAGCTTCACTGTTTCAAACTCTGAATTC  1124

seq1: chr2_27934162_27935268
seq2: B6Ng01-276C07.g_68_1179

seq1  GAATTCTCCCAGAGGGCTGTGCTTTCTAATGCAGTAGCCTGAACCTGGAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCCCAGAGGGCTGTGCTTTCTAATGCAGTAGCCTGAACCTGGAT  50

seq1  GTGCAAGGTTTTAGATTTTTTTTTTTAAATTGGAAGCACAGAAGCAGACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCAAGGTTTTAGATTTTTTTTTTTAAATTGGAAGCACAGAAGCAGACA  100

seq1  CAATAAGGTGTCCTGGTAGTGAGTAAGTGGCAAAAGGCTATGTGATTTTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATAAGGTGTCCTGGTAGTGAGTAAGTGGCAAAAGGCTATGTGATTTTC  150

seq1  AGTGGGAGGAGAAGGGACTAAGAGAGCTTGCTTTCTCTGTGGCTTGTAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGGAGGAGAAGGGACTAAGAGAGCTTGCTTTCTCTGTGGCTTGTAGA  200

seq1  GGCAAAGGGGACTTTTGTAGAACCCAGAGGCAAGTGTTCTGGATGAATTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAAAGGGGACTTTTGTAGAACCCAGAGGCAAGTGTTCTGGATGAATTA  250

seq1  ACAGCTAGAGATGAAAAACAATGTCCCCAAGACATTGGCTGGGTCCTGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCTAGAGATGAAAAACAATGTCCCCAAGACATTGGCTGGGTCCTGAG  300

seq1  AAGTCATATCCCACAGTTTAGAGGAGGCCCTTATCCCCTGACTTTCACCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCATATCCCACAGTTTAGAGGAGGCCCTTATCCCCTGACTTTCACCC  350

seq1  AGCAGAAGGGCACAGCTGTGATCTCACTCCCTGGGGTGACTTTGCTGAGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGAAGGGCACAGCTGTGATCTCACTCCCTGGGGTGACTTTGCTGAGC  400

seq1  ATTGCATACTCTAACCATGGGGGACTCTTGCCCCATGACCCAGGGTCCCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGCATACTCTAACCATGGGGGACTCTTGCCCCATGACCCAGGGTCCCA  450

seq1  AGGTTACCCCATCTGGCCGGCATTACCTACCCTGGGTGGTTAGAGCGTGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTACCCCATCTGGCCGGCATTACCTACCCTGGGTGGTTAGAGCGTGG  500

seq1  ATATTATCATTCCCCAGCCAGAACTCCCCTAGTTGGCTGCCAAAGCCCCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTATCATTCCCCAGCCAGAACTCCCCTAGTTGGCTGCCAAAGCCCCT  550

seq1  CTTGTATGAGGTCCAGTCCCGAAAGAAGTCCACAGAGCCGTCAAGCCTCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTATGAGGTCCAGTCCCGAAAGAAGTCCACAGAGCCGTCAAGCCTCC  600

seq1  TCTGGAAGACCTGAGACCGTGAAATATACACAGAAGTCAACACAAGGAAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGAAGACCTGAGACCGTGAAATATACACAGAAGTCAACACAAGGAAC  650

seq1  CAAGCCTCAAAGCAGAGCAGGAATCCAAGATTCTCAGAAGACTGGGAACC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGCCTCAAAGCAGAGCAGGAATCCAAGATTCTCAGAAGACTGGGAACC  700

seq1  TAGTGCCATAAACAGGTCATGGCAGACCCCATACACCTGAGGGTCAGCTA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTGCCATAAACAGGTCATGGCAGACCCCATACACCTGAGGGTCAGCTA  750

seq1  TGAGAATAGGCATCATGACCCAAGCCACACAGCAGGAAGAGGAGTGGCCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAATAGGCATCATGACCCAAGCCACACAGCAGGAAGAGGAGTGGCCT  800

seq1  TCCCTTCAACGTGTGCTCTCTCACACAGGTTACCTGTCAGCATTTCTGAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTTCAACGTGTGCTCTCTCACACAGGTTACCTGTCAGCATTTCTGAT  850

seq1  TCTCTATCTTCAAAGAGTAAAGGGCTCCCTCTGGGGTACAAAGGATCAGA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTATCTTCAAAGAGTAAAGGGCTCCCTCTGGGGTACAAAGGATCAGA  900

seq1  ATCCTACATAGCTCATTTTCTGCTGACCATGGAATTT-GGGTTCTGAAAG  949
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  ATCCTACATAGCTCATTTTCTGCTGACCATGGAATTTGGGGTTCTGAAAG  950

seq1  TTCAGTGACCAGGGGCTAGCTCAACACTCACGGT-CCAGCCTCCACCATC  998
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  TTCAGTGACCAGGGGCTAGCTCAACACTCACGGTCCCAGCCTCCACCATC  1000

seq1  TGTGTCCATGTCACA--CAGC-ACAGTCAGGGGCCTGCAGTCTGGCAGAT  1045
      |||||||||||||||   ||| ||||||||||| ||||||||| ||||||
seq2  TGTGTCCATGTCACAACAAGCAACAGTCAGGGG-CTGCAGTCT-GCAGAT  1048

seq1  AGATGGTATACCAGCCAGT-GAGAAAGTGGCCCTGGGTGAGCAACTCCTT  1094
      |||||   ||||||||||| ||||||||| |   |||||||||  |||||
seq2  AGATGTATTACCAGCCAGTGGAGAAAGTGCCTTGGGGTGAGCACTTCCTT  1098

seq1  G-CAGGTCCGAGGT  1107
      | ||| ||||||||
seq2  GCCAGTTCCGAGGT  1112

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information