MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-289D23
Chromosome	2 (Build37)
Map Location	26,463,286 - 26,634,141
singlet/doublet	doublet
Overlap gene	B230317C12Rik, 5730588L14Rik, LOC100039446, Lcn4, LOC669582
Upstream gene	B230208H17Rik, 4921530D09Rik, Tmem141, Fcna, Lcn8, Lcn5, LOC620709, Lcn10, Lcn13, Bmyc, LOC383678, Lcn3, Lcn11, LOC620858, Glt6d1, Lcn9, Sohlh1, Kcnt1, Camsap1, LOC100040100, LOC665199, Ubadc1, Btbd14a, C330006A16Rik, Lhx3, Qscn6l1, C030048H21Rik, 4932418E24Rik, Gpsm1, D2Bwg1335e, Card9, Snapc4, Sdccag3, Pmpca, Inpp5e, AU024582, Notch1, Egfl7, Agpat2
Downstream gene	Abo, Surf6, Surf5-ps, Surf5, Rpl7a, Surf1, Surf2, Surf4, Gm711, Rexo4, Adamts13, 5930434B04Rik, Slc2a6, LOC665315, 1110002H13Rik, Adamtsl2, C630035N08Rik, Dbh, Sardh, Vav2, D2Bwg1423e, Brd3, Wdr5, Rxra
Link	Open Mouse BAC browser

Click to get alignment info.

name	B230208H17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227624 MGI:2442633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921530D09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77058 MGI:1924308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein

name	Tmem141 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51875 MGI:1098773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcna (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14133 MGI:1340905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcn8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78076 MGI:2135945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13863 MGI:1277241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC620709 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins

name	Lcn10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332578 MGI:1925000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcn13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227627 MGI:2387617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmyc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107771 MGI:88184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383678 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Lcn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16820 MGI:102669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcn11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227630 MGI:2684955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein

name	LOC620858 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Glt6d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71103 MGI:1918353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcn9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77704 MGI:1924954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sohlh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227631 MGI:2684956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227632 MGI:1924627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camsap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227634 MGI:3036242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 217 ESTs, 3 Proteins

name	LOC100040100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs

name	LOC665199 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Ubadc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98766 MGI:1920995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btbd14a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67991 MGI:1915241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	C330006A16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109299 MGI:1924939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 81 ESTs

name	Lhx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16871 MGI:102673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Qscn6l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227638 MGI:2387194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030048H21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77481 MGI:1924731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 19 ESTs

name	4932418E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329366 MGI:3045295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpsm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67839 MGI:1915089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D2Bwg1335e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52838 MGI:106559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Card9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332579 MGI:2685628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Snapc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227644 MGI:2443935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdccag3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68112 MGI:1915362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pmpca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66865 MGI:1918568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inpp5e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64436 MGI:1927753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AU024582 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227648 MGI:2139207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Notch1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18128 MGI:97363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Egfl7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353156 MGI:2449923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Agpat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67512 MGI:1914762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230317C12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56279 MGI:1927576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730588L14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329369 MGI:3045374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100039446 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Lcn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16821 MGI:102668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669582 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669582
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Abo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80908 MGI:2135738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Surf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20935 MGI:98447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Surf5-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20934 MGI:104996
definition	note : surfeit gene 5, pseudogene pseudo : _no_value

name	Surf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20933 MGI:98446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rpl7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27176 MGI:1353472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Surf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20930 MGI:98443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Surf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20931 MGI:98444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Surf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20932 MGI:98445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm711 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279029 MGI:2685557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rexo4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227656 MGI:2684957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adamts13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279028 MGI:2685556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5930434B04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381356 MGI:1924317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc2a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227659 MGI:2443286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665315 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665315
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	1110002H13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66139 MGI:1913389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adamtsl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77794 MGI:1925044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C630035N08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109349 MGI:1926106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dbh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13166 MGI:94864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sardh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192166 MGI:2183102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vav2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22325 MGI:102718
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D2Bwg1423e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329372 MGI:106557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 26 ESTs

name	Brd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67382 MGI:1914632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140858 MGI:2155884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rxra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20181 MGI:98214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230208H17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85986572 GeneID:227624 MGI:2442633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230208H17 gene transcript_id : NM_001024616.1

name	4921530D09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249238 GeneID:77058 MGI:1924308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : RIKEN cDNA 4921530D09 gene transcript_id : XM_974596.2

name	Tmem141 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387859 GeneID:51875 MGI:1098773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 141 transcript_id : NM_001040130.2

name	Fcna (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982365 GeneID:14133 MGI:1340905
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ficolin A transcript_id : NM_007995.2

name	Lcn8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14994307 GeneID:78076 MGI:2135945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 8 transcript_id : NM_033145.1

name	Lcn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835734 GeneID:13863 MGI:1277241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 5 transcript_id : NM_001042630.1

name	Lcn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835736 GeneID:13863 MGI:1277241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 5 transcript_id : NM_007947.2

name	LOC620709 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94366291 GeneID:620709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to lipocalin 6 transcript_id : XM_885099.2

name	Lcn10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803496 GeneID:332578 MGI:1925000
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 10 transcript_id : NM_178036.3

name	Lcn13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956341 GeneID:227627 MGI:2387617
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 13 transcript_id : NM_153558.1

name	Bmyc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83035028 GeneID:107771 MGI:88184
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain expressed myelocytomatosis oncogene transcript_id : NM_023326.2

name	LOC383678 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249242 GeneID:383678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to novel lipocalin protein transcript_id : XM_357181.4

name	Lcn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754513 GeneID:16820 MGI:102669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 3 transcript_id : NM_010694.1

name	Lcn11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366296 GeneID:227630 MGI:2684955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : lipocalin 11 transcript_id : XM_130103.4

name	LOC620858 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249226 GeneID:620858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC620858 transcript_id : XM_001472746.1

