MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-287A17
Chromosome	2 (Build37)
Map Location	30,872,390 - 31,014,539
singlet/doublet	doublet
Overlap gene	Usp20, Fnbp1, Gpr107
Upstream gene	Spna2, Wdr34, Set, Pkn3, Zdhhc12, Zer1, LOC100041114, Tbc1d13, Slc39a1-ps, Endog, D2Wsu81e, Ccbl1, 1700084E18Rik, Lrrc8a, Phyhd1, Dolk, Nup188, Sh3glb2, 5730472N09Rik, Dolpp1, Crat, Ppp2r4, Ier5l, Cstad, EG665645, 1700001O22Rik, 2610205E22Rik, Asb6, Prrx2, Ptges, Ppia-ps2_387.1, Tor1b, Tor1a, BC005624
Downstream gene	Freq, LOC622345, LOC670182, LOC665700, BC034076, Ass1, Fubp3, LOC100041465, Prdm12, Exosc2, Abl1, BC094274, Fibcd1, Lamc3, 2810003C17Rik, Nup214, A130092J06Rik, LOC100040058, Ppapdc3
Link	Open Mouse BAC browser

Click to get alignment info.

name	Spna2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20740 MGI:98386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71820 MGI:1919070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Set (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56086 MGI:1860267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:263803 MGI:2388285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66220 MGI:1913470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zer1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227693 MGI:2442511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Tbc1d13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70296 MGI:2385326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a1-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194642 MGI:3615375
definition	gene_synonym : Slc39a1p note : solute carrier family 39 (zinc transporter), member 1, pseudogene pseudo : _no_value

name	Endog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13804 MGI:1261433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D2Wsu81e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227695 MGI:106544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccbl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70266 MGI:1917516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700084E18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67350 MGI:1914600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs

name	Lrrc8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241296 MGI:2652847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phyhd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227696 MGI:3612860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dolk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227697 MGI:2677836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup188 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227699 MGI:2446190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3glb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227700 MGI:2385131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730472N09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108958 MGI:1922035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dolpp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57170 MGI:1914093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12908 MGI:109501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110854 MGI:1346006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ier5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72500 MGI:1919750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cstad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78617 MGI:1925867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665645 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665645 MGI:3644459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	1700001O22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73598 MGI:1923631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610205E22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66617 MGI:1913867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72323 MGI:1919573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prrx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20204 MGI:98218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptges (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64292 MGI:1927593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppia-ps2_387.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606546
definition	note : peptidylprolyl isomerase A pseudogene 2_387.1 pseudo : _no_value

name	Tor1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30934 MGI:1353605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tor1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30931 MGI:1353568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC005624 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227707 MGI:2385132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74270 MGI:1921520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fnbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14269 MGI:109606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gpr107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277463 MGI:2139054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Freq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14299 MGI:109166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622345 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622345
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC670182 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC665700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	BC034076 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227712 MGI:2677838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ass1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11898 MGI:88090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fubp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320267 MGI:2443699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041465 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Prdm12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381359 MGI:2685844
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Exosc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227715 MGI:2385133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11350 MGI:87859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC094274 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227717 MGI:3630329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fibcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98970 MGI:2138953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lamc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23928 MGI:1344394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810003C17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108897 MGI:1919598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup214 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227720 MGI:1095411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A130092J06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241303 MGI:2443569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040058 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Ppapdc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227721 MGI:2445183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spna2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115496849 GeneID:20740 MGI:98386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spectrin alpha 2 transcript_id : NM_001076554.1

name	Wdr34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948826 GeneID:71820 MGI:1919070
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 34 transcript_id : NM_001008498.2

name	Set (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130684 GeneID:56086 MGI:1860267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET translocation transcript_id : NM_023871.3

name	Pkn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418928 GeneID:263803 MGI:2388285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase N3 transcript_id : NM_153805.1

name	Zdhhc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649750 GeneID:66220 MGI:1913470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 12 transcript_id : NM_001037762.1

name	Zdhhc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649754 GeneID:66220 MGI:1913470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 12 transcript_id : NM_025428.2

name	Zer1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542270 GeneID:227693 MGI:2442511
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zer-1 homolog (C. elegans) transcript_id : NM_178694.3

name	LOC100041114 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249267 GeneID:100041114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100041114 transcript_id : XM_001477522.1

name	Tbc1d13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368502 GeneID:70296 MGI:2385326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 13 transcript_id : NM_146252.2

name	Endog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679646 GeneID:13804 MGI:1261433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endonuclease G transcript_id : NM_007931.1

name	D2Wsu81e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801856 GeneID:227695 MGI:106544
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 2, Wayne State University 81, expressed transcript_id : NM_172660.2

name	Ccbl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982062 GeneID:70266 MGI:1917516
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine conjugate-beta lyase 1 transcript_id : NM_172404.2

name	1700084E18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366331 GeneID:67350 MGI:1914600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs product : RIKEN cDNA 1700084E18 gene transcript_id : XM_977942.1

