MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-281H08
Chromosome	2 (Build37)
Map Location	130,104,275 - 130,308,748
singlet/doublet	doublet
Overlap gene	Nol5a, Idh3b, Ebf4, LOC668899, Cpxm1, LOC100043446, 1700020A23Rik, 4933425O20Rik, A930025D01Rik, Vps16
Upstream gene	Ckap2l, Il1a, Il1b, OTTMUSG00000015529, LOC668896, F830045P16Rik, Sirpa, Pdyn, Ppia-ps2_1620.1, Stk35, Tgm3, AU015228, LOC100043438, Tgm6, Snrpb, Tmc2
Downstream gene	Ptpra, Mrps26, Oxt, Avp, 1700012O15Rik, Ubox5, Fastkd5, Prosapip1, 2600009E05Rik, Itpa, Slc4a11, 4930402H24Rik, LOC100043766, C030014O09Rik, LOC627316, Atrn, LOC100043768, Gfra4, Adam33, Siglec1, LOC100043457, Hspa12b, 1700037H04Rik, Spef1, Cenpb, Cdc25b, 2310035K24Rik, D430028G21Rik, Pank2, Rnf24, LOC100043463
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ckap2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70466 MGI:1917716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16175 MGI:96542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16176 MGI:96543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000015529 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329514 MGI:3650458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668896 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668896
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 4 Proteins pseudo : _no_value

name	F830045P16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228592 MGI:3045317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sirpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19261 MGI:108563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdyn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18610 MGI:97535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppia-ps2_1620.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545463
definition	note : peptidylprolyl isomerase A (Ppia) pseudogene 2_1620.1 pseudo : _no_value

name	Stk35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67333 MGI:1914583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tgm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21818 MGI:98732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AU015228 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99169 MGI:2139152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043438 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Tgm6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241636 MGI:3044321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20638 MGI:98342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192140 MGI:2151017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67134 MGI:1914384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Idh3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170718 MGI:2158650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ebf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228598 MGI:2385972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668899 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 788 ESTs, 7 Proteins

name	Cpxm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56264 MGI:1934569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043446 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	1700020A23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75656 MGI:1922906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins

name	4933425O20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66766 MGI:1914016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930025D01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319513 MGI:2442177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80743 MGI:2136772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptpra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19262 MGI:97808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99045 MGI:1333830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oxt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18429 MGI:97453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Avp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11998 MGI:88121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700012O15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75488 MGI:1922738
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs

name	Ubox5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140629 MGI:2154658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fastkd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380601 MGI:2139469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prosapip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241638 MGI:2656976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2600009E05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77006 MGI:1924256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16434 MGI:96622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc4a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269356 MGI:2138987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930402H24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228602 MGI:1923029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043766 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 13 Proteins pseudo : _no_value

name	C030014O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77463 MGI:1924713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC627316 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 263 ESTs, 12 Proteins pseudo : _no_value

name	Atrn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11990 MGI:1341628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043768 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043768
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 11 Proteins pseudo : _no_value

name	Gfra4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14588 MGI:1341873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110751 MGI:1341813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Siglec1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20612 MGI:99668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043457 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043457
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Hspa12b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72630 MGI:1919880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700037H04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67326 MGI:1914576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70997 MGI:3513546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12616 MGI:88376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc25b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12531 MGI:99701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310035K24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69596 MGI:1916846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D430028G21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228607 MGI:2444773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pank2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74450 MGI:1921700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51902 MGI:1261771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043463 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ckap2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31795584 GeneID:70466 MGI:1917716
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytoskeleton associated protein 2-like transcript_id : NM_181589.2

name	Il1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130060 GeneID:16175 MGI:96542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 alpha transcript_id : NM_010554.4

name	Il1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130747 GeneID:16176 MGI:96543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 beta transcript_id : NM_008361.3

name	OTTMUSG00000015529 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377485 GeneID:329514 MGI:3650458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000015529 transcript_id : NM_177848.3

name	F830045P16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821686 GeneID:228592 MGI:3045317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F830045P16 gene transcript_id : NM_177653.3

name	Sirpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626108 GeneID:19261 MGI:108563
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal-regulatory protein alpha transcript_id : NM_007547.2

name	Pdyn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24476002 GeneID:18610 MGI:97535
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prodynorphin transcript_id : NM_018863.2

name	Stk35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490406 GeneID:67333 MGI:1914583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 35 transcript_id : NM_183262.2

name	Stk35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490408 GeneID:67333 MGI:1914583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 35 transcript_id : NM_001038635.1

name	Tgm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001550 GeneID:21818 MGI:98732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transglutaminase 3, E polypeptide transcript_id : NM_009374.2

name	AU015228 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359103 GeneID:99169 MGI:2139152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU015228 transcript_id : NM_001033197.2

name	LOC100043438 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250008 GeneID:100043438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to Ubtf protein transcript_id : XM_001480168.1

name	Tgm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893375 GeneID:241636 MGI:3044321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transglutaminase 6 transcript_id : NM_177726.3

name	Snrpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378002 GeneID:20638 MGI:98342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein B transcript_id : NM_009225.2

name	Tmc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149733 GeneID:192140 MGI:2151017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane channel-like gene family 2 transcript_id : NM_138655.1

name	Nol5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090931 GeneID:67134 MGI:1914384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 5A transcript_id : NM_024193.2

name	Idh3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801765 GeneID:170718 MGI:2158650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : isocitrate dehydrogenase 3 (NAD+) beta transcript_id : NM_130884.2

name	Ebf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23308719 GeneID:228598 MGI:2385972
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : early B-cell factor 4 transcript_id : NM_152993.1

name	LOC668899 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250143 GeneID:668899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 788 ESTs, 7 Proteins product : similar to ribosomal protein L27a transcript_id : XM_001004506.2

name	Cpxm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9789916 GeneID:56264 MGI:1934569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase X 1 (M14 family) transcript_id : NM_019696.1

name	1700020A23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367228 GeneID:75656 MGI:1922906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins product : RIKEN cDNA 1700020A23 gene, transcript variant 2 transcript_id : XM_894775.2