name	Glt6d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875494 GeneID:71103 MGI:1918353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycosyltransferase 6 domain containing 1 transcript_id : NM_001039095.1

name	Lcn9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368163 GeneID:77704 MGI:1924954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 9 transcript_id : NM_029959.2

name	Sohlh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48762517 GeneID:227631 MGI:2684956
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis and oogenesis specific basic helix-loop-helix 1 transcript_id : NM_001001714.1

name	Kcnt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73611941 GeneID:227632 MGI:1924627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel, subfamily T, member 1 transcript_id : NM_175462.3

name	Camsap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249246 GeneID:227634 MGI:3036242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 217 ESTs, 2 Proteins product : calmodulin regulated spectrin-associated protein 1 transcript_id : XM_975192.2

name	LOC100040100 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249248 GeneID:100040100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs product : hypothetical protein LOC100040100 transcript_id : XM_001474832.1

name	Ubadc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527049 GeneID:98766 MGI:1920995
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin associated domain containing 1 transcript_id : NM_133835.1

name	Btbd14a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80861478 GeneID:67991 MGI:1915241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 14A transcript_id : NM_026495.3

name	Btbd14a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80861476 GeneID:67991 MGI:1915241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 14A transcript_id : NM_001037098.1

name	C330006A16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366305 GeneID:109299 MGI:1924939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 81 ESTs product : RIKEN cDNA C330006A16 gene transcript_id : XM_358556.5

name	Lhx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89001115 GeneID:16871 MGI:102673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 3 transcript_id : NM_001039653.1

name	Qscn6l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130105 GeneID:227638 MGI:2387194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : quiescin Q6-like 1 transcript_id : NM_153559.2

name	C030048H21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249228 GeneID:77481 MGI:1924731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 19 ESTs product : RIKEN cDNA C030048H21 gene transcript_id : XM_975397.2

name	4932418E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351965 GeneID:329366 MGI:3045295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932418E24 gene transcript_id : NM_177841.3

name	Gpsm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351775 GeneID:67839 MGI:1915089
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein signalling modulator 1 (AGS3-like, C. elegans) transcript_id : NM_153410.3

name	D2Bwg1335e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370449 GeneID:52838 MGI:106559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 2, Brigham & Women's Genetics 1335 expressed transcript_id : NM_026828.2

name	Card9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82884281 GeneID:332579 MGI:2685628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : caspase recruitment domain family, member 9, transcript variant 1 transcript_id : XM_285326.4

name	Snapc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361207 GeneID:227644 MGI:2443935
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear RNA activating complex, polypeptide 4 transcript_id : NM_172339.2

name	Sdccag3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801709 GeneID:68112 MGI:1915362
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serologically defined colon cancer antigen 3 transcript_id : NM_026563.2

name	Pmpca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129895 GeneID:66865 MGI:1918568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidase (mitochondrial processing) alpha transcript_id : NM_173180.3

name	Inpp5e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981235 GeneID:64436 MGI:1927753
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol polyphosphate-5-phosphatase E transcript_id : NM_033134.2

name	AU024582 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378049 GeneID:227648 MGI:2139207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU024582 transcript_id : NM_153125.2

name	Notch1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543331 GeneID:18128 MGI:97363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Notch gene homolog 1 (Drosophila) transcript_id : NM_008714.2

name	Egfl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38570122 GeneID:353156 MGI:2449923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGF-like domain 7 transcript_id : NM_178444.3

name	Egfl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38570126 GeneID:353156 MGI:2449923
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGF-like domain 7 transcript_id : NM_198725.1

name	Egfl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38570124 GeneID:353156 MGI:2449923
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGF-like domain 7 transcript_id : NM_198724.1

name	Agpat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956161 GeneID:67512 MGI:1914762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) transcript_id : NM_026212.1

name	B230317C12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364267 GeneID:56279 MGI:1927576
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230317C12 gene transcript_id : NM_019833.2

name	5730588L14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249252 GeneID:329369 MGI:3045374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 5730588L14 gene, transcript variant 2 transcript_id : XM_488938.4

name	5730588L14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249253 GeneID:329369 MGI:3045374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 5730588L14 gene, transcript variant 1 transcript_id : XM_001475516.1

name	LOC100039446 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249230 GeneID:100039446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to odorant binding protein 2A transcript_id : XM_001472904.1

name	Lcn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754515 GeneID:16821 MGI:102668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 4 transcript_id : NM_010695.1

name	Abo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802622 GeneID:80908 MGI:2135738
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-3-galactosyltransferase) transcript_id : NM_030718.3

name	Surf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366474 GeneID:20935 MGI:98447
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : surfeit gene 6 transcript_id : NM_009298.3

name	Surf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76781478 GeneID:20933 MGI:98446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : surfeit gene 5 transcript_id : NM_001033908.1

name	Surf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76781477 GeneID:20933 MGI:98446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : surfeit gene 5 transcript_id : NM_011513.2

name	Rpl7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803092 GeneID:27176 MGI:1353472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L7a transcript_id : NM_013721.3

name	Surf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7363454 GeneID:20930 MGI:98443
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : surfeit gene 1 transcript_id : NM_013677.1

name	Surf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793419 GeneID:20931 MGI:98444
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : surfeit gene 2 transcript_id : NM_013678.2

name	Surf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981472 GeneID:20932 MGI:98445
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : surfeit gene 4 transcript_id : NM_011512.2

name	Gm711 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76781471 GeneID:279029 MGI:2685557
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 711, (NCBI) transcript_id : NM_198628.2

name	Rexo4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76563951 GeneID:227656 MGI:2684957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : REX4, RNA exonuclease 4 homolog (S. cerevisiae) transcript_id : NM_207234.2

name	Adamts13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205379 GeneID:279028 MGI:2685556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13 transcript_id : NM_001001322.2

name	5930434B04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366438 GeneID:381356 MGI:1924317
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5930434B04 gene transcript_id : NM_029862.2

