MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-286H18
Chromosome	2 (Build37)
Map Location	37,998,454 - 38,135,281
singlet/doublet	doublet
Overlap gene	Dennd1a
Upstream gene	Olfr364-ps1, Olfr365, Olfr366, Olfr367, Olfr368, Pdcl, Rc3h2, Zbtb6, Zbtb26, Rabgap1, Gpr21, 6430510M02Rik, Strbp, LOC639491
Downstream gene	LOC100040947, Lhx2, Nek6, Psmb7, LOC674251, Nr5a1, Nr6a1, Olfml2a, LOC624652, LOC100041071, 1700123D08Rik, Rpl35, Arpc5l, Golga1, A930041I02Rik, LOC100042584, Ppp6c, Vmn2r-ps2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr364-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227794 MGI:3030198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2100 Proteins pseudo : _no_value

name	Olfr365 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258656 MGI:3030199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr366 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236509 MGI:3030200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr367 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545417 MGI:3030201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr368 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258371 MGI:3030202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdcl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67466 MGI:1914716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rc3h2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319817 MGI:2442789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 133 ESTs, 7 Proteins

name	Zbtb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241322 MGI:2442998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320633 MGI:2444402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabgap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227800 MGI:2385139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gpr21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338346 MGI:2441890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430510M02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319517 MGI:2442183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Strbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20744 MGI:104626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC639491 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:639491
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Dennd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227801 MGI:2442794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Lhx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16870 MGI:96785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59126 MGI:1891638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19177 MGI:107637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC674251 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Nr5a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26423 MGI:1346833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr6a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14536 MGI:1352459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfml2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241327 MGI:2444741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100041071 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	1700123D08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76646 MGI:1923896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66489 MGI:1913739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arpc5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74192 MGI:1921442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Golga1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76899 MGI:1924149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930041I02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320271 MGI:2443716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042584 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042584
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ppp6c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67857 MGI:1915107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vmn2r-ps2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Olfr365 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239285 GeneID:258656 MGI:3030199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 365 transcript_id : NM_146662.1

name	Olfr366 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53933205 GeneID:236509 MGI:3030200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 366 transcript_id : NM_001005569.1

name	Olfr367 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486589 GeneID:545417 MGI:3030201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 367 transcript_id : NM_001081010.1

name	Olfr368 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129556 GeneID:258371 MGI:3030202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 368 transcript_id : NM_146374.1

name	Pdcl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475676 GeneID:67466 MGI:1914716
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosducin-like transcript_id : NM_026176.2

name	Rc3h2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249302 GeneID:319817 MGI:2442789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 132 ESTs, 7 Proteins product : ring finger and CCCH-type zinc finger domains 2, transcript variant 1 transcript_id : XM_130233.8

name	Zbtb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375919 GeneID:241322 MGI:2442998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 6 transcript_id : NM_146253.4

name	Zbtb26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037368 GeneID:320633 MGI:2444402
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 26 transcript_id : NM_199025.2

name	Rabgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76880488 GeneID:227800 MGI:2385139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB GTPase activating protein 1 transcript_id : NM_146121.2

name	Rabgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76880497 GeneID:227800 MGI:2385139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB GTPase activating protein 1 transcript_id : NM_001033960.1

name	Gpr21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387873 GeneID:338346 MGI:2441890
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 21 transcript_id : NM_177383.3

name	6430510M02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342413 GeneID:319517 MGI:2442183
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430510M02 gene transcript_id : NM_176932.2

name	Strbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842376 GeneID:20744 MGI:104626
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatid perinuclear RNA binding protein transcript_id : NM_009261.2

name	Dennd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542026 GeneID:227801 MGI:2442794
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DENN/MADD domain containing 1A transcript_id : NM_146122.2

name	LOC100040947 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249259 GeneID:100040947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040947 transcript_id : XM_001475545.1

name	Lhx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382898 GeneID:16870 MGI:96785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 2 transcript_id : NM_010710.3

name	Nek6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543319 GeneID:59126 MGI:1891638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 6 transcript_id : NM_021606.2

name	Psmb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755205 GeneID:19177 MGI:107637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 7 transcript_id : NM_011187.1

name	Nr5a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922643 GeneID:26423 MGI:1346833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 5, group A, member 1 transcript_id : NM_139051.3

name	Nr6a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380165 GeneID:14536 MGI:1352459
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 6, group A, member 1 transcript_id : NM_010264.3