name	Lrrc8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62388880 GeneID:241296 MGI:2652847
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 8A transcript_id : NM_177725.3

name	Phyhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62388881 GeneID:227696 MGI:3612860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phytanoyl-CoA dioxygenase domain containing 1 transcript_id : NM_172267.2

name	Dolk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930710 GeneID:227697 MGI:2677836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dolichol kinase transcript_id : NM_177648.3

name	Nup188 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38678525 GeneID:227699 MGI:2446190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 188 transcript_id : NM_198304.2

name	Sh3glb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314837 GeneID:227700 MGI:2385131
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-domain GRB2-like endophilin B2 transcript_id : NM_139302.1

name	5730472N09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982182 GeneID:108958 MGI:1922035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730472N09 gene transcript_id : NM_175392.3

name	Dolpp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384824 GeneID:57170 MGI:1914093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dolichyl pyrophosphate phosphatase 1 transcript_id : NM_020329.2

name	Crat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198337 GeneID:12908 MGI:109501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carnitine acetyltransferase transcript_id : NM_007760.3

name	Ppp2r4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350306 GeneID:110854 MGI:1346006
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2A, regulatory subunit B (PR 53) transcript_id : NM_138748.3

name	Ier5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508419 GeneID:72500 MGI:1919750
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immediate early response 5-like transcript_id : NM_030244.3

name	Cstad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292434 GeneID:78617 MGI:1925867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CSA-conditional, T cell activation-dependent protein transcript_id : NM_030137.2

name	EG665645 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366335 GeneID:665645 MGI:3644459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG665645 transcript_id : XM_978420.1

name	1700001O22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574089 GeneID:73598 MGI:1923631
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700001O22 gene transcript_id : NM_198000.1

name	2610205E22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130053 GeneID:66617 MGI:1913867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610205E22 gene transcript_id : NM_170592.2

name	Asb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311559 GeneID:72323 MGI:1919573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 6 transcript_id : NM_133346.2

name	Prrx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677840 GeneID:20204 MGI:98218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired related homeobox 2 transcript_id : NM_009116.1

name	Ptges (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46852157 GeneID:64292 MGI:1927593
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin E synthase transcript_id : NM_022415.2

name	Tor1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861255 GeneID:30934 MGI:1353605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin family 1, member B transcript_id : NM_133673.3

name	Tor1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450254 GeneID:30931 MGI:1353568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin family 1, member A (torsin A) transcript_id : NM_144884.1

name	BC005624 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450248 GeneID:227707 MGI:2385132
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC005624 transcript_id : NM_144885.1

name	Usp20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359890 GeneID:74270 MGI:1921520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 20 transcript_id : NM_028846.3

name	Fnbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662769 GeneID:14269 MGI:109606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin binding protein 1 transcript_id : NM_001038700.1

name	Fnbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662772 GeneID:14269 MGI:109606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin binding protein 1 transcript_id : NM_019406.2

name	Gpr107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802594 GeneID:277463 MGI:2139054
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 107 transcript_id : NM_178760.3

name	Freq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130553 GeneID:14299 MGI:109166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : frequenin homolog (Drosophila) transcript_id : NM_019681.3

name	LOC670182 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249240 GeneID:670182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical LOC670182 transcript_id : XM_001473893.1

name	LOC665700 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94366343 GeneID:665700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : hemicentin 1-like transcript_id : XM_978791.1

name	BC034076 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982240 GeneID:227712 MGI:2677838
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC034076 transcript_id : NM_177649.3

name	Ass1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893196 GeneID:11898 MGI:88090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : argininosuccinate synthetase 1 transcript_id : NM_007494.3

name	Fubp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802436 GeneID:320267 MGI:2443699
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : far upstream element (FUSE) binding protein 3 transcript_id : NM_001033389.2

name	LOC100041465 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249275 GeneID:100041465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100041465 transcript_id : XM_001478150.1

name	Prdm12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366345 GeneID:381359 MGI:2685844
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : PR domain containing 12 transcript_id : XM_355325.5

name	Exosc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386116 GeneID:227715 MGI:2385133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 2 transcript_id : NM_144886.2

name	Abl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803247 GeneID:11350 MGI:87859
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-abl Abelson murine leukemia oncogene 1 transcript_id : NM_009594.2

name	BC094274 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351388 GeneID:227717 MGI:3630329
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC094274 transcript_id : NM_183424.2

name	Fibcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353012 GeneID:98970 MGI:2138953
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibrinogen C domain containing 1 transcript_id : NM_178887.3

name	Lamc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130018 GeneID:23928 MGI:1344394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : laminin gamma 3 transcript_id : NM_011836.3

name	2810003C17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553104 GeneID:108897 MGI:1919598
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810003C17 gene transcript_id : NM_145144.1

name	Nup214 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378032 GeneID:227720 MGI:1095411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 214 transcript_id : NM_172268.2