name	4933425O20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801888 GeneID:66766 MGI:1914016
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933425O20 gene transcript_id : NM_025753.3

name	A930025D01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803380 GeneID:319513 MGI:2442177
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930025D01 gene transcript_id : NM_178762.3

name	Vps16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46852152 GeneID:80743 MGI:2136772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 16 (yeast) transcript_id : NM_030559.2

name	Ptpra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679556 GeneID:19262 MGI:97808
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, A transcript_id : NM_008980.1

name	Mrps26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402168 GeneID:99045 MGI:1333830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S26 transcript_id : NM_207207.1

name	Oxt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359854 GeneID:18429 MGI:97453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxytocin transcript_id : NM_011025.3

name	Avp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753149 GeneID:11998 MGI:88121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginine vasopressin transcript_id : NM_009732.1

name	1700012O15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250151 GeneID:75488 MGI:1922738
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs product : RIKEN cDNA 1700012O15 gene transcript_id : XM_001480924.1

name	Ubox5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802671 GeneID:140629 MGI:2154658
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U box domain containing 5 transcript_id : NM_080562.3

name	Fastkd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38016134 GeneID:380601 MGI:2139469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FAST kinase domains 5 transcript_id : NM_198176.1

name	Prosapip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38372902 GeneID:241638 MGI:2656976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ProSAPiP1 protein transcript_id : NM_197945.2

name	2600009E05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802963 GeneID:77006 MGI:1924256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2600009E05 gene transcript_id : NM_029832.2

name	Itpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982663 GeneID:16434 MGI:96622
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inosine triphosphatase (nucleoside triphosphate pyrophosphatase) transcript_id : NM_025922.2

name	Slc4a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487206 GeneID:269356 MGI:2138987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 4, sodium bicarbonate transporter-like, member 11 transcript_id : NM_001081162.1

name	4930402H24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33695156 GeneID:228602 MGI:1923029
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930402H24 gene transcript_id : NM_029432.1

name	C030014O09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250011 GeneID:77463 MGI:1924713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA C030014O09 gene transcript_id : XM_001480201.1

name	Atrn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299634 GeneID:11990 MGI:1341628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : attractin transcript_id : NM_009730.2

name	Gfra4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910239 GeneID:14588 MGI:1341873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glial cell line derived neurotrophic factor family receptor alpha 4 transcript_id : NM_020014.1

name	Adam33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956237 GeneID:110751 MGI:1341813
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 33 transcript_id : NM_033615.1

name	Siglec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938285 GeneID:20612 MGI:99668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialic acid binding Ig-like lectin 1, sialoadhesin transcript_id : NM_011426.2

name	LOC100043457 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250013 GeneID:100043457
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043457 transcript_id : XM_001480206.1

name	Hspa12b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130472 GeneID:72630 MGI:1919880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein 12B transcript_id : NM_028306.3

name	1700037H04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801935 GeneID:67326 MGI:1914576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700037H04 gene transcript_id : NM_026091.2

name	Spef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114687765 GeneID:70997 MGI:3513546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm flagellar 1 transcript_id : NM_027641.2

name	Cenpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328104 GeneID:12616 MGI:88376
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein B transcript_id : NM_007682.2

name	Cdc25b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963486 GeneID:12531 MGI:99701
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 25 homolog B (S. pombe) transcript_id : NM_023117.1

name	2310035K24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980818 GeneID:69596 MGI:1916846
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310035K24 gene transcript_id : NM_027129.2

name	D430028G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450262 GeneID:228607 MGI:2444773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D430028G21 gene transcript_id : NM_144888.1

name	Pank2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943833 GeneID:74450 MGI:1921700
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pantothenate kinase 2 (Hallervorden-Spatz syndrome) transcript_id : NM_153501.1

name	Rnf24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130609 GeneID:51902 MGI:1261771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 24 transcript_id : NM_178607.3

name	Ckap2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712008 CCDS:CCDS16724.1 GeneID:70466 MGI:1917716
definition	codon_start : 1 product : cytoskeleton associated protein 2-like protein_id : NP_853620.1

name	Il1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059075 CCDS:CCDS16725.1 GeneID:16175 MGI:96542
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0001660 - fever [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : interleukin 1 alpha protein_id : NP_034684.2

name	Il1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680415 CCDS:CCDS16726.1 GeneID:16176 MGI:96543
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IDA]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0001660 - fever [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0050900 - leukocyte migration [Evidence IDA]; GO:0030593 - neutrophil chemotaxis [Evidence IDA]; GO:0045080 - positive regulation of chemokine biosynthesis [Evidence IDA]; GO:0045410 - positive regulation of interleukin-6 biosynthesis [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : interleukin 1, beta protein_id : NP_032387.1

name	OTTMUSG00000015529 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244430 GeneID:329514 MGI:3650458
definition	codon_start : 1 product : hypothetical protein LOC329514 protein_id : NP_808516.1

name	F830045P16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244066 CCDS:CCDS16728.1 GeneID:228592 MGI:3045317
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : novel immunoglobulin C1-set domain containing protein product : hypothetical protein LOC228592 protein_id : NP_808321.1

name	Sirpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626109 CCDS:CCDS16729.1 GeneID:19261 MGI:108563
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0045309 - protein phosphorylated amino acid binding [Evidence IPI] GO_process : GO:0007015 - actin filament organization [Evidence IMP]; GO:0006928 - cell motility [Evidence IMP]; GO:0007160 - cell-matrix adhesion [Evidence IMP]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IMP]; GO:0006911 - phagocytosis, engulfment [Evidence IDA]; GO:0006910 - phagocytosis, recognition [Evidence IDA]; GO:0050766 - positive regulation of phagocytosis [Evidence IDA] codon_start : 1 note : brain immunological-like with tyrosine-based motifs; protein tyrosine phosphatase, non-receptor type substrate 1 product : signal-regulatory protein alpha protein_id : NP_031573.2

name	Pdyn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256622 GeneID:18610 MGI:97535
definition	GO_function : GO:0005184 - neuropeptide hormone activity [Evidence ISS]; GO:0001515 - opioid peptide activity [Evidence IEA] GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007268 - synaptic transmission [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : beta-neoendorphin-dynorphin preproprotein protein_id : NP_061351.1