name	Olfml2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378168 GeneID:241327 MGI:2444741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin-like 2A transcript_id : NM_172854.2

name	LOC624652 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249263 GeneID:624652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to golgi autoantigen, golgin subfamily a transcript_id : XM_889201.2

name	LOC100041071 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249265 GeneID:100041071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041071 transcript_id : XM_001475741.1

name	1700123D08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371002 GeneID:76646 MGI:1923896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700123D08 gene transcript_id : NM_029687.2

name	Rpl35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372816 GeneID:66489 MGI:1913739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L35 transcript_id : NM_025592.3

name	Arpc5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312653 GeneID:74192 MGI:1921442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin related protein 2/3 complex, subunit 5-like transcript_id : NM_028809.1

name	Golga1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794191 GeneID:76899 MGI:1924149
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi autoantigen, golgin subfamily a, 1 transcript_id : NM_029793.1

name	A930041I02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198338 GeneID:320271 MGI:2443716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930041I02 gene transcript_id : NM_178778.3

name	Ppp6c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359530 GeneID:67857 MGI:1915107
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 6, catalytic subunit transcript_id : NM_024209.2

name	Olfr365 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239286 CCDS:CCDS15995.1 GeneID:258656 MGI:3030199
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33885305-33886243; olfactory receptor MOR138-1 product : olfactory receptor 365 protein_id : NP_666873.1

name	Olfr366 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53933206 CCDS:CCDS15996.1 GeneID:236509 MGI:3030200
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33902472-33903401; olfactory receptor MOR138-5P product : olfactory receptor 366 protein_id : NP_001005569.1

name	Olfr367 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486590 GeneID:545417 MGI:3030201
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004984 - olfactory receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33954853-33955794; olfactory receptor MOR128-1 product : olfactory receptor 367 protein_id : NP_001074479.1

name	Olfr368 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129557 CCDS:CCDS15997.1 GeneID:258371 MGI:3030202
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-34015743-34016726; olfactory receptor MOR178-1 product : olfactory receptor 368 protein_id : NP_666486.1

name	Pdcl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18079230 CCDS:CCDS15998.1 GeneID:67466 MGI:1914716
definition	GO_process : GO:0050896 - response to stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosducin-like protein_id : NP_080452.1

name	Rc3h2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249303 GeneID:319817 MGI:2442789
definition	codon_start : 1 product : membrane-associated nucleic acid binding protein isoform 1 protein_id : XP_130233.7

name	Zbtb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122841 CCDS:CCDS16000.1 GeneID:241322 MGI:2442998
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 482 protein_id : NP_666365.1

name	Zbtb26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037369 CCDS:CCDS16001.1 GeneID:320633 MGI:2444402
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 483 protein_id : NP_950190.2

name	Rabgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76880489 CCDS:CCDS16002.1 GeneID:227800 MGI:2385139
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1; rab6 GTPase activating protein (GAP and centrosome-associated) product : RAB GTPase activating protein 1 isoform a protein_id : NP_666233.2

name	Rabgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76880498 CCDS:CCDS16003.1 GeneID:227800 MGI:2385139
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2; rab6 GTPase activating protein (GAP and centrosome-associated) product : RAB GTPase activating protein 1 isoform b protein_id : NP_001029132.1

name	Gpr21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893547 CCDS:CCDS16004.1 GeneID:338346 MGI:2441890
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor GPR21 product : G protein-coupled receptor 21 protein_id : NP_796357.1

name	6430510M02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892735 GeneID:319517 MGI:2442183
definition	codon_start : 1 product : hypothetical protein LOC319517 protein_id : NP_795906.1

name	Strbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842377 GeneID:20744 MGI:104626
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003725 - double-stranded RNA binding [Evidence IDA]; GO:0003727 - single-stranded RNA binding [Evidence IDA] GO_process : GO:0006928 - cell motility [Evidence IMP]; GO:0007638 - mechanosensory behavior [Evidence IMP]; GO:0007286 - spermatid development [Evidence IMP] codon_start : 1 product : spermatid perinuclear RNA-binding protein protein_id : NP_033287.2

name	Dennd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542027 CCDS:CCDS16007.1 GeneID:227801 MGI:2442794
definition	codon_start : 1 exception : mismatches in translation product : DENN/MADD domain containing 1A protein_id : NP_666234.2

name	LOC100040947 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249260 GeneID:100040947
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475595.1

