MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-293A14
Chromosome	2 (Build37)
Map Location	36,132,468 - 36,133,237
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Gsn, Stom, LOC654354, 4930568D16Rik, 4930402F06Rik, Ggta1, LOC666042, LOC100042194, Dab2ip, Ttll11, Ndufa8, 1700010A17Rik, Lhx6, Rbm18, LOC100042236, Mrrf, LOC100040493, Ptgs1
Downstream gene	Olfr334-ps1, Olfr335, Olfr336-ps1, Olfr337-ps1, Olfr338, LOC675440, Olfr339, Olfr340, Olfr341, Olfr342, Olfr343-ps1, Olfr344, Olfr345, Olfr346, Olfr347, Olfr348, Olfr50, Rpl18p, Olfr3, Olfr349-ps1, Olfr350, Olfr351, Olfr352, Olfr353, Olfr354, Olfr355, Olfr356, Olfr357, Olfr358, Olfr359-ps1, Olfr360, Olfr361, Olfr362, Olfr364-ps1, Olfr365, Olfr366, Olfr367
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gsn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227753 MGI:95851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stom (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13830 MGI:95403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC654354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654354
definition	note : glyoxalase 1 pseudogene pseudo : _no_value

name	4930568D16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75859 MGI:1923109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 Proteins

name	4930402F06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74854 MGI:1922104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggta1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14594 MGI:95704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666042 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100042194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Dab2ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69601 MGI:1916851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttll11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74410 MGI:1921660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufa8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68375 MGI:1915625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700010A17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75495 MGI:1922745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lhx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16874 MGI:1306803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Rbm18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67889 MGI:1915139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042236 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Mrrf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67871 MGI:1915121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040493 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ptgs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19224 MGI:97797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr334-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257991 MGI:3030168
definition	gene_synonym : MOR137-1P note : olfactory receptor 334, pseudogene 1 pseudo : _no_value

name	Olfr335 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666118 MGI:3030169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr336-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258093 MGI:3030170
definition	gene_synonym : MOR136-15P note : olfactory receptor 336, pseudogene 1 pseudo : _no_value

name	Olfr337-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258092 MGI:3030171
definition	gene_synonym : MOR136-16P note : olfactory receptor 337, pseudogene 1 pseudo : _no_value

name	Olfr338 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258949 MGI:3030172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675440 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 656 ESTs, 7 Proteins

name	Olfr339 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258951 MGI:3030173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr340 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258953 MGI:3030174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258952 MGI:3030175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr342 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258950 MGI:3030176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr343-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404379 MGI:3030177
definition	note : olfactory receptor 343, pseudogene 1 pseudo : _no_value

name	Olfr344 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258621 MGI:3030178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr345 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258947 MGI:3030179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr346 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258940 MGI:3030180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258945 MGI:3030181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr348 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258946 MGI:3030182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18350 MGI:1333746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl18p (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624088
definition	note : similar to 60S ribosomal protein L18 pseudo : _no_value

name	Olfr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18328 MGI:102697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr349-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257999 MGI:3030183
definition	gene_synonym : MOR136-17P note : olfactory receptor 349, pseudogene 1 pseudo : _no_value

name	Olfr350 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258620 MGI:3030184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr351 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258944 MGI:3030185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr352 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258942 MGI:3030186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr353 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258943 MGI:3030187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr354 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258941 MGI:3030188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr355 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258618 MGI:3030189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr356 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258617 MGI:3030190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr357 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258616 MGI:3030191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr358 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227789 MGI:3030192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr359-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258091 MGI:3030193
definition	gene_synonym : MOR159-2P note : olfactory receptor 359, pseudogene 1 pseudo : _no_value

name	Olfr360 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258615 MGI:3030194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr361 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258365 MGI:3030195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr362 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259053 MGI:3030196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr364-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227794 MGI:3030198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2100 Proteins pseudo : _no_value

name	Olfr365 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258656 MGI:3030199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr366 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236509 MGI:3030200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr367 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545417 MGI:3030201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130216 GeneID:227753 MGI:95851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gelsolin transcript_id : NM_146120.3

name	Stom (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129913 GeneID:13830 MGI:95403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stomatin transcript_id : NM_013515.2

name	4930568D16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366402 GeneID:75859 MGI:1923109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 Proteins product : RIKEN cDNA 4930568D16 gene transcript_id : XM_130220.4