name	Stk35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490409 CCDS:CCDS16731.1 GeneID:67333 MGI:1914583
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; CLP-36 interacting kinase product : serine/threonine kinase 35 isoform b protein_id : NP_001033724.1

name	Stk35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490407 CCDS:CCDS16732.1 GeneID:67333 MGI:1914583
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; CLP-36 interacting kinase product : serine/threonine kinase 35 isoform a protein_id : NP_899085.2

name	Tgm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001551 GeneID:21818 MGI:98732
definition	GO_component : GO:0001533 - cornified envelope [Evidence TAS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0031234 - extrinsic to internal side of plasma membrane [Evidence ISS] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA] [Evidence ISS]; GO:0019003 - GDP binding [Evidence ISS]; GO:0005525 - GTP binding [Evidence ISS]; GO:0003924 - GTPase activity [Evidence ISS]; GO:0000287 - magnesium ion binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003810 - protein-glutamine gamma-glutamyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016746 - transferase activity, transferring acyl groups [Evidence ISS] GO_process : GO:0043163 - cell envelope organization and biogenesis [Evidence ISS]; GO:0035315 - hair cell differentiation [Evidence TAS]; GO:0031069 - hair follicle morphogenesis [Evidence ISS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence ISS]; GO:0018149 - peptide cross-linking [Evidence IEA] [Evidence TAS] [Evidence ISS]; GO:0051262 - protein tetramerization [Evidence ISS]; GO:0043588 - skin development [Evidence TAS] codon_start : 1 note : E polypeptide; protein-glutamine-gamma-glutamyltransferase; TG E product : transglutaminase 3, E polypeptide protein_id : NP_033400.2

name	AU015228 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701612 GeneID:99169 MGI:2139152
definition	GO_component : GO:0005673 - transcription factor TFIIE complex [Evidence IEA] GO_function : GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006367 - transcription initiation from RNA polymerase II promoter [Evidence IEA] codon_start : 1 note : general transcription factor II E, polypeptide 1-like product : hypothetical protein LOC99169 protein_id : NP_001028369.1

name	LOC100043438 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250009 GeneID:100043438
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480218.1

name	Tgm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244202 CCDS:CCDS16734.1 GeneID:241636 MGI:3044321
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003810 - protein-glutamine gamma-glutamyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018149 - peptide cross-linking [Evidence IEA] codon_start : 1 product : transglutaminase 6 protein_id : NP_808394.1

name	Snrpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678053 CCDS:CCDS16735.1 GeneID:20638 MGI:98342
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA] codon_start : 1 product : small nuclear ribonucleoprotein B protein_id : NP_033251.1

name	Tmc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149734 CCDS:CCDS16736.1 GeneID:192140 MGI:2151017
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane, cochlear expressed 2 product : transmembrane channel-like gene family 2 protein_id : NP_619596.1

name	Nol5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090932 CCDS:CCDS16737.1 GeneID:67134 MGI:1914384
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : 56kDa with KKE/D repeat product : nucleolar protein 5A protein_id : NP_077155.2

name	Idh3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700024 CCDS:CCDS16738.1 GeneID:170718 MGI:2158650
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016652 - oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor [Evidence IEA] codon_start : 1 note : N14A tumor-related protein; isocitrate dehydrogenase 3 beta product : isocitrate dehydrogenase 3, beta subunit protein_id : NP_570954.1

name	Ebf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23308720 GeneID:228598 MGI:2385972
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Olf-1/EBF-like 4; Olf-1/EBF-like-4/132 transcription factor; early B-cell factor 3 product : early B-cell factor 4 protein_id : NP_694538.1

name	LOC668899 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367245 GeneID:668899
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004506.1

name	Cpxm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789917 CCDS:CCDS16740.1 GeneID:56264 MGI:1934569
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA]; GO:0004180 - carboxypeptidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : metallocarboxypeptidase CPX-1; metallocarboxypeptidase 1; carboxypeptidase X (M14 family) product : carboxypeptidase X 1 (M14 family) protein_id : NP_062670.1

name	1700020A23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82886863 GeneID:75656 MGI:1922906
definition	codon_start : 1 product : hypothetical protein LOC75656 isoform 2 protein_id : XP_899868.1

name	4933425O20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313328 CCDS:CCDS16742.1 GeneID:66766 MGI:1914016
definition	codon_start : 1 product : hypothetical protein LOC66766 protein_id : NP_080029.1

name	A930025D01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520223 GeneID:319513 MGI:2442177
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC319513 protein_id : NP_848877.1

name	Vps16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46852153 GeneID:80743 MGI:2136772
definition	GO_component : GO:0005884 - actin filament [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005769 - early endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vacuolar protein sorting 16 protein_id : NP_085036.2

name	Ptpra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679557 CCDS:CCDS16743.1 GeneID:19262 MGI:97808
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008286 - insulin receptor signaling pathway [Evidence IMP]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protein tyrosine phosphatase, receptor type, A protein_id : NP_033006.1

name	Mrps26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402169 CCDS:CCDS16744.1 GeneID:99045 MGI:1333830
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S26 protein_id : NP_997090.1

name	Oxt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754960 CCDS:CCDS16745.1 GeneID:18429 MGI:97453
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005185 - neurohypophyseal hormone activity [Evidence IEA] codon_start : 1 product : oxytocin protein_id : NP_035155.1

name	Avp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753150 CCDS:CCDS16746.1 GeneID:11998 MGI:88121
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005185 - neurohypophyseal hormone activity [Evidence IEA] GO_process : GO:0030146 - diuresis [Evidence IDA]; GO:0030819 - positive regulation of cAMP biosynthesis [Evidence IDA]; GO:0050880 - regulation of blood vessel size [Evidence IEA]; GO:0042310 - vasoconstriction [Evidence IEA] codon_start : 1 product : arginine vasopressin protein_id : NP_033862.1

name	1700012O15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250152 GeneID:75488 MGI:1922738
definition	codon_start : 1 product : hypothetical protein LOC75488 protein_id : XP_001480974.1