name	A130092J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801699 GeneID:241303 MGI:2443569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A130092J06 gene transcript_id : NM_175511.3

name	LOC100040058 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249244 GeneID:100040058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100040058 transcript_id : XM_001474012.1

name	Ppapdc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356125 GeneID:227721 MGI:2445183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidic acid phosphatase type 2 domain containing 3 transcript_id : NM_145521.3

name	Spna2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115496850 GeneID:20740 MGI:98386
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA] codon_start : 1 note : alpha-spectrin 2, brain; alpha-fodrin product : spectrin alpha 2 protein_id : NP_001070022.1

name	Wdr34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948827 CCDS:CCDS15865.1 GeneID:71820 MGI:1919070
definition	codon_start : 1 product : WD repeat domain 34 protein_id : NP_001008498.2

name	Set (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13591862 CCDS:CCDS15866.1 GeneID:56086 MGI:1860267
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] codon_start : 1 product : SET translocation protein_id : NP_076360.1

name	Pkn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418929 CCDS:CCDS15867.1 GeneID:263803 MGI:2388285
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein kinase N3 protein_id : NP_722500.1

name	Zdhhc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649751 CCDS:CCDS15868.1 GeneID:66220 MGI:1913470
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; zinc finger DHHC domain containing 12 product : zinc finger, DHHC domain containing 12 isoform b protein_id : NP_001032851.1

name	Zdhhc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649755 CCDS:CCDS15869.1 GeneID:66220 MGI:1913470
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; zinc finger DHHC domain containing 12 product : zinc finger, DHHC domain containing 12 isoform a protein_id : NP_079704.2

name	Zer1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542271 CCDS:CCDS15870.1 GeneID:227693 MGI:2442511
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : zyg-11 homolog B (C. elegans)-like protein_id : NP_848809.2

name	LOC100041114 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249268 GeneID:100041114
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477572.1

name	Tbc1d13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122839 CCDS:CCDS15871.1 GeneID:70296 MGI:2385326
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : TBC1 domain family member 13 product : TBC1 domain family, member 13 protein_id : NP_666364.1

name	Endog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679647 CCDS:CCDS15872.1 GeneID:13804 MGI:1261433
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : endonuclease G protein_id : NP_031957.1

name	D2Wsu81e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369948 CCDS:CCDS15873.1 GeneID:227695 MGI:106544
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC227695 protein_id : NP_766248.1

name	Ccbl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982063 CCDS:CCDS15874.1 GeneID:70266 MGI:1917516
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0047804 - cysteine-S-conjugate beta-lyase activity [Evidence IEA]; GO:0047316 - glutamine-phenylpyruvate transaminase activity [Evidence IEA]; GO:0016212 - kynurenine-oxoglutarate transaminase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] codon_start : 1 note : kynurenine aminotransferase I; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase) product : cysteine conjugate-beta lyase 1 protein_id : NP_765992.2

name	1700084E18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366332 GeneID:67350 MGI:1914600
definition	codon_start : 1 product : hypothetical protein LOC67350 protein_id : XP_983036.1

name	Lrrc8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244192 CCDS:CCDS15875.1 GeneID:241296 MGI:2652847
definition	codon_start : 1 product : leucine-rich repeat-containing 8 protein_id : NP_808393.1

name	Phyhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986561 CCDS:CCDS15876.1 GeneID:227696 MGI:3612860
definition	codon_start : 1 product : phytanoyl-CoA dioxygenase domain containing 1 protein_id : NP_758471.1

name	Dolk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244058 CCDS:CCDS15877.1 GeneID:227697 MGI:2677836
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004605 - phosphatidate cytidylyltransferase activity [Evidence IEA] GO_process : GO:0008654 - phospholipid biosynthesis [Evidence IEA] codon_start : 1 product : transmembrane protein 15 protein_id : NP_808316.1

name	Nup188 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38678526 CCDS:CCDS15878.1 GeneID:227699 MGI:2446190
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA] codon_start : 1 product : nucleoporin 188 protein_id : NP_938046.2

name	Sh3glb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314838 CCDS:CCDS15879.1 GeneID:227700 MGI:2385131
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : SH3-containing protein SH3GLB2 product : SH3-domain GRB2-like endophilin B2 protein_id : NP_647463.1

name	5730472N09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425102 CCDS:CCDS15880.1 GeneID:108958 MGI:1922035
definition	codon_start : 1 note : mFLJ00199 protein product : hypothetical protein LOC108958 protein_id : NP_780601.1

name	Dolpp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9966770 CCDS:CCDS15881.1 GeneID:57170 MGI:1914093
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047874 - dolichyldiphosphatase activity [Evidence IDA] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006487 - protein amino acid N-linked glycosylation [Evidence IDA] codon_start : 1 function : expression of this gene product inhibits the growth of E. coli product : dolichyl pyrophosphate phosphatase 1 protein_id : NP_065062.1