name	Lhx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754538 CCDS:CCDS16008.1 GeneID:16870 MGI:96785
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0007498 - mesoderm development [Evidence IMP]; GO:0007399 - nervous system development [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : LIM homeo box protein 2 product : LIM homeobox protein 2 protein_id : NP_034840.1

name	Nek6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11037794 CCDS:CCDS16009.1 GeneID:59126 MGI:1891638
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007059 - chromosome segregation [Evidence ISS] [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0030071 - regulation of mitotic metaphase/anaphase transition [Evidence ISS] codon_start : 1 note : NIMA-related expressed kinase 6 product : NIMA (never in mitosis gene a)-related expressed kinase 6 protein_id : NP_067619.1

name	Psmb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755206 CCDS:CCDS16010.1 GeneID:19177 MGI:107637
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : proteasome (prosome, macropain) subunit, beta type 7 protein_id : NP_035317.1

name	Nr5a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20522231 CCDS:CCDS16011.1 GeneID:26423 MGI:1346833
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030325 - adrenal gland development [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IGI]; GO:0001553 - luteinization [Evidence IMP]; GO:0008584 - male gonad development [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0009888 - tissue development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : steroidogenic factor 1; adrenal 4-binding protein; fushi tarazu 1 factor homolog product : nuclear receptor subfamily 5, group A, member 1 protein_id : NP_620639.1

name	Nr6a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753956 CCDS:CCDS16012.1 GeneID:14536 MGI:1352459
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IMP] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : germ cell nuclear factor product : nuclear receptor subfamily 6, group A, member 1 protein_id : NP_034394.1

name	Olfml2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370292 CCDS:CCDS16013.1 GeneID:241327 MGI:2444741
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA] codon_start : 1 note : photomedin-1 product : olfactomedin-like 2A protein_id : NP_766442.1

name	LOC624652 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249264 GeneID:624652
definition	codon_start : 1 product : similar to golgi autoantigen, golgin subfamily a protein_id : XP_894294.2

name	LOC100041071 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249266 GeneID:100041071
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475791.1

name	1700123D08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037455 GeneID:76646 MGI:1923896
definition	codon_start : 1 note : novel WD domain, G-beta repeat domain containing protein (1700123D08Rik) product : hypothetical protein LOC76646 protein_id : NP_083963.1

name	Rpl35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385044 CCDS:CCDS16015.1 GeneID:66489 MGI:1913739
definition	codon_start : 1 product : ribosomal protein L35 protein_id : NP_079868.1

name	Arpc5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312654 GeneID:74192 MGI:1921442
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030833 - regulation of actin filament polymerization [Evidence IEA] codon_start : 1 product : actin related protein 2/3 complex, subunit 5-like protein_id : NP_083085.1

name	Golga1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794192 CCDS:CCDS16016.1 GeneID:76899 MGI:1924149
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA] codon_start : 1 product : golgi autoantigen, golgin subfamily a, 1 protein_id : NP_084069.1

name	A930041I02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198339 GeneID:320271 MGI:2443716
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320271 protein_id : NP_848893.2

name	Ppp6c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312758 CCDS:CCDS16017.1 GeneID:67857 MGI:1915107
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA] codon_start : 1 product : protein phosphatase 6, catalytic subunit protein_id : NP_077171.1

name	Olfr364-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:227794
definition	number : 2 pseudo : _no_value

name	Olfr364-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:227794
definition	number : 3 pseudo : _no_value

name	LOC639491 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639491
definition	number : 1 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 1 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 2 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 3 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 4 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 5 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 6 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 7 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 8 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 9 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 10 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 11 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 12 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 13 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 14 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 15 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 16 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 17 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 18 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 19 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 20 pseudo : _no_value

name	LOC674251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674251
definition	number : 21 pseudo : _no_value

name	LOC100042584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042584
definition	number : 2 pseudo : _no_value

name	LOC100042584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042584
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps2 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041126
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps2 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041126
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps2 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041126
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps2 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041126
definition	number : 4 pseudo : _no_value