name	Ubox5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543595 CCDS:CCDS16747.1 GeneID:140629 MGI:2154658
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000151 - ubiquitin ligase complex [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016567 - protein ubiquitination [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : UbcM4-interacting protein 5; ring finger protein 37 product : ubiquitin conjugating enzyme 7 interacting protein 5 protein_id : NP_542129.2

name	Fastkd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016135 GeneID:380601 MGI:2139469
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : FAST kinase domains 5 protein_id : NP_937819.1

name	Prosapip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38372903 GeneID:241638 MGI:2656976
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : ProSAPiP1 protein protein_id : NP_922936.2

name	2600009E05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110350660 GeneID:77006 MGI:1924256
definition	codon_start : 1 product : hypothetical protein LOC77006 protein_id : NP_084108.1

name	Itpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982664 CCDS:CCDS16748.1 GeneID:16434 MGI:96622
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0047429 - nucleoside-triphosphate diphosphatase activity [Evidence IDA] GO_process : GO:0009117 - nucleotide metabolism [Evidence IEA] codon_start : 1 note : nucleoside triphosphate pyrophosphatase; inosine triphosphate pyrophosphatase product : inosine triphosphatase protein_id : NP_080198.2

name	Slc4a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487207 GeneID:269356 MGI:2138987
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005452 - inorganic anion exchanger activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence IEA] codon_start : 1 product : solute carrier family 4, sodium bicarbonate transporter-like, member 11 protein_id : NP_001074631.1

name	4930402H24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33695157 CCDS:CCDS16750.1 GeneID:228602 MGI:1923029
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC228602 protein_id : NP_083708.1

name	C030014O09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250012 GeneID:77463 MGI:1924713
definition	codon_start : 1 product : hypothetical protein LOC77463 protein_id : XP_001480251.1

name	Atrn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299635 CCDS:CCDS16751.1 GeneID:11990 MGI:1341628
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0040014 - regulation of body size [Evidence IMP] codon_start : 1 product : attractin protein_id : NP_033860.2

name	Gfra4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910240 CCDS:CCDS16752.1 GeneID:14588 MGI:1341873
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015026 - coreceptor activity [Evidence TAS]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007399 - nervous system development [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence TAS] codon_start : 1 note : GFR alpha-4 product : glial cell line derived neurotrophic factor family receptor alpha 4 protein_id : NP_064398.1

name	Adam33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956238 CCDS:CCDS16753.1 GeneID:110751 MGI:1341813
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence NAS] [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence NAS] [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence NAS] [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence NAS]; GO:0042035 - regulation of cytokine biosynthesis [Evidence NAS] codon_start : 1 exception : mismatches in translation note : disintegrin and metalloprotease domain 33 product : a disintegrin and metalloprotease domain 33 protein_id : NP_291093.1

name	Siglec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938286 CCDS:CCDS16754.1 GeneID:20612 MGI:99668
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0016337 - cell-cell adhesion [Evidence ISS]; GO:0007160 - cell-matrix adhesion [Evidence ISS]; GO:0006954 - inflammatory response [Evidence ISS] codon_start : 1 product : sialoadhesin protein_id : NP_035556.2

name	LOC100043457 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250014 GeneID:100043457
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480256.1

name	Hspa12b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312236 CCDS:CCDS16755.1 GeneID:72630 MGI:1919880
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : HSPA12B protein_id : NP_082582.1

name	1700037H04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385590 CCDS:CCDS16756.1 GeneID:67326 MGI:1914576
definition	codon_start : 1 product : hypothetical protein LOC67326 protein_id : NP_080367.1

name	Spef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625792 GeneID:70997 MGI:3513546
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0019861 - flagellum [Evidence IEA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA] codon_start : 1 note : calponin-homology and microtubule-associated protein product : sperm flagellar 1 protein_id : NP_081917.1

name	Cenpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328105 CCDS:CCDS16757.1 GeneID:12616 MGI:88376
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : centromere autoantigen B protein_id : NP_031708.2

name	Cdc25b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963487 CCDS:CCDS16758.1 GeneID:12531 MGI:99701
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007144 - female meiosis I [Evidence IMP]; GO:0000087 - M phase of mitotic cell cycle [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0001556 - oocyte maturation [Evidence IMP]; GO:0045860 - positive regulation of protein kinase activity [Evidence IMP]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : cell division cycle 25B product : cell division cycle 25 homolog B protein_id : NP_075606.1

name	2310035K24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980819 CCDS:CCDS16759.1 GeneID:69596 MGI:1916846
definition	codon_start : 1 product : hypothetical protein LOC69596 protein_id : NP_081405.2

name	D430028G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450263 CCDS:CCDS16760.1 GeneID:228607 MGI:2444773
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : mitochondrial anti-viral signaling protein product : virus-induced signaling adapter protein_id : NP_659137.1

name	Pank2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51571537 CCDS:CCDS16761.1 GeneID:74450 MGI:1921700
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004594 - pantothenate kinase activity [Evidence IGI] GO_process : GO:0015937 - coenzyme A biosynthesis [Evidence IEA] codon_start : 1 product : pantothenate kinase 2 protein_id : NP_705721.2

name	Rnf24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519929 CCDS:CCDS16762.1 GeneID:51902 MGI:1261771
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ring finger protein 24 protein_id : NP_848722.1

name	LOC100043446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043446
definition	number : 1 pseudo : _no_value

name	LOC100043446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043446
definition	number : 2 pseudo : _no_value

name	LOC100043446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043446
definition	number : 3 pseudo : _no_value

name	LOC100043446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043446
definition	number : 4 pseudo : _no_value

name	LOC100043463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043463
definition	number : 4 pseudo : _no_value

name	LOC100043463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043463
definition	number : 3 pseudo : _no_value

name	LOC100043463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043463
definition	number : 2 pseudo : _no_value

name	LOC100043463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043463
definition	number : 1 pseudo : _no_value

name	LOC668896 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250136 GeneID:668896
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 4 Proteins product : similar to signal peptidase complex subunit 2 homolog pseudo : _no_value transcript_id : XR_034890.1

name	LOC100043766 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250157 GeneID:100043766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 13 Proteins product : similar to PKC-potentiated PP1 inhibitory protein pseudo : _no_value transcript_id : XR_034913.1