name	4930402F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123959717 GeneID:74854 MGI:1922104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930402F06 gene transcript_id : NM_001080709.1

name	Ggta1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369425 GeneID:14594 MGI:95704
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein galactosyltransferase alpha 1, 3 transcript_id : NM_010283.2

name	LOC100042194 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249294 GeneID:100042194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042194 transcript_id : XM_001479211.1

name	Dab2ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48675374 GeneID:69601 MGI:1916851
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : disabled homolog 2 (Drosophila) interacting protein transcript_id : NM_001001602.1

name	Ttll11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625990 GeneID:74410 MGI:1921660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 11 transcript_id : NM_028921.1

name	Ndufa8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893199 GeneID:68375 MGI:1915625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8 transcript_id : NM_026703.2

name	1700010A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130578 GeneID:75495 MGI:1922745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700010A17 gene transcript_id : NM_029309.2

name	Lhx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893072 GeneID:16874 MGI:1306803
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 6 transcript_id : NM_001083125.1

name	Lhx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891793 GeneID:16874 MGI:1306803
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 6 transcript_id : NM_008500.2

name	Lhx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892050 GeneID:16874 MGI:1306803
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 6 transcript_id : NM_001083127.1

name	Lhx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892445 GeneID:16874 MGI:1306803
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 6 transcript_id : NM_001083126.1

name	Rbm18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377962 GeneID:67889 MGI:1915139
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 18 transcript_id : NM_026434.3

name	LOC100042236 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249296 GeneID:100042236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100042236 transcript_id : XM_001479253.1

name	Mrrf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312751 GeneID:67871 MGI:1915121
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosome recycling factor transcript_id : NM_026422.1

name	LOC100040493 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249255 GeneID:100040493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040493 transcript_id : XM_001474797.1

name	Ptgs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227245 GeneID:19224 MGI:97797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin-endoperoxide synthase 1 transcript_id : NM_008969.3

name	Olfr335 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487172 GeneID:666118 MGI:3030169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 335 transcript_id : NM_001081410.1

name	Olfr338 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129020 GeneID:258949 MGI:3030172
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 338 transcript_id : NM_146947.1

name	LOC675440 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249298 GeneID:675440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 656 ESTs, 6 Proteins product : similar to SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae), transcript variant 1 transcript_id : XM_001479274.1

name	LOC675440 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249300 GeneID:675440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 350 ESTs, 2 Proteins product : similar to SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae), transcript variant 2 transcript_id : XM_001479282.1

name	Olfr339 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129016 GeneID:258951 MGI:3030173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 339 transcript_id : NM_146949.1

name	Olfr340 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129018 GeneID:258953 MGI:3030174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 340 transcript_id : NM_146951.1

name	Olfr341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203812 GeneID:258952 MGI:3030175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 341 transcript_id : NM_146950.1

name	Olfr342 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129022 GeneID:258950 MGI:3030176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 342 transcript_id : NM_146948.1

name	Olfr344 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239293 GeneID:258621 MGI:3030178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 344 transcript_id : NM_146628.1

name	Olfr345 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239289 GeneID:258947 MGI:3030179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 345 transcript_id : NM_146945.1

name	Olfr346 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129032 GeneID:258940 MGI:3030180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 346 transcript_id : NM_146938.1

name	Olfr347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129026 GeneID:258945 MGI:3030181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 347 transcript_id : NM_146943.1

name	Olfr348 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239291 GeneID:258946 MGI:3030182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 348 transcript_id : NM_146944.1

name	Olfr50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170059 GeneID:18350 MGI:1333746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 50 transcript_id : NM_146946.1

name	Olfr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170067 GeneID:18328 MGI:102697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 3 transcript_id : NM_206903.1

name	Olfr350 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239295 GeneID:258620 MGI:3030184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 350 transcript_id : NM_146627.1

name	Olfr351 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129024 GeneID:258944 MGI:3030185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 351 transcript_id : NM_146942.1

name	Olfr352 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129028 GeneID:258942 MGI:3030186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 352 transcript_id : NM_146940.1

name	Olfr353 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129030 GeneID:258943 MGI:3030187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 353 transcript_id : NM_146941.1

name	Olfr354 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129034 GeneID:258941 MGI:3030188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 354 transcript_id : NM_146939.1