clone name	MSMg01-473H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-074C13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-404F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120C08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-383D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123L10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-302C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141A04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-286H18.b	B6Ng01-286H18.g
ACC	GA084669	GA084670
length	1,193	1,057
definition	B6Ng01-286H18.b	B6Ng01-286H18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(37,998,454 - 37,999,653)	(38,134,222 - 38,135,281)
sequence	gaattcacaccccaaggccaaagctttcctgccaccagtccttcaaatct gacttggacattacacgggaggaggctccaagcctccctgaggtctcact ccttttacaacacacgaaaaagcagtcgataatgggcccatgctgaattc actgctccccacgtctcctcttgggacacaagcctagcagatgtgataaa aactgtgtcagagaagtggctctagtttgtgccttaatgacaacttaaac ctctacaccaatacaaccaagagatgaacagagctgcctgttacctctct ctgctgccaatcttccaataccttggaactaaattagcgcctctccccac aacttcccctgccacccctcaaaacctattctaattttaaaagataaatg agttcagaaaacacactggtggcacaagtgtctgggtgctgtgtgtgtgg atgtcctataattaaacgctgacacatatttcatagagtttgtattttct caaggtatgattgaacattcagatgtcataaaagactgcctactaaactc cctctgatcaccaccccagtacccatattcacatataccgctgggagatt tacagcctccaaaaaaaaaaatgcttcaaggtctaaagattatttttaaa catgttcaaacataagagaggtgatattccaagttaatgaaacattctaa ttattaaaatttatacaggacaatttcttaaaccataggcggttatactt ttcttttaactcataagaactctttgtcttatctaatgatatggtaccat aaaaatctatttaaatgtgtacctctgataacattttctaaattctataa ttcagccttcagatgatgggtcttttaacccagtatcttgaaagcctatt cagccacaattgcatacccacttaatcagcaatcattgttctgggatgtg ggactttgttgtcagacaagcaacaaaaccctttaaaaaaaaaatttttt tttttttcagaactgcatagaaaaaagtgattcttttgtcagacagaaca atttatgcaaatcttttataaacattcacaaaacatttatttaagccttt tgaatgttgctcaattgagagccatggaaatgaggggtagtgaaaacgca agacgctagagctggcagcctcattaaatattcggaaaggaag	gaattcagtgagcactgcaatgggatcttgctggggcttttaagtagact actagcagcagcagactagagtgcagtggccaaacagtggcatccctggg ttgtgcaaggtgatccattggaacatggggaaaagacttagtttaatgat aactttaaggacttctgtactttctaatttattgatgtaactataaacca ttagagtatatatggatatgtgtaaagtgtgttgcttagtttttactgac aggaatgtgtgtgggaaaaggaatgctgaaggattgtggaaggaactatg caatagtttatgttgcaggagatgaaggcctgatctgaggttttggtatt gaaaagaaaagaatgggtttcagagaaattttaggtagatgtgacaggag gttgtagactctagaaatgagtgaagatgatctagtaaacttagctaagt tatattttaaataagatgttcataaggtgaggatccgtgtacgatgtatt tacatttgggagaaggtgttttggtctgcagtgaggatttttgtttgttt gttttgttttgtttatgtgtaaccctggctgtactggagctcattctgca aatcaggttggccttgaacagagattcatctgcctctgtctccctggtgc tggggttaaaggtgctcaccactaccatctggggaaagggaaagaacttt taagagccccatggtgaaggcatgagctctgctagacaagtaagacttaa agtgggcaagaaaggaaatctatccctggcaattttagaaagagaaagca acagaaagaaaccgtttttgaacttgttagccttaggaaaggtttcctgg atgttgcattgatattgcttaggccttgtgaataaacagacagaagaaat tggtctagagtaagtgctgtttgagtcctagctgagtttgtactccaggg tgtgagtgaggctggaataagggtataatgctgagcagcaacccctttcc caaatgtgttatgacatagcagctttgtatactgtctccaaattctggag tctctct
quality values	Open. Hide. 58 38 33 39 58 41 25 42 35 58 62 62 33 27 62 62 62 62 41 25 62 62 46 62 62 62 62 62 62 62 62 62 47 30 56 47 36 28 29 38 56 56 62 59 51 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 59 59 62 59 59 59 62 62 62 62 59 49 54 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 42 54 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 58 58 54 58 58 58 41 58 58 58 54 58 58 58 58 58 54 54 58 54 58 58 58 54 58 54 58 58 58 52 58 54 58 58 58 58 58 58 54 54 52 58 54 58 58 58 58 58 58 58 58 58 58 54 58 52 58 54 47 58 58 58 58 52 54 46 51 49 58 49 49 58 58 58 58 54 50 58 50 58 53 58 51 58 58 58 54 58 58 58 58 46 41 42 29 58 51 50 51 52 51 58 58 53 53 39 46 58 58 58 58 58 58 58 58 58 50 40 58 48 58 51 42 52 52 51 58 46 58 52 58 58 53 53 39 24 49 51 41 58 58 58 41 