name	Crat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662408 CCDS:CCDS15882.1 GeneID:12908 MGI:109501
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004092 - carnitine O-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : carnitine acetyltransferase protein_id : NP_031786.2

name	Ppp2r4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981677 CCDS:CCDS15883.1 GeneID:110854 MGI:1346006
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence ISS]; GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0008601 - protein phosphatase type 2A regulator activity [Evidence ISS] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence ISS] codon_start : 1 exception : mismatches in translation product : protein phosphatase 2A, regulatory subunit B (PR 53) protein_id : NP_620087.2

name	Ier5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508420 GeneID:72500 MGI:1919750
definition	codon_start : 1 product : immediate early response 5-like protein_id : NP_084520.3

name	Cstad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469017 CCDS:CCDS15884.1 GeneID:78617 MGI:1925867
definition	GO_component : GO:0005741 - mitochondrial outer membrane [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007006 - mitochondrial membrane organization and biogenesis [Evidence IDA] codon_start : 1 note : CSA-conditional T cell activation-dependent protein product : CSA-conditional, T cell activation-dependent protein protein_id : NP_084413.1

name	EG665645 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366336 GeneID:665645 MGI:3644459
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983514.1

name	1700001O22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574090 CCDS:CCDS15885.1 GeneID:73598 MGI:1923631
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73598 protein_id : NP_932117.1

name	2610205E22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24528555 CCDS:CCDS15886.1 GeneID:66617 MGI:1913867
definition	codon_start : 1 product : hypothetical protein LOC66617 protein_id : NP_733480.1

name	Asb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111154 GeneID:72323 MGI:1919573
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : ankyrin repeat and SOCS box-containing protein 6 protein_id : NP_579924.1

name	Prrx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677841 CCDS:CCDS15888.1 GeneID:20204 MGI:98218
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : surface antigen, homeo box of paired rule product : paired related homeobox 2 protein_id : NP_033142.1

name	Ptges (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967941 CCDS:CCDS15889.1 GeneID:64292 MGI:1927593
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0005641 - nuclear envelope lumen [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0004667 - prostaglandin-D synthase activity [Evidence TAS]; GO:0050220 - prostaglandin-E synthase activity [Evidence IEA] GO_process : GO:0006693 - prostaglandin metabolism [Evidence IDA] codon_start : 1 product : prostaglandin E synthase protein_id : NP_071860.1

name	Tor1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559990 CCDS:CCDS15890.1 GeneID:30934 MGI:1353605
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : torsin family 1, member B protein_id : NP_598434.2

name	Tor1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450255 CCDS:CCDS15891.1 GeneID:30931 MGI:1353568
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : dystonia 1 product : torsin A protein_id : NP_659133.1

name	BC005624 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450249 CCDS:CCDS15892.1 GeneID:227707 MGI:2385132
definition	codon_start : 1 product : cDNA sequence BC005624 protein_id : NP_659134.1

name	Usp20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794162 CCDS:CCDS15893.1 GeneID:74270 MGI:1921520
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ubiquitin specific protease 20 protein_id : NP_083122.1

name	Fnbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662770 GeneID:14269 MGI:109606
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; formin binding protein 17 product : formin binding protein 1 isoform a protein_id : NP_001033789.1

name	Fnbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956088 CCDS:CCDS15894.1 GeneID:14269 MGI:109606
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; formin binding protein 17 product : formin binding protein 1 isoform b protein_id : NP_062279.1

name	Gpr107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520219 CCDS:CCDS15895.1 GeneID:277463 MGI:2139054
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : expressed sequence AI790205 protein_id : NP_848875.1

name	Freq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790115 CCDS:CCDS15896.1 GeneID:14299 MGI:109166
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence TAS] GO_process : GO:0050806 - positive regulation of synaptic transmission [Evidence TAS] codon_start : 1 note : neuronal calcium sensor-1 product : frequenin homolog protein_id : NP_062655.1

name	LOC670182 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249241 GeneID:670182
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473943.1

name	LOC665700 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94366344 GeneID:665700
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983885.1

name	BC034076 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982241 CCDS:CCDS15897.1 GeneID:227712 MGI:2677838
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC227712 protein_id : NP_808317.2

name	Ass1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6996911 CCDS:CCDS15898.1 GeneID:11898 MGI:88090
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004055 - argininosuccinate synthase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0006526 - arginine biosynthesis [Evidence IEA]; GO:0000050 - urea cycle [Evidence IEA] codon_start : 1 note : arginosuccinate synthetase 1 product : argininosuccinate synthetase protein_id : NP_031520.1

name	Fubp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370320 CCDS:CCDS15899.1 GeneID:320267 MGI:2443699
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : far upstream element (FUSE) binding protein 3 protein_id : NP_001028561.1

name	LOC100041465 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249276 GeneID:100041465
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478200.1

name	Prdm12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366346 GeneID:381359 MGI:2685844
definition	codon_start : 1 product : PR domain containing 12 protein_id : XP_355325.5