name	LOC627316 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250158 GeneID:627316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 263 ESTs, 12 Proteins product : similar to proteasome 26S non-ATPase subunit 11 pseudo : _no_value transcript_id : XR_034915.1

name	LOC100043768 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250159 GeneID:100043768
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 11 Proteins product : similar to high mobility group box 1 pseudo : _no_value transcript_id : XR_034918.1

clone name	MSMg01-139N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-440B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-390E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398L13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-398D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-059O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305K16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-385A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-266D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417P15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-309B11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350E17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-281H08.b	B6Ng01-281H08.g
ACC	GA080930	GA080931
length	1,174	1,150
definition	B6Ng01-281H08.b	B6Ng01-281H08.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(130,307,577 - 130,308,748)	(130,104,275 - 130,105,402)
sequence	gaattcacaagacattaggcttttccaagtaggccgttggcacggcttgc ttgtacaaaagcttgaactgtgtggctgcaaagctgttcgcataccattg cacagtctcccagtgacactgggcaatgtgtaaagctggttttgatcacc ataaatgaaggcatgaggactgtgtcatggacatataagggtcaaggcct gggatgctgctaaacatcttataaatcaaggcaggctcctagaacaaaga cttctccagcctggaaatgtctatgatgtcaaggcttttcagccatgcac tatggggaaatcttattttcgggcttttttttttctctctctctctctta gaaagcttgtactaatgggagggactggaaggagaggaaattgcagtcag gatgtaaaatacatatatacatacatacatacatgaatgataaaaatgtt ctctcaactcatgggcaactaaaataaccgaataaatatctaataaaata gctagtcaggtgtggtagtgcacacctgtaacgccagcacttggaaggct tgaggcaggggatcacaagtctgcggtcagcctggcatacctacatcttg tgtcagatgaaaagacaaacaaaaagaaccccaaagataacaacctcctt cacttaagaactctcaacgaaatacaactctatataagtgctcttatatg ctctaccttatttgacttccaacagtcctcactataagagggaaactatt cctcccactatttagggaaatagctcataaccagacacttgcccacagtc acaaataagtaactacaaagacaaaagtctgaatgtgctgagtccgagtc tgaagccttcattttaccatcaccttcccctgccccttcggacggagaac tgaatattcattcaatttacaaactactaaacaccatatgggaccagtgg cccaaggctgctgaagggggctggggaaaatatttggttcatcacgaggc tcaagtatctcaacagtgtggtgactcaacaccgaatagtctaagacttg ggagaatagagccagatgatcaaaggttgatgggtcattctgggctcaca tgagtatggcagcttgggctaagagaacctgttctctcaacattgaacaa caataggcaagcttaactggtcct	gaattcctgctctccctgttctgtgtctggaggtgatagtgtctcatgat ggggggtgggggcagggaggtcaccaatgtgacagtttagaattgtccct taggcttttttttaaaatcttgagctattagtgattttcatttcagtgtt ccctgggagctctgcatgatatccatcgtgagcagcatacagggggtttt ctctagggtttaagagggccagggaaattataaaatgtgagagtaggtag atcattaagtcaccagaagtactaggtttgctcttctgcctggattctaa tgggagctgtggctgctaacaattgtaagcaatgtcccgtgtctgattcc cccttcaggaggtaaatgaaaaatctaagaagaaaaagaagttaaaaccc caggaaaatggaatggaagacccacctgtctctctacctaaatccaagaa aaagaaagctcccaaggaggagttggccagtgaccttgaagagatggcca ctagcagtgctaagagaaagaagtcctcacctaaggaggaagtggccagt gaaccagaagaggcagcaagccccaccacccctaagaagaaaaggaaatt ttctgaggagcctgaagttgctgctaacttcacaaagagcagcacaaaga aaaagaaaaagtcccagaaagcacaggaggattagaacggacctgcttgg tgggaggggcataccttgtggcagctcctgcccatgaatgataaaacccc aataaaaacacaaaaaccagatagtatgtgtgtattttgtttattgacta tttttttcatgggccatgtataggatttatgacagggcagtaatgacagc cttcagtgaagtcatgacatgtggcataaccacccatatctgaggttcga acctgtggggaaaaagttatcatcttagggtctgggccttggtcgcaaca accaaccctttgtagattaccctttaccccagcccccaggaacaggcctt agcttcagaaaagcctattaatagtctactgtcaggatgattcctctttc tgggtccatgtacttgaagggatgtataccgagccatggtcctttttgaa tttgagggagtaaggctctaacccccattgtggggggttgccaggtggcc