52 49 49 51 32 58 58 51 53 42 42 58 58 51 42 53 41 49 50 58 31 53 41 51 39 53 53 32 33 39 51 50 50 27 58 52 53 35 38 54 50 54 53 54 54 52 39 53 52 44 41 51 52 40 39 42 40 51 39 54 54 50 46 54 44 42 42 42 52 35 49 51 53 34 37 41 53 54 52 52 42 42 35 54 44 47 45 40 42 31 13 51 33 24 25 7 51 41 42 32 52 29 54 54 41 53 52 54 54 29 26 33 34 45 39 34 40 40 49 35 53 23 29 40 52 52 52 51 40 32 41 32 45 39 31 41 33 36 38 37 53 40 40 31 40 39 51 31 31 28 31 13 28 24 51 51 51 32 31 36 36 45 36 51 45 29 51 42 31 45 38 51 29 28 32 33 38 43 31 31 42 19 22 30 31 31 27 48 48 31 43 22 31 48 43 31 36 32 33 31 31 37 33 31 35 33 34 25 31 42 25 23 32 32 24 42 27 32 42 25 41 47 37 35 29 21 48 48 18 17 27 41 48 39 30 28 14 31 26 27 33 23 26 28 48 31 25 32 27 32 30 21 31 19 16 27 38 28 13 31 14 17 31 29 38 32 17 14 13 37 44 31 18 38 24 33 22 17 29 34 27 24 42 25 26 34 36 33 25 14 36 27 17 26 31 31 44 21 17 15 32 24 31 39 28 18 18 24 48 32 32 17 14 31 16 12 24 8 32 16 8 33 26 7 5 5 31 10 40 43 31 11 31 7 34 36 31 19 43 37 39 39 34 37 37 11 24 22 47 47 47 40 47 40 40 40 40 40 38 19 19 6 6 28 16 14 17 15 3 9 14 20 8 27 40 34 34 40 24 14 16 23 11 11 6 6 6 34 8 11 8 6 20 9 9 27 8 9 3 3 7 7 11 21 21 38 13 7 7 18 15 9 30 20 14 8 6 16 28 12 11 9 6 25 12 13 5 11 12 17 5 7 9 28 13 9 20 6 17 27 13 19 16 30 25 5 12 9 10 5 20 30 14 11 6 15 14 3 5 3 5 3 9 3 9 6 5 27 8 3 5 4 8 5 6 14 4 6 8 6 10 3 3 1 2 5 2 25 17 5 1 3 5 8 3 21 26 30 4 2 3 2 3 2 4 3 4 4 7 23 3 1 2 4 5 6 8 6 2 3 5 7 5 11 8 4 4 4 23 26 5 12 5 16 22 12 4 4 17 17 7 9 1 6 10 3	Open. Hide. 62 47 35 47 62 47 37 56 62 62 49 62 51 32 44 36 43 22 21 21 51 62 62 62 43 59 62 62 62 62 62 62 62 62 62 62 62 62 49 49 59 62 62 62 59 59 62 59 59 59 62 62 59 59 62 59 62 51 59 51 45 54 48 40 59 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 59 59 62 62 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 49 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 56 47 41 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 54 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 52 62 62 62 58 58 45 54 54 58 58 58 58 58 54 54 58 54 54 54 52 58 58 54 58 58 58 58 41 58 52 54 58 54 58 58 58 58 54 58 58 54 58 58 58 48 52 54 54 58 58 58 58 42 35 58 58 58 58 58 42 58 58 58 58 58 58 54 49 58 58 58 49 42 58 58 58 58 40 58 37 58 51 58 53 58 49 48 58 41 58 58 58 58 58 50 51 58 51 50 51 51 58 48 58 52 58 58 50 50 58 49 53 54 58 51 54 43 42 51 53 50 19 39 48 51 51 49 34 58 58 51 53 58 58 50 50 46 58 26 36 29 51 53 28 41 58 47 54 52 58 53 49 49 54 46 51 49 41 58 58 51 41 58 39 58 39 53 58 58 58 51 31 51 47 54 58 50 58 23 58 50 52 50 52 50 42 40 28 46 42 53 37 33 54 53 37 54 54 54 51 47 54 39 35 54 54 41 54 54 40 54 24 31 42 54 54 39 39 53 35 54 18 38 51 51 45 29 18 41 54 39 41 53 30 8 51 25 28 34 39 47 19 42 53 42 32 43 39 53 42 32 34 32 31 51 33 23 32 51 35 42 27 53 37 29 54 35 37 32 53 49 30 29 37 41 22 25 51 13 33 27 32 53 41 32 34 40 35 52 29 36 31 34 32 47 32 31 21 46 52 53 25 25 31 53 53 33 33 41 19 40 51 38 23 31 21 32 30 21 16 25 46 32 31 42 51 19 12 51 34 32 51 51 51 46 23 31 22 31 43 37 51 35 28 31 31 33 27 18 22 20 18 12 31 48 35 22 42 12 46 28 37 31 31 28 6 27 24 31 14 28 25 31 22 12 41 31 30 33 31 24 28 33 25 19 13 19 25 18 21 31 15 9 14 23 25 30 37 26 27 39 22 37 24 18 31 25 27 13 27 20 9 15 39 31 19 34 12 25 14 31 16 9 14 26 8 14 11 34 32 31 32 31 31 21 33 44 16 20 31 16 32 19 14 21 38 20 20 32 21 28 9 29 48 21 37 27 10 19 32 29 25 30 24 48 14 9 11 5 13 33 21 32 32 31 10 22 16 21 28 18 23 26 11 9 23 4 29 30 7 6 4 6 33 17 33 25 21 11 43 9 29 13 5 11 7 14 26 28 25 27 7 29 10 18 28 7 3 11 14 5 12 6 6 6 5 5 6 7 13 8 12 23 19 6 8 9 18 19 24 17 5 5 5 9 22 5 23 8 4 3 5 27 20 21 8 34 13 19 15 19 7 13 8 15 12 13 11 11 8 16 9 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_37998454_37999653
seq2: B6Ng01-286H18.b_46_1238