name	Exosc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450259 CCDS:CCDS15900.1 GeneID:227715 MGI:2385133
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 note : homolog of Yeast RRP4 (ribosomal RNA processing 4), 3'-5'-exoribonuclease product : exosome component 2 protein_id : NP_659135.1

name	Abl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859504 CCDS:CCDS15901.1 GeneID:11350 MGI:87859
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Abelson murine leukemia oncogene product : v-abl Abelson murine leukemia oncogene 1 protein_id : NP_033724.1

name	BC094274 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34556201 CCDS:CCDS15902.1 GeneID:227717 MGI:3630329
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005184 - neuropeptide hormone activity [Evidence ISS] GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence ISS] [Evidence IEA] codon_start : 1 note : P518 precursor protein; P518 precursor protein (P518) product : P518 precursor protein_id : NP_906269.1

name	Fibcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725730 GeneID:98970 MGI:2138953
definition	codon_start : 1 exception : mismatches in translation product : fibrinogen C domain containing 1 protein_id : NP_849218.1

name	Lamc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66392579 CCDS:CCDS15903.1 GeneID:23928 MGI:1344394
definition	GO_component : GO:0005604 - basement membrane [Evidence IEA]; GO:0031012 - extracellular matrix [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : laminin gamma 3 protein_id : NP_035966.2

name	2810003C17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553105 CCDS:CCDS15904.1 GeneID:108897 MGI:1919598
definition	codon_start : 1 product : ionized calcium binding adapter molecule 2 protein_id : NP_660126.1

name	Nup214 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378033 GeneID:227720 MGI:1095411
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005643 - nuclear pore [Evidence TAS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005487 - nucleocytoplasmic transporter activity [Evidence IMP]; GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IMP]; GO:0006611 - protein export from nucleus [Evidence ISS]; GO:0006606 - protein import into nucleus [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IMP] codon_start : 1 product : nucleoporin 214 protein_id : NP_758472.2

name	A130092J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425270 CCDS:CCDS15905.1 GeneID:241303 MGI:2443569
definition	codon_start : 1 product : hypothetical protein LOC241303 protein_id : NP_780720.1

name	LOC100040058 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249245 GeneID:100040058
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474062.1

name	Ppapdc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704026 CCDS:CCDS15906.1 GeneID:227721 MGI:2445183
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : phosphatidic acid phosphatase type 2 domain containing 3 protein_id : NP_663496.1

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 1 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 2 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 3 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 4 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 5 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 6 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 7 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 8 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 9 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 10 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 11 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 12 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 13 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 14 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 15 pseudo : _no_value