quality values	Open. Hide. 52 36 20 26 58 26 18 39 28 54 52 49 48 52 47 62 47 41 41 56 62 62 62 62 62 42 26 47 62 54 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 54 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 54 58 54 49 54 58 52 58 58 58 58 39 58 54 38 54 52 58 58 58 54 39 49 52 54 46 58 58 41 36 35 54 52 54 52 58 52 58 58 58 58 58 58 58 52 52 39 53 58 58 58 58 58 49 51 53 58 46 58 51 52 54 40 58 58 54 58 58 53 58 51 51 51 50 58 35 58 58 58 58 58 50 49 46 40 58 58 51 40 58 58 58 54 50 58 34 37 58 58 51 50 58 58 52 44 46 43 58 50 50 50 54 58 51 49 51 39 58 51 50 51 54 54 49 58 31 58 49 46 51 51 51 38 40 42 50 50 58 58 50 53 53 52 50 42 46 58 54 51 50 53 41 52 47 58 40 51 53 50 54 58 52 50 50 41 53 49 47 50 50 58 52 41 50 58 52 52 41 37 58 39 50 39 29 33 33 32 39 25 21 40 37 47 37 53 53 53 53 39 38 35 35 49 35 50 40 50 32 42 44 42 54 40 39 43 39 53 49 49 54 39 33 54 40 32 33 33 40 28 54 49 33 12 54 51 54 54 40 30 32 40 45 53 41 40 40 37 30 52 53 34 37 53 37 37 37 33 51 37 45 54 54 40 39 29 28 20 33 26 45 20 47 32 45 28 33 18 36 32 22 31 41 31 35 29 46 33 36 32 27 32 40 40 32 26 35 45 42 43 34 28 31 42 34 37 33 37 36 31 24 35 32 29 20 44 12 30 27 27 30 37 36 21 33 45 31 30 32 32 33 51 51 35 32 31 31 29 34 38 31 27 29 30 31 34 48 47 46 25 31 31 31 31 22 9 14 31 24 38 31 15 30 31 31 23 43 37 32 36 31 33 33 31 22 31 32 36 24 34 32 27 21 19 27 46 31 29 31 16 37 28 17 28 34 31 31 22 36 31 31 26 41 41 28 43 31 31 38 44 31 26 13 30 27 28 21 21 12 19 44 33 13 25 20 31 32 35 33 31 29 26 23 25 17 44 41 36 44 31 25 25 41 41 10 14 6 5 5 4 9 4 25 17 21 18 6 15 14 15 20 25 27 34 24 37 13 15 22 32 32 32 17 14 21 23 25 21 19 11 14 8 9 13 6 7 23 28 31 30 24 32 31 27 27 15 9 5 6 15 27 29 20 17 11 20 6 25 9 6 3 21 28 11 16 6 9 12 20 10 8 22 6 7 26 6 3 9 19 10 4 6 27 11 18 9 12 21 7 25 13 34 19 13 12 5 18 19 23 18 8 28 15 11 19 16 9 5 7 2 3 21 6 9 4 10 7 7 2 2 5 2 1 3 1 1 4 6 11 16 18 13 7 4 4 17 7 14 6 12 5 10 10 6 6 8 23 22 6 18 10 8 12 4 8 7 4 14 16 7 4 3 5 1 3 9 9 7 4 10 5 9 4 7 5 11 13 6 15 5 9 9 18 8 5 7 4 7 2 1 2 5 3	Open. Hide. 62 47 32 44 62 62 62 62 62 62 62 62 59 49 59 46 38 38 48 51 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 49 49 49 62 62 62 59 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 59 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 59 48 34 56 36 46 49 35 59 59 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 59 59 62 62 59 62 62 62 62 54 54 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 56 59 59 50 48 59 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 51 62 46 56 62 59 59 62 62 59 62 62 59 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 51 59 44 59 59 51 44 56 38 49 43 56 56 56 62 54 54 62 62 62 62 62 62 56 62 62 62 62 62 56 62 62 62 62 62 56 62 56 56 56 56 62 62 62 51 43 62 62 62 54 51 62 62 56 62 56 47 47 42 56 51 33 38 56 62 54 62 62 62 62 62 62 56 62 56 38 29 62 47 47 62 56 47 54 62 38 62 56 39 47 62 62 47 38 62 46 62 52 62 62 62 50 62 54 43 52 62 54 54 62 42 47 62 54 39 47 41 62 43 40 62 62 58 50 58 54 47 52 52 52 42 52 54 54 54 54 58 49 35 54 52 42 54 24 58 52 54 41 54 52 52 52 54 54 54 54 50 42 41 52 54 54 38 36 52 33 52 29 52 40 30 52 39 43 40 26 54 54 52 52 52 54 58 45 54 49 54 51 29 48 49 37 50 49 42 50 45 29 36 53 51 50 49 58 50 50 51 41 50 52 50 58 46 42 41 37 51 42 41 51 40 50 42 26 50 41 50 40 42 50 46 54 50 50 43 48 35 49 15 7 41 21 16 39 42 53 46 28 37 53 50 42 50 52 40 53 50 23 50 29 18 42 38 32 39 39 39 35 40 39 50 49 40 47 52 53 54 42 29 33 54 50 39 53 50 33 47 13 50 50 23 28 26 39 33 39 39 28 17 36 32 35 26 27 24 6 15 32 31 36 35 53 39 54 49 26 52 34 53 32 25 39 34 34 29 54 54 42 35 54 52 33 16 22 28 19 52 52 40 37 45 24 31 17 19 34 36 29 33 29 23 16 30 42 40 45 9 45 39 53 37 42 27 47 26 40 53 52 52 31 54 30 42 32 32 32 32 42 26 29 29 33 26 25 19 15 15 29 21 39 24 37 53 53 37 14 9 11 14 22 18 28 32 30 14 22 35 25 45 42 28 30 30 40 18 20 10 40 10 11 31 6 12 18 37 31 31 24 22 12 17 14 9 31 21 31 9 7 16 19 18 9 6 11 22 29 30 27 21 21 18 36 38 34 32 29 13 36 27 42 11 25 31 18 25 31 38 32 36 26 15 20 40 25 28 8 31 31 32 30 6 7 29 24 31 22 31 13 7 31 18 19 32 37 39 31 29 11 9 26 35 33 42 7 5 23 6 31 13 9 32 23 10 29 26 23 44 21 5 5 13 21 8 9 8 5 9 27 15 9 11 21 15 30 16 9 16 38 44 35 30 38 31 24 9 9 6 24 8 9 27 25 16 16 20 23 13 11 12 10 11 9 22 23 27 19 31 32 30 20 19 15 20 14 11 9 6 12 17 30 17 9 12 5 9 4 5 8 30 12 24 14 9 19 19 12 15 9 10 17 32 12 6 6 7 22 16 21 5 19 20 20 5 3 3 8 4 5 10 6 8 5 8 18 12 13 6 5 15 32 20 20 28 7 28 18 6 5 28 17 27 6 6 6 6 6 20 5 10 19 18 31 22 8 5 6 3 3 3 5 13 9 4 11 4 8 8 5 6 22 25 7 16 16 6 21 25 27 18 10 16 16 8 21 12 15 6 6 20 9 12 7 4 8 8 18 14 4 9 12 6 9 7 8 10 28 26 24 8 13 6 6 4 18 23 30 30 21 16 5 6 5 14 14 7 24 16 5 8 13 8 18