seq1  GAATTCACACCCCAAGGCCAAAGCTTTCCTGCCACCAGTCCTTCAAATCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACACCCCAAGGCCAAAGCTTTCCTGCCACCAGTCCTTCAAATCT  50

seq1  GACTTGGACATTACACGGGAGGAGGCTCCAAGCCTCCCTGAGGTCTCACT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTTGGACATTACACGGGAGGAGGCTCCAAGCCTCCCTGAGGTCTCACT  100

seq1  CCTTTTACAACACACGAAAAAGCAGTCGATAATGGGCCCATGCTGAATTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTTACAACACACGAAAAAGCAGTCGATAATGGGCCCATGCTGAATTC  150

seq1  ACTGCTCCCCACGTCTCCTCTTGGGACACAAGCCTAGCAGATGTGATAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCTCCCCACGTCTCCTCTTGGGACACAAGCCTAGCAGATGTGATAAA  200

seq1  AACTGTGTCAGAGAAGTGGCTCTAGTTTGTGCCTTAATGACAACTTAAAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGTGTCAGAGAAGTGGCTCTAGTTTGTGCCTTAATGACAACTTAAAC  250

seq1  CTCTACACCAATACAACCAAGAGATGAACAGAGCTGCCTGTTACCTCTCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTACACCAATACAACCAAGAGATGAACAGAGCTGCCTGTTACCTCTCT  300

seq1  CTGCTGCCAATCTTCCAATACCTTGGAACTAAATTAGCGCCTCTCCCCAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTGCCAATCTTCCAATACCTTGGAACTAAATTAGCGCCTCTCCCCAC  350

seq1  AACTTCCCCTGCCACCCCTCAAAACCTATTCTAATTTTAAAAGATAAATG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTCCCCTGCCACCCCTCAAAACCTATTCTAATTTTAAAAGATAAATG  400

seq1  AGTTCAGAAAACACACTGGTGGCACAAGTGTCTGGGTGCTGTGTGTGTGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCAGAAAACACACTGGTGGCACAAGTGTCTGGGTGCTGTGTGTGTGG  450

seq1  ATGTCCTATAATTAAACGCTGACACATATTTCATAGAGTTTGTATTTTCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCCTATAATTAAACGCTGACACATATTTCATAGAGTTTGTATTTTCT  500

seq1  CAAGGTATGATTGAACATTCAGATGTCATAAAAGACTGCCTACTAAACTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGTATGATTGAACATTCAGATGTCATAAAAGACTGCCTACTAAACTC  550