clone name	MSMg01-358B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418G04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-262G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213J24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-287A17.b	B6Ng01-287A17.g
ACC	GA085077	GA085078
length	816	1,021
definition	B6Ng01-287A17.b	B6Ng01-287A17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(31,013,726 - 31,014,539)	(30,872,390 - 30,873,409)
sequence	gaattcaaatgcccaagaccaaggaggatgtttctaattcaaactatcac agatgataagacccagttttgggctgggtgtggtggtgcatgcctttaat cccagcacttgggaggcagaggcagtcggatttctgagttcgagaccagc ctggtctacagagtgagttccaggacagccagggctatacagagaaaccc tgtctcaaaaacaaaaaacaaaaacaaattaaaaaatccagttttttaag aaaatcactctagggctggagagatggctcagtggttaagagcactgact gctctttcaaaagtcctgaattcaattcccaacatccacatggtggctca taaccatctatcctgtatcagatgccctcctgtggcatgcagacgcctat acatacataaatacatacacacacacacatacacacacacatacacacac acacacacacacacacacacgtgcgcgcgcgcgcacacacagagagagag agagagagagagagagagtgaatcaccctagtgggctaaataaataagta aaatgtaaaactctatgagctagaagatgctggagactacactggtccag gagtcattaagggtggaccagaggaagcagcaattgtggtaataacacac aagaagacaggggattgggagctatttagaatactttacagaacttggtg acttggtgaaatgacagacttccagcttgagaaatgagcagccagtggtc tagttactaagaaagtcaaagtgggagggagagtccacaggctgggggtg gaggggtgggggagga	gaattcttgggaaataagcgtggcaggctggggtggcatgggctccctac agggaccagtccctctggcagccacaccataggctgccagtccttagaag agaagatggggctattggcttccatgtgtaggtctctgacctgtgtgata gattccacgcaggtccaatggcctggtcctgggctggagcttatctgtga gcttccctgccatctgccccagatgcccagcatgactggcacctgccctc tcccctcagattctgtgcgtccacctgaagcgcttccggcatgaggtgat gtactccttcaaggtcagcagccatgtctctttccccctcgagggactgg acctacgcccttttctggccaaggagtgcacgtcccaggtcaccacctat gacctcctctctgtcatctgtcaccatggcacagcaggcagtgagtatgg cccaccaggccccgcttgcagtgcctagtccctgtggtctccatagcctc ttgcttgtctctcaggtgggcactacattgcctactgtcagaacgtgatc aatgggcagtggtacgaattcgatgaccagtacgtcaccgaggtccatga gacggtagtacagaacgtggaggcctacgtgctgttctacaggtgagact gggggccctgctgcatgtctccctgcagctgcagtctgagcttttcctgt ggtgtcccagcatgctaaagggtggctctgcacacaccctggccatggca tggcttgtgtccatgcacaacctgcccccagctagtggctcataccacac cctccatcccaggaagagcagtgaggaggccatgcgtgagcggcagcagg tagtgtccctggctgccatgcgggaacccagcctgctccgcttctacgtg tcccgagaatggctcaacaaattcaacaccttgccgagcaggcccatcac caaccacaccttcctgtgctcccatggaggtggagcagtccgccgccggg aagaggtattggagggggggt
quality values	Open. Hide. 58 26 19 26 58 26 22 45 52 36 31 58 62 41 30 54 62 47 47 41 27 62 62 62 47 54 62 37 15 47 47 62 56 42 35 25 21 27 32 16 19 22 34 43 62 62 62 59 59 62 59 62 59 62 62 59 59 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 38 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 59 62 62 54 59 62 59 62 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 58 54 54 49 31 58 58 54 54 58 58 58 58 58 54 58 58 52 52 58 58 58 58 58 54 54 49 58 58 39 46 58 54 54 58 58 58 54 58 58 58 52 58 58 58 50 58 51 51 52 58 58 32 45 27 58 51 54 58 58 58 39 47 37 53 53 53 40 54 47 58 58 50 51 51 50 52 58 51 32 51 53 34 41 42 41 48 33 58 51 37 58 58 46 22 50 50 46 46 9 43 32 49 39 53 52 37 49 35 41 41 58 58 32 58 30 37 27 46 52 49 49 50 50 51 53 53 37 49 50 58 44 50 46 30 42 47 49 38 49 33 22 50 58 49 49 50 32 39 49 35 51 58 43 27 25 58 53 50 43 50 53 58 51 38 37 30 37 58 32 39 53 51 50 50 41 51 26 26 49 49 52 51 35 33 35 54 40 35 39 42 39 31 28 49 23 53 52 35 32 33 42 53 41 54 49 39 31 53 54 34 26 37 53 29 45 39 32 49 49 32 41 35 52 51 31 37 37 32 31 49 32 32 33 35 31 33 14 37 54 37 32 32 32 42 54 53 39 34 42 49 21 41 16 54 35 25 27 53 28 31 38 53 31 53 32 15 21 21 33 51 49 49 49 33 16 33 32 31 19 52 40 22 10 32 40 47 47 29 33 29 30 9	Open. Hide. 62 47 38 39 62 62 62 62 62 62 62 47 51 51 50 38 44 25 35 44 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 59 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 49 58 58 58 58 58 58 58 54 58 58 48 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 54 58 54 58 58 49 52 48 54 58 58 58 54 58 58 58 58 58 58 58 54 58 58 58 54 53 42 58 58 49 58 51 58 42 51 58 51 58 54 58 58 58 52 58 53 53 58 58 51 54 42 52 58 54 42 58 58 42 54 53 50 58 28 39 32 50 49 53 49 51 58 53 53 47 58 48 33 18 58 38 51 49 37 51 53 58 42 49 41 50 51 52 53 53 54 41 53 41 52 58 50 40 58 52 58 58 36 19 47 37 58 52 42 47 40 51 49 51 51 54 50 53 53 42 39 50 32 40 58 50 43 46 41 51 31 53 49 58 58 58 44 42 43 35 41 53 51 47 44 40 40 50 54 47 49 51 52 54 38 47 49 44 44 41 49 50 41 47 38 34 33 53 37 40 51 21 53 53 54 54 53 52 53 40 54 42 51 44 31 51 33 39 54 39 34 30 51 40 32 44 40 32 24 54 42 27 36 42 32 39 39 30 51 42 39 40 40 25 37 52 53 34 42 52 52 31 53 27 39 42 28 31 21 40 27 34 29 47 32 30 32 53 51 32 47 41 33 33 32 34 31 45 30 43 31 32 31 52 32 45 30 51 46 47 41 33 28 39 25 34 34 34 43 31 31 35 33 35 43 33 30 32 31 33 30 28 47 45 33 28 31 33 37 34 51 31 31 15 36 33 33 13 46 19 31 31 19 26 37 37 23 32 41 25 28 22 33 29 34 32 43 32 31 31 31 20 37 32 35 21 34 24 31 23 27 26 26 35 19 22 31 31 31 48 41 31 27 31 24 32 38 21 30 21 31 34 20 22 41 33 21 23 27 48 32 32 24 31 27 19 31 25 42 18 26 13 22 34 42 32 21 25 29 12 13 19 32 27 48 25 19 34 26 32 38 33 23 25 15 34 32 23 19 21 26 48 29 37 33 21 17 21 26 29 18 12 18 10 13 9 10 16 37 6 13 11 31 17 7 31 22 27 34 28 20 7 33 11 17 24 7 17 25 15 9 33 20 18 17 15 23 20 10 28 32 32 18 48 34 27 32 19 25 17 13 12 14 15 7 18 11 28 26 24 24 25 14 15 22 8 8 20 21 15 30 15 17 7 10 10 5 9 6 5 6 7 5 6 18 10 34 30 27 26 24 4 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_31013726_31014539
seq2: B6Ng01-287A17.b_42_857 (reverse)