name	Olfr355 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239287 GeneID:258618 MGI:3030189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 355 transcript_id : NM_146625.1

name	Olfr356 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239307 GeneID:258617 MGI:3030190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 356 transcript_id : NM_146624.1

name	Olfr357 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239281 GeneID:258616 MGI:3030191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 357 transcript_id : NM_146623.1

name	Olfr358 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402224 GeneID:227789 MGI:3030192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 358 transcript_id : NM_207235.1

name	Olfr360 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239255 GeneID:258615 MGI:3030194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 360 transcript_id : NM_146622.1

name	Olfr361 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129562 GeneID:258365 MGI:3030195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 361 transcript_id : NM_146368.1

name	Olfr362 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128848 GeneID:259053 MGI:3030196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 362 transcript_id : NM_147051.1

name	Olfr365 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239285 GeneID:258656 MGI:3030199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 365 transcript_id : NM_146662.1

name	Olfr366 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53933205 GeneID:236509 MGI:3030200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 366 transcript_id : NM_001005569.1

name	Olfr367 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486589 GeneID:545417 MGI:3030201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 367 transcript_id : NM_001081010.1

name	Gsn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916693 CCDS:CCDS15960.1 GeneID:227753 MGI:95851
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005829 - cytosol [Evidence ISS]; GO:0005576 - extracellular region [Evidence ISS]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence ISS] GO_process : GO:0030041 - actin filament polymerization [Evidence ISS]; GO:0051014 - actin filament severing [Evidence ISS]; GO:0051016 - barbed-end actin filament capping [Evidence ISS]; GO:0016192 - vesicle-mediated transport [Evidence IMP] codon_start : 1 product : gelsolin protein_id : NP_666232.2

name	Stom (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710018 CCDS:CCDS15961.1 GeneID:13830 MGI:95403
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : protein 7.2b product : erythrocyte protein band 7.2 protein_id : NP_038543.1

name	4930568D16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82884425 GeneID:75859 MGI:1923109
definition	codon_start : 1 product : hypothetical protein LOC75859 protein_id : XP_130220.3

name	4930402F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123959718 GeneID:74854 MGI:1922104
definition	codon_start : 1 product : hypothetical protein LOC74854 protein_id : NP_001074178.1

name	Ggta1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753982 CCDS:CCDS15964.1 GeneID:14594 MGI:95704
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0047276 - N-acetyllactosaminide 3-alpha-galactosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glycoprotein alpha galactosyl transferase 1; alpha Gal product : glycoprotein galactosyltransferase alpha 1, 3 protein_id : NP_034413.1

name	LOC100042194 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249295 GeneID:100042194
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479261.1

name	Dab2ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48675375 CCDS:CCDS15965.1 GeneID:69601 MGI:1916851
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : DAB2-interacting protein protein_id : NP_001001602.1

name	Ttll11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625991 GeneID:74410 MGI:1921660
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : polyglutamylase product : tubulin tyrosine ligase-like family, member 11 protein_id : NP_083197.1

name	Ndufa8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312012 CCDS:CCDS15967.1 GeneID:68375 MGI:1915625
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8 protein_id : NP_080979.1

name	1700010A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037413 CCDS:CCDS15968.1 GeneID:75495 MGI:1922745
definition	codon_start : 1 note : novel protein containing MORN domains product : hypothetical protein LOC75495 protein_id : NP_083585.1

name	Lhx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133893073 GeneID:16874 MGI:1306803
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; LIM-homeodomain protein 6.1 product : LIM homeobox protein 6 isoform 2 protein_id : NP_001076594.1

name	Lhx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892051 GeneID:16874 MGI:1306803
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; LIM-homeodomain protein 6.1 product : LIM homeobox protein 6 isoform 4 protein_id : NP_001076596.1

name	Lhx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133891794 GeneID:16874 MGI:1306803
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; LIM-homeodomain protein 6.1 product : LIM homeobox protein 6 isoform 1 protein_id : NP_032526.2

name	Lhx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892446 GeneID:16874 MGI:1306803
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; LIM-homeodomain protein 6.1 product : LIM homeobox protein 6 isoform 3 protein_id : NP_001076595.1

name	Rbm18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385930 CCDS:CCDS15969.1 GeneID:67889 MGI:1915139
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein 18 protein_id : NP_080710.1