seq1  CCTCTGATCACCACCCCAGTACCCATATTCACATATACCGCTGGGAGATT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGATCACCACCCCAGTACCCATATTCACATATACCGCTGGGAGATT  600

seq1  TACAGCCTCCAAAAAAAAAAATGCTTCAAGGTCTAAAGATTATTTTTAAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGCCTCCAAAAAAAAAAATGCTTCAAGGTCTAAAGATTATTTTTAAA  650

seq1  CATGTTCAAACATAAGAGAGGTGATATTCCAAGTTAATGAAACATTCTAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTTCAAACATAAGAGAGGTGATATTCCAAGTTAATGAAACATTCTAA  700

seq1  TTATTAAAATTTATACAGGACAATTTCTTAAACCATAGGCGGTTATACTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTAAAATTTATACAGGACAATTTCTTAAACCATAGGCGGTTATACTT  750

seq1  TTCTTTTAACTCATAAGAACTCTTTGTCTTATCTAATGATATGGTACCAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTTTAACTCATAAGAACTCTTTGTCTTATCTAATGATATGGTACCAT  800

seq1  AAAAATCTATTTAAATGTGTACCTCTGATAACATTTTCTAAATTCTATAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATCTATTTAAATGTGTACCTCTGATAACATTTTCTAAATTCTATAA  850

seq1  TTCAGCCTTCAGATGATGGGTCTTTTAACCCAGTATCTTGAAAGCCTATT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGCCTTCAGATGATGGGTCTTTTAACCCAGTATCTTGAAAGCCTATT  900

seq1  CAGCCACAATTGCATACCCACTTAATCAGCAATCATTGTTCTGGGATGTG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCACAATTGCATACCCACTTAATCAGCAATCATTGTTCTGGGATGTG  950

seq1  GGACTTTGTTGTCAAGACAAGCACCAAAACC--TTTAAAAAAAAATTTTT  998
      ||||||||||||| ||||||||| |||||||  || ||||||||||||||
seq2  GGACTTTGTTGTC-AGACAAGCAACAAAACCCTTTAAAAAAAAAATTTTT  999

seq1  TTTTTTTTCAGAACTGGCATAAGAAAAAAGTGAT--CTTTGTCAGACAAG  1046
      ||||||||||||||| |||| |||||||||||||   |||||||||||  
seq2  TTTTTTTTCAGAACT-GCAT-AGAAAAAAGTGATTCTTTTGTCAGACA--  1045

seq1  GACAAATTTATGCAAATCTTTTATAAACATTCAC-AAACATTTATTT-AG  1094
      ||  |||||||||||||||||||||||||||||| |||||||||||| ||
seq2  GAACAATTTATGCAAATCTTTTATAAACATTCACAAAACATTTATTTAAG  1095

seq1  CTTTTGAAATGTTGGCCTCATTTGAGAG-CATGAAAATGAGGGGGAAGTA  1143
      | |||  |||||||  |||| ||||||| |||| |||||||||    |||
seq2  CCTTTTGAATGTTG--CTCAATTGAGAGCCATGGAAATGAGGG----GTA  1139

seq1  G-AAAAACGCAAAGGACAGCTTAGAAGCTGGCACGCTACATAAATATTCA  1192
      |  |||||||||  ||| || ||| ||||||||  ||   ||||||||| 
seq2  GTGAAAACGCAA--GAC-GC-TAG-AGCTGGCAGCCTCATTAAATATTCG  1184

seq1  G-AAGGAAG  1200
      | |||||||
seq2  GAAAGGAAG  1193

seq1: chr2_38134222_38135281
seq2: B6Ng01-286H18.g_69_1125 (reverse)

seq1  AGAGAGACT-CAGAATTTGGGAGACAGTATAC-AAGCTGGCTATGTCATA  48
      ||||||||| |||||||| ||||||||||||| ||||| |||||||||||
seq2  AGAGAGACTCCAGAATTT-GGAGACAGTATACAAAGCT-GCTATGTCATA  48

seq1  TACACATTTGGGGAAGGGGTTGCTGCTTCAGCATTATACCCCTTATTCCA  98
       ||||||||||| ||||||||||||| ||||||||||| |||||||||||
seq2  -ACACATTTGGGAAAGGGGTTGCTGC-TCAGCATTATA-CCCTTATTCCA  95

seq1  GCCTCACTCACACCCTGGAGTACAAACTCAGCTAGGACTCAAACAGCACT  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCACTCACACCCTGGAGTACAAACTCAGCTAGGACTCAAACAGCACT  145