name	Slc2a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369953 GeneID:227659 MGI:2443286
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 2 (facilitated glucose transporter), member 6 transcript_id : NM_172659.1

name	1110002H13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347300 GeneID:66139 MGI:1913389
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110002H13 gene transcript_id : NM_025376.2

name	Adamtsl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037506 GeneID:77794 MGI:1925044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADAMTS-like 2 transcript_id : NM_029981.1

name	C630035N08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359024 GeneID:109349 MGI:1926106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C630035N08 gene transcript_id : NM_175427.3

name	Dbh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815860 GeneID:13166 MGI:94864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dopamine beta hydroxylase transcript_id : NM_138942.3

name	Sardh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149747 GeneID:192166 MGI:2183102
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sarcosine dehydrogenase transcript_id : NM_138665.1

name	Vav2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678554 GeneID:22325 MGI:102718
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vav 2 oncogene transcript_id : NM_009500.1

name	D2Bwg1423e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249234 GeneID:329372 MGI:106557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 26 ESTs product : DNA segment, Chr 2, Brigham & Women's Genetics 1423 expressed transcript_id : XM_001473037.1

name	Brd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364270 GeneID:67382 MGI:1914632
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 3 transcript_id : NM_023336.3

name	Wdr5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18252789 GeneID:140858 MGI:2155884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 5 transcript_id : NM_080848.1

name	Rxra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579898 GeneID:20181 MGI:98214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoid X receptor alpha transcript_id : NM_011305.3

name	B230208H17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181302 GeneID:227624 MGI:2442633
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : novel Ras protein product : hypothetical protein LOC227624 protein_id : NP_001019787.2

name	4921530D09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249239 GeneID:77058 MGI:1924308
definition	codon_start : 1 product : hypothetical protein LOC77058 protein_id : XP_979690.2

name	Tmem141 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92110403 GeneID:51875 MGI:1098773
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 141 protein_id : NP_001035219.1

name	Fcna (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679763 CCDS:CCDS15785.1 GeneID:14133 MGI:1340905
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : ficolin A protein_id : NP_032021.1

name	Lcn8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14994308 CCDS:CCDS15786.1 GeneID:78076 MGI:2135945
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : lipocalin 5 product : lipocalin 8 protein_id : NP_149157.1

name	Lcn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835735 GeneID:13863 MGI:1277241
definition	GO_component : GO:0005615 - extracellular space [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005501 - retinoid binding [Evidence TAS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0042573 - retinoic acid metabolism [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; MEP 10; epididymal retinoic acid-binding protein; epididymal retinoic acid binding protein product : lipocalin 5 isoform b protein_id : NP_001036095.1

name	Lcn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835737 GeneID:13863 MGI:1277241
definition	GO_component : GO:0005615 - extracellular space [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005501 - retinoid binding [Evidence TAS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0042573 - retinoic acid metabolism [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; MEP 10; epididymal retinoic acid-binding protein; epididymal retinoic acid binding protein product : lipocalin 5 isoform a protein_id : NP_031973.2

name	LOC620709 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82884242 GeneID:620709
definition	codon_start : 1 product : similar to lipocalin 6 protein_id : XP_890192.1

name	Lcn10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794262 CCDS:CCDS15787.1 GeneID:332578 MGI:1925000
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : lipocalin protein_id : NP_828875.1

name	Lcn13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956342 CCDS:CCDS15788.1 GeneID:227627 MGI:2387617
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : lipocalin 13 protein_id : NP_705786.1

name	Bmyc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83035029 CCDS:CCDS15789.1 GeneID:107771 MGI:88184
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : brain expressed myelocytomatosis oncogene protein_id : NP_075815.2

name	LOC383678 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249243 GeneID:383678
definition	codon_start : 1 product : similar to novel lipocalin protein protein_id : XP_357181.4

name	Lcn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754514 CCDS:CCDS15790.1 GeneID:16820 MGI:102669
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005550 - pheromone binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 function : transportation of lipophilic molecules, possible pheromone-carrier product : lipocalin 3 protein_id : NP_034824.1

name	Lcn11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20823096 GeneID:227630 MGI:2684955
definition	codon_start : 1 product : lipocalin 11 protein_id : XP_130103.1

name	LOC620858 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249227 GeneID:620858
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472796.1

name	Glt6d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875495 CCDS:CCDS15791.1 GeneID:71103 MGI:1918353
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 note : novel glycosyltransferase family 6 protein product : galactosyltransferase family 6 domain containing 1 protein_id : NP_001034184.1

name	Lcn9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28933463 CCDS:CCDS15792.1 GeneID:77704 MGI:1924954
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005550 - pheromone binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : MUP-like lipocalin product : lipocalin protein_id : NP_084235.1

name	Sohlh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48762518 CCDS:CCDS15793.1 GeneID:227631 MGI:2684956
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : helix-loop-helix protein NOHLH; novel protein containing a helix-loop-helix DNA binding domain product : spermatogenesis and oogenesis specific basic helix-loop-helix 1 protein_id : NP_001001714.1

name	Kcnt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73611942 CCDS:CCDS15794.1 GeneID:227632 MGI:1924627
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0015269 - calcium-activated potassium channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium channel subfamily T member 1 product : potassium channel, subfamily T, member 1 protein_id : NP_780671.2

name	Camsap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249247 GeneID:227634 MGI:3036242
definition	codon_start : 1 product : calmodulin regulated spectrin-associated protein 1 protein_id : XP_980286.2

name	LOC100040100 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249249 GeneID:100040100
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474882.1

name	Ubadc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527050 CCDS:CCDS15795.1 GeneID:98766 MGI:1920995
definition	codon_start : 1 exception : mismatches in translation product : putative glialblastoma cell differentiation-related protein_id : NP_598596.1