name	LOC100042236 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249297 GeneID:100042236
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479303.1

name	Mrrf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312752 GeneID:67871 MGI:1915121
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] codon_start : 1 product : mitochondrial ribosome recycling factor protein_id : NP_080698.1

name	LOC100040493 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249256 GeneID:100040493
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474847.1

name	Ptgs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679537 CCDS:CCDS15970.1 GeneID:19224 MGI:97797
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IEA]; GO:0004666 - prostaglandin-endoperoxide synthase activity [Evidence IEA] GO_process : GO:0008217 - blood pressure regulation [Evidence IMP]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0001516 - prostaglandin biosynthesis [Evidence IMP] codon_start : 1 note : cyclooxygenase 1 product : prostaglandin-endoperoxide synthase 1 protein_id : NP_032995.1

name	Olfr335 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487173 GeneID:666118 MGI:3030169
definition	codon_start : 1 note : GA_x6K02T2NLDC-33001193-33002131; olfactory receptor W1UHSO2293FU.01 product : olfactory receptor 335 protein_id : NP_001074879.1

name	Olfr338 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129021 CCDS:CCDS15971.1 GeneID:258949 MGI:3030172
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33070879-33071799; olfactory receptor MOR136-5 product : olfactory receptor 338 protein_id : NP_667158.1

name	LOC675440 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249299 GeneID:675440
definition	codon_start : 1 product : similar to SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) isoform 1 protein_id : XP_001479324.1

name	LOC675440 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249301 GeneID:675440
definition	codon_start : 1 product : similar to SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) isoform 2 protein_id : XP_001479332.1

name	Olfr339 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129017 CCDS:CCDS15972.1 GeneID:258951 MGI:3030173
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33116096-33117025; olfactory receptor MOR136-3 product : olfactory receptor 339 protein_id : NP_667160.1

name	Olfr340 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129019 CCDS:CCDS15973.1 GeneID:258953 MGI:3030174
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33147742-33148680; olfactory receptor MOR136-1 product : olfactory receptor 340 protein_id : NP_667162.1

name	Olfr341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203813 CCDS:CCDS15974.1 GeneID:258952 MGI:3030175
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33174915-33173974; olfactory receptor MOR136-2 product : olfactory receptor 341 protein_id : NP_667161.1

name	Olfr342 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129023 CCDS:CCDS15975.1 GeneID:258950 MGI:3030176
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33222024-33222962; olfactory receptor MOR136-4 product : olfactory receptor 342 protein_id : NP_667159.1

name	Olfr344 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239294 CCDS:CCDS15976.1 GeneID:258621 MGI:3030178
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33262744-33263673; olfactory receptor MOR136-12 product : olfactory receptor 344 protein_id : NP_666839.1

name	Olfr345 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239290 CCDS:CCDS15977.1 GeneID:258947 MGI:3030179
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33334179-33335114; olfactory receptor MOR136-7 product : olfactory receptor 345 protein_id : NP_667156.1

name	Olfr346 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129033 CCDS:CCDS15978.1 GeneID:258940 MGI:3030180
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33382467-33383396; olfactory receptor MOR136-11 product : olfactory receptor 346 protein_id : NP_667149.1

name	Olfr347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129027 CCDS:CCDS15979.1 GeneID:258945 MGI:3030181
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33428755-33429693; olfactory receptor MOR136-9 product : olfactory receptor 347 protein_id : NP_667154.1

name	Olfr348 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239292 CCDS:CCDS15980.1 GeneID:258946 MGI:3030182
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33481050-33481991; olfactory receptor MOR136-8 product : olfactory receptor 348 protein_id : NP_667155.1

name	Olfr50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170060 CCDS:CCDS15981.1 GeneID:18350 MGI:1333746
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR136-6; GA_x6K02T2NLDC-33487752-33488690 product : olfactory receptor 50 protein_id : NP_667157.1

name	Olfr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170068 CCDS:CCDS15982.1 GeneID:18328 MGI:102697
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33507606-33506665; olfactory receptor MOR136-14 product : olfactory receptor 3 protein_id : NP_996786.1

name	Olfr350 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239296 CCDS:CCDS15983.1 GeneID:258620 MGI:3030184
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33544602-33545540; olfactory receptor MOR136-13 product : olfactory receptor 350 protein_id : NP_666838.1