seq1  TCCTCCCC--ACCCTCCACCCCCAGCCTGTGGACTCTCCCTCCCACTTTG  48
      ||||||||   |||||||||||||||||||||||||||||||||||||||
seq2  TCCTCCCCCACCCCTCCACCCCCAGCCTGTGGACTCTCCCTCCCACTTTG  50

seq1  ACTTTCTTAGTAACTAGACCACTGGCTGCTCATTTCTCAAGCTGGAAGTC  98
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTCTTAGTAACTAGACCACTGGCTGCTCATTTCTCAAGCTGGAAGTC  100

seq1  TGTCATTTCACCAAGTCACCAAGTTCTGTAAAGTATTCTAAATAGCTCCC  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCATTTCACCAAGTCACCAAGTTCTGTAAAGTATTCTAAATAGCTCCC  150

seq1  AATCCCCTGTCTTCTTGTGTGTTATTACCACAATTGCTGCTTCCTCTGGT  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCCCCTGTCTTCTTGTGTGTTATTACCACAATTGCTGCTTCCTCTGGT  200

seq1  CCACCCTTAATGACTCCTGGACCAGTGTAGTCTCCAGCATCTTCTAGCTC  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCCTTAATGACTCCTGGACCAGTGTAGTCTCCAGCATCTTCTAGCTC  250

seq1  ATAGAGTTTTACATTTTACTTATTTATTTAGCCCACTAGGGTGATTCACT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGAGTTTTACATTTTACTTATTTATTTAGCCCACTAGGGTGATTCACT  300

seq1  CTCTCTCTCTCTCTCTCTCTCTCTCTGTGTGTGCGCGCGCGCGCACGTGT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCTCTCTCTCTCTCTCTCTCTCTGTGTGTGCGCGCGCGCGCACGTGT  350

seq1  GTGTGTGTGTGTGTGTGTGTGTGTATGTGTGTGTGTATGTGTGTGTGTGT  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGTGTGTGTGTGTGTGTGTGTATGTGTGTGTGTATGTGTGTGTGTGT  400

seq1  ATGTATTTATGTATGTATAGGCGTCTGCATGCCACAGGAGGGCATCTGAT  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTATTTATGTATGTATAGGCGTCTGCATGCCACAGGAGGGCATCTGAT  450

seq1  ACAGGATAGATGGTTATGAGCCACCATGTGGATGTTGGGAATTGAATTCA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGATAGATGGTTATGAGCCACCATGTGGATGTTGGGAATTGAATTCA  500

seq1  GGACTTTTGAAAGAGCAGTCAGTGCTCTTAACCACTGAGCCATCTCTCCA  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTTTTGAAAGAGCAGTCAGTGCTCTTAACCACTGAGCCATCTCTCCA  550

seq1  GCCCTAGAGTGATTTTCTTAAAAAACTGGATTTTTTAATTTGTTTTTGTT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCTAGAGTGATTTTCTTAAAAAACTGGATTTTTTAATTTGTTTTTGTT  600

seq1  TTTTGTTTTTGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAAC  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGTTTTTGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAAC  650

seq1  TCACTCTGTAGACCAGGCTGGTCTCGAACTCAGAAATCCGACTGCCTCTG  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTCTGTAGACCAGGCTGGTCTCGAACTCAGAAATCCGACTGCCTCTG  700

seq1  CCTCCCAAGTGCTGGGATTAAAGGCATGCACCACCACACCCAGCCCAAAA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCCAAGTGCTGGGATTAAAGGCATGCACCACCACACCCAGCCCAAAA  750

seq1  CTGGGTCTTATCATCTGTGATAGTTTGAATTAGAAACATCCTCCTTGGTC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGTCTTATCATCTGTGATAGTTTGAATTAGAAACATCCTCCTTGGTC  800

seq1  TTGGGCATTTGAATTC  814
      ||||||||||||||||
seq2  TTGGGCATTTGAATTC  816

seq1: chr2_30872390_30873409
seq2: B6Ng01-287A17.g_65_1085

seq1  GAATTCTTGGGAAATAAGCGTGGCAGGCTGGGGTGGCATGGGCTCCCTAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTGGGAAATAAGCGTGGCAGGCTGGGGTGGCATGGGCTCCCTAC  50