name	Btbd14a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:80861479 CCDS:CCDS15796.1 GeneID:67991 MGI:1915241
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : BTB (POZ) domain containing 14A isoform 1 protein_id : NP_080771.3

name	Btbd14a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:80861477 CCDS:CCDS15796.1 GeneID:67991 MGI:1915241
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : BTB (POZ) domain containing 14A isoform 2 protein_id : NP_001032175.1

name	C330006A16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38074580 GeneID:109299 MGI:1924939
definition	codon_start : 1 product : hypothetical protein LOC109299 protein_id : XP_358556.1

name	Lhx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89001116 GeneID:16871 MGI:102673
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : LIM homeo box protein 3 product : LIM homeobox protein 3 protein_id : NP_001034742.1

name	Qscn6l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956334 CCDS:CCDS15798.1 GeneID:227638 MGI:2387194
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0016972 - thiol oxidase activity [Evidence IEA] codon_start : 1 product : quiescin Q6-like 1 protein_id : NP_705787.1

name	C030048H21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249229 GeneID:77481 MGI:1924731
definition	codon_start : 1 product : hypothetical protein LOC77481 protein_id : XP_980491.2

name	4932418E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244424 GeneID:329366 MGI:3045295
definition	codon_start : 1 product : hypothetical protein LOC329366 protein_id : NP_808509.1

name	Gpsm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189378 CCDS:CCDS15800.1 GeneID:67839 MGI:1915089
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : activator of G-protein signaling 3; G-protein signalling modulator 1 (AGS3-like C. elegans) product : G-protein signalling modulator 1 (AGS3-like, C. elegans) protein_id : NP_700459.2

name	D2Bwg1335e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625712 GeneID:52838 MGI:106559
definition	codon_start : 1 product : hypothetical protein LOC52838 protein_id : NP_081104.1

name	Card9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82884282 GeneID:332579 MGI:2685628
definition	codon_start : 1 product : caspase recruitment domain family, member 9 isoform 1 protein_id : XP_285326.4

name	Snapc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27261820 CCDS:CCDS15802.1 GeneID:227644 MGI:2443935
definition	GO_component : GO:0005634 - nucleus [Evidence ISS]; GO:0019185 - snRNA-activating protein complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence ISS] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0042795 - snRNA transcription from RNA polymerase II promoter [Evidence ISS]; GO:0042796 - snRNA transcription from RNA polymerase III promoter [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : small nuclear RNA activating complex, polypeptide 4 protein_id : NP_758842.1

name	Sdccag3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311937 CCDS:CCDS15803.1 GeneID:68112 MGI:1915362
definition	codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : serologically defined colon cancer antigen 3 isoform 1 protein_id : NP_080839.1

name	Pmpca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27502349 CCDS:CCDS15804.1 GeneID:66865 MGI:1918568
definition	EC_number : 3.4.24.64 GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0004240 - mitochondrial processing peptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : mitochondrial matrix processing protease, alpha subunit product : peptidase (mitochondrial processing) alpha protein_id : NP_775272.1

name	Inpp5e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14916467 CCDS:CCDS15805.1 GeneID:64436 MGI:1927753
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IDA]; GO:0004439 - phosphoinositide 5-phosphatase activity [Evidence IDA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : inositol polyphosphate-5-phosphatase, 72 kDa product : inositol polyphosphate-5-phosphatase E protein_id : NP_149125.1

name	AU024582 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378050 GeneID:227648 MGI:2139207
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0004445 - inositol-polyphosphate 5-phosphatase activity [Evidence ISS] codon_start : 1 product : hypothetical protein LOC227648 protein_id : NP_694765.2

name	Notch1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543332 CCDS:CCDS15806.1 GeneID:18128 MGI:97363
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0004623 - phospholipase A2 activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0042640 - anagen [Evidence IMP]; GO:0007409 - axonogenesis [Evidence IDA] [Evidence IMP]; GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IMP]; GO:0045165 - cell fate commitment [Evidence IMP]; GO:0001708 - cell fate specification [Evidence IMP]; GO:0007386 - compartment specification [Evidence IMP]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IGI]; GO:0007492 - endoderm development [Evidence IMP]; GO:0008544 - epidermis development [Evidence IGI]; GO:0001837 - epithelial to mesenchymal transition [Evidence IMP]; GO:0030900 - forebrain development [Evidence IGI] [Evidence IMP]; GO:0007440 - foregut morphogenesis [Evidence IMP]; GO:0010001 - glial cell differentiation [Evidence IMP]; GO:0031069 - hair follicle morphogenesis [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0030216 - keratinocyte differentiation [Evidence IMP]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0030324 - lung development [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0045596 - negative regulation of cell differentiation [Evidence IMP]; GO:0045665 - negative regulation of neuron differentiation [Evidence IMP]; GO:0048663 - neuron fate commitment [Evidence IGI]; GO:0007219 - Notch signaling pathway [Evidence IMP] [Evidence IDA] [Evidence IC]; GO:0043065 - positive regulation of apoptosis [Evidence IGI] [Evidence IDA]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0050793 - regulation of development [Evidence IEA]; GO:0050678 - regulation of epithelial cell proliferation [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048103 - somatic stem cell division [Evidence IGI] [Evidence IDA]; GO:0002040 - sprouting angiogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : major type A protein; transmembrane receptor Notch1 product : Notch gene homolog 1 protein_id : NP_032740.2

name	Egfl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38570123 CCDS:CCDS15807.1 GeneID:353156 MGI:2449923
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence NAS]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0001568 - blood vessel development [Evidence IEP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030336 - negative regulation of cell migration [Evidence IDA]; GO:0001570 - vasculogenesis [Evidence IEP] codon_start : 1 note : isoform 1 precursor is encoded by transcript variant a; vascular endothelial-statin; NEU1 protein product : vascular endothelial statin isoform 1 precursor protein_id : NP_848538.2