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_130307577_130308748
seq2: B6Ng01-281H08.b_39_1212 (reverse)

seq1  AGGACCAG-TAAGCTTTGCTATTGTTGTTTTAAATGTTGAG---ACAGGG  46
      |||||||| |||||||  |||||||||  || |||||||||   ||||| 
seq2  AGGACCAGTTAAGCTTGCCTATTGTTG--TTCAATGTTGAGAGAACAGGT  48

seq1  TCTC-TAGCCCAGGCCTGCCTTAACTCCCTGTGAGGCCAAGGATGA-CCA  94
      |||| ||||||| | ||||| | ||| | ||||| ||| || |||| |||
seq2  TCTCTTAGCCCAAG-CTGCCAT-ACT-CATGTGA-GCCCAGAATGACCCA  94

seq1  TCAACCTTTGATCATCTTGCCTCTA-TCTCCCAAGTCTTAGGACTA-TCG  142
      |||||||||||||||| || ||||| |||||||||||||| ||||| |||
seq2  TCAACCTTTGATCATC-TGGCTCTATTCTCCCAAGTCTTA-GACTATTCG  142

seq1  GTG-TGAGTCACCACACTG-TGAGATACTTGAGCCTCGTGATGAACCAAA  190
      ||| ||||||||||||||| ||||||||||||||||||||||||||||||
seq2  GTGTTGAGTCACCACACTGTTGAGATACTTGAGCCTCGTGATGAACCAAA  192

seq1  TTATATCCCCAGCCCCCTTCAGCAGCCTTGGGCCACTGGTCCCATATGGT  240
      |  | |||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTCCCCAGCCCCCTTCAGCAGCCTTGGGCCACTGGTCCCATATGGT  242

seq1  GTTTAGTAGTTTGTAAATTGAATGAATATTCAGTTCTCCGTCCGAAGGGG  290
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTAGTAGTTTGTAAATTGAATGAATATTCAGTTCTCCGTCCGAAGGGG  292

seq1  CAGGGGAAGGTGATGGTAAAATGAAGGCTTCAGACTCGGACTCAGCACAT  340
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGGAAGGTGATGGTAAAATGAAGGCTTCAGACTCGGACTCAGCACAT  342

seq1  TCAGACTTTTGTCTTTGTAGTTACTTATTTGTGACTGTGGGCAAGTGTCT  390
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGACTTTTGTCTTTGTAGTTACTTATTTGTGACTGTGGGCAAGTGTCT  392

seq1  GGTTATGAGCTATTTCCCTAAATAGTGGGAGGAATAGTTTCCCTCTTATA  440
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTATGAGCTATTTCCCTAAATAGTGGGAGGAATAGTTTCCCTCTTATA  442

seq1  GTGAGGACTGTTGGAAGTCAAATAAGGTAGAGCATATAAGAGCACTTATA  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGGACTGTTGGAAGTCAAATAAGGTAGAGCATATAAGAGCACTTATA  492

seq1  TAGAGTTGTATTTCGTTGAGAGTTCTTAAGTGAAGGAGGTTGTTATCTTT  540
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAGTTGTATTTCGTTGAGAGTTCTTAAGTGAAGGAGGTTGTTATCTTT  542

seq1  GGGGTTCTTTTTGTTTGTCTTTTCATCTGACACAAGATGTAGGTATGCCA  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGTTCTTTTTGTTTGTCTTTTCATCTGACACAAGATGTAGGTATGCCA  592

seq1  GGCTGACCGCAGACTTGTGATCCCCTGCCTCAAGCCTTCCAAGTGCTGGC  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGACCGCAGACTTGTGATCCCCTGCCTCAAGCCTTCCAAGTGCTGGC  642

seq1  GTTACAGGTGTGCACTACCACACCTGACTAGCTATTTTATTAGATATTTA  690
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTACAGGTGTGCACTACCACACCTGACTAGCTATTTTATTAGATATTTA  692

seq1  TTCGGTTATTTTAGTTGCCCATGAGTTGAGAGAACATTTTTATCATTCAT  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCGGTTATTTTAGTTGCCCATGAGTTGAGAGAACATTTTTATCATTCAT  742

seq1  GTATGTATGTATGTATATATGTATTTTACATCCTGACTGCAATTTCCTCT  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGTATGTATGTATATATGTATTTTACATCCTGACTGCAATTTCCTCT  792

seq1  CCTTCCAGTCCCTCCCATTAGTACAAGCTTTCTAAGAGAGAGAGAGAGAA  840
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCCAGTCCCTCCCATTAGTACAAGCTTTCTAAGAGAGAGAGAGAGAA  842

seq1  AAAAAAAAGCCCGAAAATAAGATTTCCCCATAGTGCATGGCTGAAAAGCC  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAGCCCGAAAATAAGATTTCCCCATAGTGCATGGCTGAAAAGCC  892

seq1  TTGACATCATAGACATTTCCAGGCTGGAGAAGTCTTTGTTCTAGGAGCCT  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGACATCATAGACATTTCCAGGCTGGAGAAGTCTTTGTTCTAGGAGCCT  942

seq1  GCCTTGATTTATAAGATGTTTAGCAGCATCCCAGGCCTTGACCCTTATAT  990
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTGATTTATAAGATGTTTAGCAGCATCCCAGGCCTTGACCCTTATAT  992

seq1  GTCCATGACACAGTCCTCATGCCTTCATTTATGGTGATCAAAACCAGCTT  1040
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCATGACACAGTCCTCATGCCTTCATTTATGGTGATCAAAACCAGCTT  1042

seq1  TACACATTGCCCAGTGTCACTGGGAGACTGTGCAATGGTATGCGAACAGC  1090
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACATTGCCCAGTGTCACTGGGAGACTGTGCAATGGTATGCGAACAGC  1092

seq1  TTTGCAGCCACACAGTTCAAGCTTTTGTACAAGCAAGCCGTGCCAACGGC  1140
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCAGCCACACAGTTCAAGCTTTTGTACAAGCAAGCCGTGCCAACGGC  1142

seq1  CTACTTGGAAAAGCCTAATGTCTTGTGAATTC  1172
      ||||||||||||||||||||||||||||||||
seq2  CTACTTGGAAAAGCCTAATGTCTTGTGAATTC  1174