seq1  TACTCTAGACCAATTTCCTTCTGTCTGTTTATTCACAAGGCCTAAGCAAT  198
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  TACTCTAGACCAATTT-CTTCTGTCTGTTTATTCACAAGGCCTAAGCAAT  194

seq1  ATCAATGCAACATCCAGGAAACCTTTCCTAAGGCTAACAAGTTCAAAAAC  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAATGCAACATCCAGGAAACCTTTCCTAAGGCTAACAAGTTCAAAAAC  244

seq1  GGTTTCTTTCTGTTGCTTTCTCTTTCTAAAATTGCCAGGGATAGATTTCC  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTCTTTCTGTTGCTTTCTCTTTCTAAAATTGCCAGGGATAGATTTCC  294

seq1  -TTCTTGCCCACTTTAAGTCTTACTTGTCTAGCAGAGCTCATGCCTTCAC  347
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTTGCCCACTTTAAGTCTTACTTGTCTAGCAGAGCTCATGCCTTCAC  344

seq1  CATGGGGCTCTTAAAAGTTCTTTCCCTTTCCCCAGATGGTAGTGGTGAGC  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGGGCTCTTAAAAGTTCTTTCCCTTTCCCCAGATGGTAGTGGTGAGC  394

seq1  ACCTTTAACCCCAGCACCAGGGAGACAGAGGCAGATGAATCTCTGTTCAA  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTTAACCCCAGCACCAGGGAGACAGAGGCAGATGAATCTCTGTTCAA  444

seq1  GGCCAACCTGATTTGCAGAATGAGCTCCAGTACAGCCAGGGTTACACATA  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCAACCTGATTTGCAGAATGAGCTCCAGTACAGCCAGGGTTACACATA  494

seq1  AACAAAACAAAACAAACAAACAAAAATCCTCACTGCAGACCAAAACACCT  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAAAACAAAACAAACAAACAAAAATCCTCACTGCAGACCAAAACACCT  544

seq1  TCTCCCAAATGTAAATACATCGTACACGGATCCTCACCTTATGAACATCT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCAAATGTAAATACATCGTACACGGATCCTCACCTTATGAACATCT  594

seq1  TATTTAAAATATAACTTAGCTAAGTTTACTAGATCATCTTCACTCATTTC  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTAAAATATAACTTAGCTAAGTTTACTAGATCATCTTCACTCATTTC  644

seq1  TAGAGTCTACAACCTCCTGTCACATCTACCTAAAATTTCTCTGAAACCCA  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAGTCTACAACCTCCTGTCACATCTACCTAAAATTTCTCTGAAACCCA  694

seq1  TTCTTTTCTTTTCAATACCAAAACCTCAGATCAGGCCTTCATCTCCTGCA  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTTTCTTTTCAATACCAAAACCTCAGATCAGGCCTTCATCTCCTGCA  744

seq1  ACATAAACTATTGCATAGTTCCTTCCACAATCCTTCAGCATTCCTTTTCC  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATAAACTATTGCATAGTTCCTTCCACAATCCTTCAGCATTCCTTTTCC  794

seq1  CACACACATTCCTGTCAGTAAAAACTAAGCAACACACTTTACACATATCC  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACACATTCCTGTCAGTAAAAACTAAGCAACACACTTTACACATATCC  844

seq1  ATATATACTCTAATGGTTTATAGTTACATCAATAAATTAGAAAGTACAGA  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATATACTCTAATGGTTTATAGTTACATCAATAAATTAGAAAGTACAGA  894

seq1  AGTCCTTAAAGTTATCATTAAACTAAGTCTTTTCCCCATGTTCCAATGGA  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCTTAAAGTTATCATTAAACTAAGTCTTTTCCCCATGTTCCAATGGA  944

seq1  TCACCTTGCACAACCCAGGGATGCCACTGTTTGGCCACTGCACTCTAGTC  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCTTGCACAACCCAGGGATGCCACTGTTTGGCCACTGCACTCTAGTC  994

seq1  TGCTGCTGCTAGTAGTCTACTTAAAAGCCCCAGCAAGATCCCATTGCAGT  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGCTGCTAGTAGTCTACTTAAAAGCCCCAGCAAGATCCCATTGCAGT  1044

seq1  GCTCACTGAATTC  1060
      |||||||||||||
seq2  GCTCACTGAATTC  1057

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information