name	Egfl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38570125 CCDS:CCDS15807.1 GeneID:353156 MGI:2449923
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence NAS]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0001568 - blood vessel development [Evidence IEP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030336 - negative regulation of cell migration [Evidence IDA]; GO:0001570 - vasculogenesis [Evidence IEP] codon_start : 1 note : isoform 1 precursor is encoded by transcript variant b; vascular endothelial-statin; NEU1 protein product : vascular endothelial statin isoform 1 precursor protein_id : NP_942017.1

name	Egfl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38570127 CCDS:CCDS15808.1 GeneID:353156 MGI:2449923
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence NAS]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0001568 - blood vessel development [Evidence IEP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030336 - negative regulation of cell migration [Evidence IDA]; GO:0001570 - vasculogenesis [Evidence IEP] codon_start : 1 note : isoform 2 precursor is encoded by transcript variant c; vascular endothelial-statin; NEU1 protein product : vascular endothelial statin isoform 2 precursor protein_id : NP_942018.1

name	Agpat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956162 CCDS:CCDS15809.1 GeneID:67512 MGI:1914762
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003841 - 1-acylglycerol-3-phosphate O-acyltransferase activity [Evidence IDA] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008654 - phospholipid biosynthesis [Evidence NAS] [Evidence IEA] codon_start : 1 product : 1-acylglycerol-3-phosphate O-acyltransferase 2 protein_id : NP_080488.1

name	B230317C12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790001 GeneID:56279 MGI:1927576
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy function : expression of this gene product inhibits the growth of E. coli product : hypothetical protein LOC56279 protein_id : NP_062807.1

name	5730588L14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51706052 GeneID:329369 MGI:3045374
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_488938.1

name	5730588L14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249254 GeneID:329369 MGI:3045374
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001475566.1

name	LOC100039446 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249231 GeneID:100039446
definition	codon_start : 1 product : similar to odorant binding protein 2A protein_id : XP_001472954.1

name	Lcn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754516 CCDS:CCDS15810.1 GeneID:16821 MGI:102668
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005550 - pheromone binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 function : transportation of lipophilic molecules, possible pheromone-carrier product : lipocalin 4 protein_id : NP_034825.1

name	Abo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560019 CCDS:CCDS15811.1 GeneID:80908 MGI:2135738
definition	GO_function : GO:0004381 - fucosylgalactoside 3-alpha-galactosyltransferase activity [Evidence IDA]; GO:0004380 - glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase) product : cis-AB transferase protein_id : NP_109643.2

name	Surf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678185 CCDS:CCDS15812.1 GeneID:20935 MGI:98447
definition	GO_component : GO:0001652 - granular component [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA] [Evidence IEA]; GO:0003723 - RNA binding [Evidence IDA] [Evidence IEA] GO_process : GO:0042255 - ribosome assembly [Evidence NAS] codon_start : 1 product : surfeit gene 6 protein_id : NP_033324.1

name	Surf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76781479 CCDS:CCDS15813.1 GeneID:20933 MGI:98446
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : surfeit gene 5 isoform 2 protein_id : NP_001029080.1

name	Surf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755700 CCDS:CCDS15814.1 GeneID:20933 MGI:98446
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : surfeit gene 5 isoform 1 protein_id : NP_035643.1

name	Rpl7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305443 CCDS:CCDS15815.1 GeneID:27176 MGI:1353472
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0042254 - ribosome biogenesis and assembly [Evidence IEA] codon_start : 1 note : surfeit 3 product : ribosomal protein L7a protein_id : NP_038749.1

name	Surf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7363455 GeneID:20930 MGI:98443
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IMP] codon_start : 1 exception : mismatches in translation product : surfeit gene 1 protein_id : NP_038705.1

name	Surf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305529 CCDS:CCDS15816.1 GeneID:20931 MGI:98444
definition	codon_start : 1 product : surfeit gene 2 protein_id : NP_038706.1

name	Surf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755698 CCDS:CCDS15817.1 GeneID:20932 MGI:98445
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : surfeit gene 4 protein_id : NP_035642.1

name	Gm711 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76781472 CCDS:CCDS15818.1 GeneID:279029 MGI:2685557
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : likely ortholog of H. sapiens chromosome 9 open reading frame 96 (C9orf96) product : hypothetical protein LOC279029 protein_id : NP_941030.2

name	Rexo4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76563952 CCDS:CCDS15819.1 GeneID:227656 MGI:2684957
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] codon_start : 1 note : Xenopus prevents mitotic catastrophe 2 homolog product : XPMC2 prevents mitotic catastrophe 2 homolog protein_id : NP_997117.2

name	Adamts13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47604978 CCDS:CCDS15820.1 GeneID:279028 MGI:2685556
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004175 - endopeptidase activity [Evidence IMP] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0007599 - hemostasis [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] [Evidence IDA] codon_start : 1 note : von Willebrand factor-cleaving protease; vWF-CP mRNA for von Willebrand factor-cleaving product : a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13 protein_id : NP_001001322.1

name	5930434B04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037485 GeneID:381356 MGI:1924317
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : likely ortholog of H. sapiens chromosome 9 open reading frame 7 (C9orf7) product : hypothetical protein LOC381356 protein_id : NP_084138.1

name	Slc2a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369954 CCDS:CCDS15822.1 GeneID:227659 MGI:2443286
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 2 (facilitated glucose transporter), member 6 protein_id : NP_766247.1

name	1110002H13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384750 CCDS:CCDS15823.1 GeneID:66139 MGI:1913389
definition	codon_start : 1 product : hypothetical protein LOC66139 protein_id : NP_079652.1

name	Adamtsl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037507 CCDS:CCDS15824.1 GeneID:77794 MGI:1925044
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0031012 - extracellular matrix [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : TSP1-repeats containing protein product : ADAMTS-like 2 protein_id : NP_084257.1