seq1: chr2_130104275_130105402
seq2: B6Ng01-281H08.g_66_1215

seq1  GAATTCCTGCTCTCCCTGTTCTGTGTCTGGAGGTGATAGTGTCTCATGAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTGCTCTCCCTGTTCTGTGTCTGGAGGTGATAGTGTCTCATGAT  50

seq1  GGGGGGTGGGGGCAGGGAGGTCACCAATGTGACAGTTTAGAATTGTCCCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGGTGGGGGCAGGGAGGTCACCAATGTGACAGTTTAGAATTGTCCCT  100

seq1  TAGGCTTTTTTTTAAAATCTTGAGCTATTAGTGATTTTCATTTCAGTGTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGCTTTTTTTTAAAATCTTGAGCTATTAGTGATTTTCATTTCAGTGTT  150

seq1  CCCTGGGAGCTCTGCATGATATCCATCGTGAGCAGCATACAGGGGGTTTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGGGAGCTCTGCATGATATCCATCGTGAGCAGCATACAGGGGGTTTT  200

seq1  CTCTAGGGTTTAAGAGGGCCAGGGAAATTATAAAATGTGAGAGTAGGTAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTAGGGTTTAAGAGGGCCAGGGAAATTATAAAATGTGAGAGTAGGTAG  250

seq1  ATCATTAAGTCACCAGAAGTACTAGGTTTGCTCTTCTGCCTGGATTCTAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATTAAGTCACCAGAAGTACTAGGTTTGCTCTTCTGCCTGGATTCTAA  300

seq1  TGGGAGCTGTGGCTGCTAACAATTGTAAGCAATGTCCCGTGTCTGATTCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGAGCTGTGGCTGCTAACAATTGTAAGCAATGTCCCGTGTCTGATTCC  350

seq1  CCCTTCAGGAGGTAAATGAAAAATCTAAGAAGAAAAAGAAGTTAAAACCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTCAGGAGGTAAATGAAAAATCTAAGAAGAAAAAGAAGTTAAAACCC  400

seq1  CAGGAAAATGGAATGGAAGACCCACCTGTCTCTCTACCTAAATCCAAGAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAAAATGGAATGGAAGACCCACCTGTCTCTCTACCTAAATCCAAGAA  450

seq1  AAAGAAAGCTCCCAAGGAGGAGTTGGCCAGTGACCTTGAAGAGATGGCCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAAAGCTCCCAAGGAGGAGTTGGCCAGTGACCTTGAAGAGATGGCCA  500

seq1  CTAGCAGTGCTAAGAGAAAGAAGTCCTCACCTAAGGAGGAAGTGGCCAGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGCAGTGCTAAGAGAAAGAAGTCCTCACCTAAGGAGGAAGTGGCCAGT  550

seq1  GAACCAGAAGAGGCAGCAAGCCCCACCACCCCTAAGAAGAAAAGGAAATT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCAGAAGAGGCAGCAAGCCCCACCACCCCTAAGAAGAAAAGGAAATT  600

seq1  TTCTGAGGAGCCTGAAGTTGCTGCTAACTTCACAAAGAGCAGCACAAAGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGAGGAGCCTGAAGTTGCTGCTAACTTCACAAAGAGCAGCACAAAGA  650

seq1  AAAAGAAAAAGTCCCAGAAAGCACAGGAGGATTAGAACGGACCTGCTTGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGAAAAAGTCCCAGAAAGCACAGGAGGATTAGAACGGACCTGCTTGG  700

seq1  TGGGAGGGGCATACCTTGTGGCAGCTCCTGCCCATGAATGATAAAACCCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGAGGGGCATACCTTGTGGCAGCTCCTGCCCATGAATGATAAAACCCC  750

seq1  AATAAAAACAC-AAAACCAGATAGTATGTGTGTATTTTGTTTATTGACTA  799
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  AATAAAAACACAAAAACCAGATAGTATGTGTGTATTTTGTTTATTGACTA  800

seq1  TTTTTTTCATGGG-CATGTATAGGATTTATGACAGGGCAGTAATGACAG-  847
      ||||||||||||| ||||||||||||||||||||||||||||||||||| 
seq2  TTTTTTTCATGGGCCATGTATAGGATTTATGACAGGGCAGTAATGACAGC  850

seq1  CTTCAGTGAAGTCATGACATGTGGCATAACCACCCATATCTGAGGTTCGA  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCAGTGAAGTCATGACATGTGGCATAACCACCCATATCTGAGGTTCGA  900

seq1  ACCTGT-GGGAAAAAGTTATCATCTTAGGGTCTGGGCCTT-GTCGCAACA  945
      |||||| ||||||||||||||||||||||||||||||||| |||||||||
seq2  ACCTGTGGGGAAAAAGTTATCATCTTAGGGTCTGGGCCTTGGTCGCAACA  950

seq1  ACCCACCCTTTG-AGA-TACCCTTAACACCAGCCCCCAGG-ACAG--CCT  990
      ||| |||||||| ||| ||||||| || |||||||||||| ||||  | |
seq2  ACCAACCCTTTGTAGATTACCCTTTACCCCAGCCCCCAGGAACAGGCCTT  1000

seq1  AGCCTCAGAAAAG-CTATT-ATAGTCTACTGTCTAGATG--TTCTC-TTC  1035
      ||| ||||||||| ||||| |||||||||||||  ||||  | ||| |||
seq2  AGCTTCAGAAAAGCCTATTAATAGTCTACTGTCAGGATGATTCCTCTTTC  1050

seq1  T-GGTCCATTGTAC-TGAAGGGATGTATA-CGAAGCATGGTCCTTTTGAA  1082
      | |||||| ||||| |||||||||||||| |||  ||||||||||||  |
seq2  TGGGTCCA-TGTACTTGAAGGGATGTATACCGAGCCATGGTCCTTTTTGA  1099

seq1  ATTGGAGGGAGTAAGGGCTCTAGCCCCCAT----GGGGGT--GCAGGTGG  1126
      ||| |||||||||| ||||||| |||||||    ||||||   |||||||
seq2  ATTTGAGGGAGTAA-GGCTCTAACCCCCATTGTGGGGGGTTGCCAGGTGG  1148

seq1  CC  1128
      ||
seq2  CC  1150

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information