seq1  AGGGACCAGTCCCTCTGGCAGCCACACCATAGGCTGCCAGTCCTTAGAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGACCAGTCCCTCTGGCAGCCACACCATAGGCTGCCAGTCCTTAGAAG  100

seq1  AGAAGATGGGGCTATTGGCTTCCATGTGTAGGTCTCTGACCTGTGTGATA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGATGGGGCTATTGGCTTCCATGTGTAGGTCTCTGACCTGTGTGATA  150

seq1  GATTCCACGCAGGTCCAATGGCCTGGTCCTGGGCTGGAGCTTATCTGTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTCCACGCAGGTCCAATGGCCTGGTCCTGGGCTGGAGCTTATCTGTGA  200

seq1  GCTTCCCTGCCATCTGCCCCAGATGCCCAGCATGACTGGCACCTGCCCTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCCCTGCCATCTGCCCCAGATGCCCAGCATGACTGGCACCTGCCCTC  250

seq1  TCCCCTCAGATTCTGTGCGTCCACCTGAAGCGCTTCCGGCATGAGGTGAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCTCAGATTCTGTGCGTCCACCTGAAGCGCTTCCGGCATGAGGTGAT  300

seq1  GTACTCCTTCAAGGTCAGCAGCCATGTCTCTTTCCCCCTCGAGGGACTGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACTCCTTCAAGGTCAGCAGCCATGTCTCTTTCCCCCTCGAGGGACTGG  350

seq1  ACCTACGCCCTTTTCTGGCCAAGGAGTGCACGTCCCAGGTCACCACCTAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTACGCCCTTTTCTGGCCAAGGAGTGCACGTCCCAGGTCACCACCTAT  400

seq1  GACCTCCTCTCTGTCATCTGTCACCATGGCACAGCAGGCAGTGAGTATGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTCCTCTCTGTCATCTGTCACCATGGCACAGCAGGCAGTGAGTATGG  450

seq1  CCCACCAGGCCCCGCTTGCAGTGCCTAGTCCCTGTGGTCTCCATAGCCTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACCAGGCCCCGCTTGCAGTGCCTAGTCCCTGTGGTCTCCATAGCCTC  500

seq1  TTGCTTGTCTCTCAGGTGGGCACTACATTGCCTACTGTCAGAACGTGATC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTTGTCTCTCAGGTGGGCACTACATTGCCTACTGTCAGAACGTGATC  550

seq1  AATGGGCAGTGGTACGAATTCGATGACCAGTACGTCACCGAGGTCCATGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGGCAGTGGTACGAATTCGATGACCAGTACGTCACCGAGGTCCATGA  600

seq1  GACGGTAGTACAGAACGTGGAGGCCTACGTGCTGTTCTACAGGTGAGACT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACGGTAGTACAGAACGTGGAGGCCTACGTGCTGTTCTACAGGTGAGACT  650

seq1  GGGGGCCCTGCTGCATGTCTCCCTGCAGCTGCAGTCTGAGCTTTTCCTGT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGCCCTGCTGCATGTCTCCCTGCAGCTGCAGTCTGAGCTTTTCCTGT  700

seq1  GGTGTCCCAGCATGCTAAAGGGTGGCTCTGCACACACCCTGGCCATGGCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTCCCAGCATGCTAAAGGGTGGCTCTGCACACACCCTGGCCATGGCA  750

seq1  TGGCTTGTGTCCATGCACAACCTGCCCCCAGCTAGTGGCTCATACCACAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTTGTGTCCATGCACAACCTGCCCCCAGCTAGTGGCTCATACCACAC  800

seq1  CCTCCATCCCAGGAAGAGCAGTGAGGAGGCCATGCGTGAGCGGCAGCAGG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCATCCCAGGAAGAGCAGTGAGGAGGCCATGCGTGAGCGGCAGCAGG  850

seq1  TAGTGTCCCTGGCTGCCATGCGGGAACCCAGCCTGCTCCGCTTCTACGTG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTGTCCCTGGCTGCCATGCGGGAACCCAGCCTGCTCCGCTTCTACGTG  900

seq1  TCCCGAGAATGGCTCAACAAATTCAACACCTTTGCCGAGCCAGGGCCCAT  950
      |||||||||||||||||||||||||||||| |||||||||   |||||||
seq2  TCCCGAGAATGGCTCAACAAATTCAACACC-TTGCCGAGC--AGGCCCAT  947

seq1  CACCAACCACACCTTCCTGTGCTCCCATGGAGGT-GAGCAGTCCG-CGCC  998
      |||||||||||||||||||||||||||||||||| |||||||||| ||||
seq2  CACCAACCACACCTTCCTGTGCTCCCATGGAGGTGGAGCAGTCCGCCGCC  997

seq1  GGGAAGAGGTAT--GAGGGGGGGT  1020
      ||||||||||||  ||||||||||
seq2  GGGAAGAGGTATTGGAGGGGGGGT  1021

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information