name	C630035N08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425144 GeneID:109349 MGI:1926106
definition	codon_start : 1 product : hypothetical protein LOC109349 protein_id : NP_780636.1

name	Dbh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815861 GeneID:13166 MGI:94864
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0004500 - dopamine beta-monooxygenase activity [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008306 - associative learning [Evidence IMP]; GO:0048149 - behavioral response to ethanol [Evidence IMP]; GO:0001974 - blood vessel remodeling [Evidence IMP]; GO:0042423 - catecholamine biosynthesis [Evidence IEA]; GO:0006584 - catecholamine metabolism [Evidence IEA]; GO:0001816 - cytokine production [Evidence IMP]; GO:0042420 - dopamine catabolism [Evidence IMP]; GO:0042596 - fear response [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0006548 - histidine catabolism [Evidence IEA]; GO:0042309 - homoiothermy [Evidence IMP]; GO:0002443 - leukocyte mediated immunity [Evidence IMP]; GO:0050900 - leukocyte migration [Evidence IMP]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0042711 - maternal behavior [Evidence IMP]; GO:0007613 - memory [Evidence IMP]; GO:0042421 - norepinephrine biosynthesis [Evidence IMP]; GO:0045907 - positive regulation of vasoconstriction [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IMP]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0001975 - response to amphetamine [Evidence IMP]; GO:0048265 - response to pain [Evidence IMP]; GO:0008542 - visual learning [Evidence IMP] codon_start : 1 product : dopamine beta hydroxylase protein_id : NP_620392.2

name	Sardh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149748 CCDS:CCDS15826.1 GeneID:192166 MGI:2183102
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008480 - sarcosine dehydrogenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006546 - glycine catabolism [Evidence IEA] codon_start : 1 product : sarcosine dehydrogenase protein_id : NP_619606.1

name	Vav2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678555 CCDS:CCDS15827.1 GeneID:22325 MGI:102718
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0005154 - epidermal growth factor receptor binding [Evidence IPI]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IMP]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016477 - cell migration [Evidence IGI]; GO:0030031 - cell projection biogenesis [Evidence IGI]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0030032 - lamellipodium biogenesis [Evidence IGI]; GO:0043552 - positive regulation of phosphoinositide 3-kinase activity [Evidence IGI]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IMP] codon_start : 1 product : Vav2 oncogene protein_id : NP_033526.1

name	D2Bwg1423e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249235 GeneID:329372 MGI:106557
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473087.1

name	Brd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981064 CCDS:CCDS15828.1 GeneID:67382 MGI:1914632
definition	codon_start : 1 exception : mismatches in translation note : bromodomain-containing 3 product : bromodomain containing 3 protein_id : NP_075825.2

name	Wdr5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252790 CCDS:CCDS15829.1 GeneID:140858 MGI:2155884
definition	GO_component : GO:0005622 - intracellular [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001501 - skeletal development [Evidence IDA] codon_start : 1 note : Bmp2-induced product : WD repeat domain 5 protein_id : NP_543124.1

name	Rxra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755384 CCDS:CCDS15830.1 GeneID:20181 MGI:98214
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IPI] [Evidence ISS] [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : RXR alpha 1 product : retinoid X receptor alpha protein_id : NP_035435.1

name	LOC665199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665199
definition	number : 2 pseudo : _no_value

name	LOC665199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665199
definition	number : 1 pseudo : _no_value

name	LOC669582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669582
definition	number : 5 pseudo : _no_value

name	LOC669582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669582
definition	number : 4 pseudo : _no_value

name	LOC669582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669582
definition	number : 3 pseudo : _no_value

name	LOC669582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669582
definition	number : 2 pseudo : _no_value

name	LOC669582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669582
definition	number : 1 pseudo : _no_value

name	LOC665315 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249257 GeneID:665315
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to ribosomal protein L6 pseudo : _no_value transcript_id : XR_032494.1

clone name	MSMg01-418O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344O05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-531M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101D18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-217G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095O04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-427B21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-264J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365H21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472F17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-350G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498P09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-383E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174L07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-341O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044C19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-289D23.b	B6Ng01-289D23.g
ACC	GA086702	GA086703
length	1,084	294
definition	B6Ng01-289D23.b	B6Ng01-289D23.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(26,633,121 - 26,634,141)	(26,463,286 - 26,463,579)
sequence	gaattctataaaatcattaattaatctaaacagaattattacatgaaagt acatctttatattgattctgcaggaaatctgcccaacagcatgggttaaa acccaggaaacagtaggttatgccagatgtgtgagggatacagcaatggc atgcacatcagaagcaagaagcaatcctgggataaagttcctgggatcta tgcctattcagagcacacacatcacagctatgcaaaattatgagccatct ccaggaagctcacttgcttgccacagcctttccttcattgctctcacaac ttagttggaacgtgggcacaaagaattactgatgtctacaattcccctgc acacttaactccctgggaagcctggctggctttattccatcagtagagca tcatggggtttagacagtggacaggatggaccccattcagagcatctcct gttggaggagtctcaggtcaataatttgtcccttcatggtgtttgcccta gctgagaagaaagaagagattcatataaacagatggtatttcacaggtaa ggcagtggcattaagttcaggggctgtggcaattggtaggagttcttacc aaagccaaatggctaccaaatttgggaaaatttacatgatggtaagaaaa acatgatgtctatatagataaatcaaatgttgtttaaaaccaatgttaat accctcacaaactgtacaatccattgaacaattacttggttcaataatcc cttatcttttctagtccccacccctctgtcttatgttgtgttatctctcc ggttttgttgtggtacatctctgacttgtgttgtgttttattttgaagct tccaccccacccaaaattttcactacaaataacattagagacagtcactc caatgacacccctcctttataaaaagaaaaggaggaactgtgggacaatg gccatgccaggaaacttggtaagatagagtgggtctgagacctagaaaat cagtgggtacacactgagatgtatgtgtatccctgctctcaacatgggtc agttcacatagtcaaaacagagtttttcatgcta	ttgttgtgctcctgaactattgggtgggggtaggggtacatgtaggggtg ctgtgaccccaccttggagagagaagaggcaagactgaagcctggggtgg gacccgagacagagtaggagtgccctctgtgagtcttattctcactggtg ggacactctgggggttttgactccttaaggggaactcagagtagaggcaa ctggaagataaagaaaaggaggaggaagaggagaaggaggaggataaaga agaaaggaaggaggagcagagtggggagaaggagtgggaaggac
quality values	Open. Hide. 58 33 27 31 62 62 62 62 62 52 62 62 62 47 39 37 62 62 62 62 62 54 62 62 54 62 62 62 62 62 44 43 34 33 28 29 43 45 46 46 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 47 62 62 62 49 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 54 42 62 62 62 62 62 62 62 62 58 52 58 54 54 41 58 58 54 58 58 58 58 58 58 58 54 58 58 54 58 58 54 58 54 58 58 54 52 54 58 54 58 58 54 58 58 58 52 58 54 54 58 58 54 40 54 58 54 58 54 58 58 54 54 58 58 58 58 58 58 58 58 58 58 54 58 58 54 54 58 46 54 58 42 58 58 50 58 58 53 54 54 49 42 47 48 58 58 52 58 46 50 58 48 51 58 51 49 58 52 48 38 42 58 58 53 58 58 58 58 58 58 58 58 50 39 58 49 50 50 48 58 58 39 49 58 44 42 51 58 46 58 49 58 58 41 49 53 51 58 39 47 58 51 51 41 47 53 42 53 53 52 51 40 50 58 50 53 52 43 49 44 51 58 37 51 49 35 58 47 39 58 58 50 40 49 29 50 50 58 50 40 50 38 53 52 40 31 41 51 50 50 51 41 58 50 50 50 51 47 41 44 37 38 49 42 37 35 49 50 47 39 54 40 49 39 50 40 45 53 53 39 54 53 52 40 32 40 54 53 53 54 50 54 54 54 42 52 54 38 53 31 54 54 25 34 37 43 37 31 41 54 54 52 42 38 54 54 54 46 53 37 41 33 30 33 32 38 39 53 31 46 47 32 46 33 32 45 40 42 42 52 42 34 39 17 26 9 53 49 40 47 33 32 47 32 21 25 31 32 32 24 34 32 52 31 31 31 31 20 30 51 31 42 45 35 42 30 29 41 21 46 51 33 36 31 51 51 34 23 33 37 29 33 37 31 24 31 31 31 46 46 27 27 21 41 31 21 46 46 30 18 46 46 23 31 25 32 31 31 31 13 46 46 26 24 42 30 25 32 42 27 10 44 30 32 27 26 30 31 34 34 38 41 25 36 7 31 21 31 31 32 25 28 32 32 27 39 30 31 34 48 42 32 21 21 48 47 44 25 8 25 48 48 27 24 18 28 10 11 23 20 25 32 32 23 31 44 29 31 13 9 31 22 14 11 5 8 28 32 23 20 18 21 23 11 24 37 19 31 19 27 12 26 21 22 25 23 22 10 21 14 31 17 26 31 48 29 22 32 32 21 28 7 19 10 12 32 6 6 24 48 48 34 14 21 32 27 11 17 34 27 26 11 10 15 17 5 11 5 9 23 9 27 8 14 3 9 18 16 16 28 9 9 9 13 32 17 8 14 19 10 19 4 6 6 7 8 6 21 6 30 14 24 23 6 3 4 9 16 7 5 7 11 9 5 5 14 13 25 28 7 6 4 4 21 6 17 25 29 17 22 10 10 11 18 18 18 23	Open. Hide. 43 35 28 28 28 29 35 35 32 54 62 62 62 62 54 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 56 62 49 42 56 62 62 62 62 62 59 49 59 59 59 59 43 59 59 62 59 59 51 59 44 59 56 62 62 62 62 49 62 51 59 51 43 50 51 59 49 56 62 59 59 59 62 62 62 62 56 62 62 62 62 62 62 59 59 62 62 59 59 54 54 59 51 49 59 43 46 56 41 59 54 40 56 62 59 62 62 59 59 59 59 59 59 59 59 59 59 56 62 62 62 62 62 62 62 49 59 59 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 56 51 56 59 46 59 49 59 62 59 56 59 59 59 62 59 59 62 59 59 59 59 51 51 62 51 51 59 43 59 51 59 59 56 59 59 59 62 56 49 51 34 59 51 50 50 50 48 59 59 59 59 51 62 62 49 62 59 51 59 59 51 49 62 56 59 54 59 62 59 59 62 59 49 59 59 51 59 59 59 34 41 34 24 43 41 41 62 59 59 56 62 59 59 51 62 62 56 62 59 51 59 59 43 59 43 59 59 44 56 46 44 51 59 59 50 62 51 51 39 51 31 32 50 44 24 51 32 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_26633121_26634141
seq2: B6Ng01-289D23.b_112_1128 (reverse)

seq1  TAGCATGAAAAACTCTGTTTTGGACTATGTGACCTGACCAATGTGAGGAG  50
      ||||||||||||||||||||| |||||||||| |||||| ||||   |||
seq2  TAGCATGAAAAACTCTGTTTT-GACTATGTGAACTGACCCATGTTGAGAG  49

seq1  CAGGGATACACATACCATCTCAGGTGTGTACCCACTGATTTTCTAAGGTC  100
      |||||||||||||| ||||||| ||||||||||||||||||||| |||||
seq2  CAGGGATACACATA-CATCTCA-GTGTGTACCCACTGATTTTCT-AGGTC  96

seq1  TCAGACCCACTCTATCTTACCAAGTTTCCTGGCATGGCCCATTGTCCCAC  150
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  TCAGACCCACTCTATCTTACCAAGTTTCCTGGCATGG-CCATTGTCCCAC  145

seq1  AGTTCCTCCTTTTCTTTTTATAAAGGAGGGGTGTCATTGGAGTGACTGTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCCTCCTTTTCTTTTTATAAAGGAGGGGTGTCATTGGAGTGACTGTC  195

seq1  TCTAATGTTATTTGTAGTGAAAATTTTGGGTGGGGTGGAAGCTTCAAAAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAATGTTATTTGTAGTGAAAATTTTGGGTGGGGTGGAAGCTTCAAAAT  245

seq1  AAAACACAACACAAGTCAGAGATGTACCACAACAAAACCGGAGAGATAAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACACAACACAAGTCAGAGATGTACCACAACAAAACCGGAGAGATAAC  295

seq1  ACAACATAAGACAGAGGGGTGGGGACTAG-AAAGATAAGGGATTATTGAA  349
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  ACAACATAAGACAGAGGGGTGGGGACTAGAAAAGATAAGGGATTATTGAA  345

seq1  CCAAGTAATTGTTCAATGGATTGTACAGTTTGTGAGGGTATTAACATTGG  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGTAATTGTTCAATGGATTGTACAGTTTGTGAGGGTATTAACATTGG  395

seq1  TTTTAAACAACATTTGATTTATCTATATAGACATCATGTTTTTCTTACCA  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAAACAACATTTGATTTATCTATATAGACATCATGTTTTTCTTACCA  445

seq1  TCATGTAAATTTTCCCAAATTTGGTAGCCATTTGGCTTTGGTAAGAACTC  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGTAAATTTTCCCAAATTTGGTAGCCATTTGGCTTTGGTAAGAACTC  495

seq1  CTACCAATTGCCACAGCCCCTGAACTTAATGCCACTGCCTTACCTGTGAA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCAATTGCCACAGCCCCTGAACTTAATGCCACTGCCTTACCTGTGAA  545

seq1  ATACCATCTGTTTATATGAATCTCTTCTTTCTTCTCAGCTAGGGCAAACA  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACCATCTGTTTATATGAATCTCTTCTTTCTTCTCAGCTAGGGCAAACA  595

seq1  CCATGAAGGGACAAATTATTGACCTGAGACTCCTCCAACAGGAGATGCTC  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGAAGGGACAAATTATTGACCTGAGACTCCTCCAACAGGAGATGCTC  645

seq1  TGAATGGGGTCCATCCTGTCCACTGTCTAAACCCCATGATGCTCTACTGA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATGGGGTCCATCCTGTCCACTGTCTAAACCCCATGATGCTCTACTGA  695

seq1  TGGAATAAAGCCAGCCAGGCTTCCCAGGGAGTTAAGTGTGCAGGGGAATT  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAATAAAGCCAGCCAGGCTTCCCAGGGAGTTAAGTGTGCAGGGGAATT  745

seq1  GTAGACATCAGTAATTCTTTGTGCCCACGTTCCAACTAAGTTGTGAGAGC  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGACATCAGTAATTCTTTGTGCCCACGTTCCAACTAAGTTGTGAGAGC  795

seq1  AATGAAGGAAAGGCTGTGGCAAGCAAGTGAGCTTCCTGGAGATGGCTCAT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAAGGAAAGGCTGTGGCAAGCAAGTGAGCTTCCTGGAGATGGCTCAT  845

seq1  AATTTTGCATAGCTGTGATGTGTGTGCTCTGAATAGGCATAGATCCCAGG  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTTGCATAGCTGTGATGTGTGTGCTCTGAATAGGCATAGATCCCAGG  895

seq1  AACTTTATCCCAGGATTGCTTCTTGCTTCTGATGTGCATGCCATTGCTGT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTTATCCCAGGATTGCTTCTTGCTTCTGATGTGCATGCCATTGCTGT  945

seq1  ATCCCTCACACATCTGGCATAACCTACTGTTTCCTGGGTTTTAACCCATG  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCCTCACACATCTGGCATAACCTACTGTTTCCTGGGTTTTAACCCATG  995

seq1  CTGTTGGGCAGATTTCCTGCAG  1021
      ||||||||||||||||||||||
seq2  CTGTTGGGCAGATTTCCTGCAG  1017

seq1: chr2_26463286_26463579
seq2: B6Ng01-289D23.g_79_372

seq1  TTGTTGTGCTCCTGAACTATTGGGTGGGGGTAGGGGTACATGTAGGGGTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTGTGCTCCTGAACTATTGGGTGGGGGTAGGGGTACATGTAGGGGTG  50

seq1  CTGTGACCCCACCTTGGAGAGAGAAGAGGCAAGACTGAAGCCTGGGGTGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGACCCCACCTTGGAGAGAGAAGAGGCAAGACTGAAGCCTGGGGTGG  100

seq1  GACCCGAGACAGAGTAGGAGTGCCCTCTGTGAGTCTTATTCTCACTGGTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCCGAGACAGAGTAGGAGTGCCCTCTGTGAGTCTTATTCTCACTGGTG  150

seq1  GGACACTCTGGGGGTTTTGACTCCTTAAGGGGAACTCAGAGTAGAGGCAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACACTCTGGGGGTTTTGACTCCTTAAGGGGAACTCAGAGTAGAGGCAA  200

seq1  CTGGAAGATAAAGAAAAGGAGGAGGAAGAGGAGAAGGAGGAGGATAAAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGAAGATAAAGAAAAGGAGGAGGAAGAGGAGAAGGAGGAGGATAAAGA  250

seq1  AGAAAGGAAGGAGGAGCAGAGTGGGGAGAAGGAGTGGGAAGGAC  294
      ||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAGGAAGGAGGAGCAGAGTGGGGAGAAGGAGTGGGAAGGAC  294

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information