name	Olfr351 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129025 CCDS:CCDS15984.1 GeneID:258944 MGI:3030185
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33554926-33553994; olfactory receptor MOR127-2 product : olfactory receptor 351 protein_id : NP_667153.1

name	Olfr352 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129029 CCDS:CCDS15985.1 GeneID:258942 MGI:3030186
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33564136-33565083; olfactory receptor MOR136-10 product : olfactory receptor 352 protein_id : NP_667151.1

name	Olfr353 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129031 CCDS:CCDS15986.1 GeneID:258943 MGI:3030187
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33585366-33584431; olfactory receptor MOR127-3 product : olfactory receptor 353 protein_id : NP_667152.1

name	Olfr354 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129035 CCDS:CCDS15987.1 GeneID:258941 MGI:3030188
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33601476-33602429; olfactory receptor MOR127-4 product : olfactory receptor 354 protein_id : NP_667150.1

name	Olfr355 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239288 CCDS:CCDS15988.1 GeneID:258618 MGI:3030189
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33622642-33621710; olfactory receptor MOR138-2 product : olfactory receptor 355 protein_id : NP_666836.1

name	Olfr356 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239308 CCDS:CCDS15989.1 GeneID:258617 MGI:3030190
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33631647-33632594; olfactory receptor MOR134-1 product : olfactory receptor 356 protein_id : NP_666835.1

name	Olfr357 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239282 CCDS:CCDS15990.1 GeneID:258616 MGI:3030191
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33688556-33689482; olfactory receptor MOR138-3 product : olfactory receptor 357 protein_id : NP_666834.1

name	Olfr358 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402225 CCDS:CCDS15991.1 GeneID:227789 MGI:3030192
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2NLDC-33697309-33696317 product : olfactory receptor 358 protein_id : NP_997118.1

name	Olfr360 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239256 CCDS:CCDS15992.1 GeneID:258615 MGI:3030194
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33760081-33761034; olfactory receptor MOR159-1 product : olfactory receptor 360 protein_id : NP_666833.1

name	Olfr361 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129563 CCDS:CCDS15993.1 GeneID:258365 MGI:3030195
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33777519-33776551; olfactory receptor MOR159-3 product : olfactory receptor 361 protein_id : NP_666480.1

name	Olfr362 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128849 CCDS:CCDS15994.1 GeneID:259053 MGI:3030196
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33797415-33796462; olfactory receptor MOR158-1 product : olfactory receptor 362 protein_id : NP_667262.1

name	Olfr365 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239286 CCDS:CCDS15995.1 GeneID:258656 MGI:3030199
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33885305-33886243; olfactory receptor MOR138-1 product : olfactory receptor 365 protein_id : NP_666873.1

name	Olfr366 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53933206 CCDS:CCDS15996.1 GeneID:236509 MGI:3030200
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33902472-33903401; olfactory receptor MOR138-5P product : olfactory receptor 366 protein_id : NP_001005569.1

name	Olfr367 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486590 GeneID:545417 MGI:3030201
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004984 - olfactory receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33954853-33955794; olfactory receptor MOR128-1 product : olfactory receptor 367 protein_id : NP_001074479.1

name	LOC666042 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666042
definition	number : 1 pseudo : _no_value

name	Olfr364-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:227794
definition	number : 1 pseudo : _no_value

name	Olfr364-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:227794
definition	number : 2 pseudo : _no_value

name	Olfr364-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:227794
definition	number : 3 pseudo : _no_value

clone name	MSMg01-408O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337P13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159K18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-476P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362H01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-453G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020O11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-293A14.b	B6Ng01-293A14.g
ACC	GA089517	GA089518
length	1,241	776
definition	B6Ng01-293A14.b	B6Ng01-293A14.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcagtaggaattcagtaagaaggttacctattcagtaacattcaaa tttacttctagtagagacagtgaaactaattaggcattacaaagaacaga gccagaatagctcagggctggtctgcagtgtttacttgagacaatagcca gtcttacccagagaagggaattcacaatggcctagtgaataggtgggttt accatgaaagagttagggaattcccctgagacaggtttcttcactaggcc caaagaaatcaggcatttactaagaaaccctggtggtgggcttaacaata gactaacattacacctggctctcttcttagtggcagcagcctggtcccac cttcttttgatgtatacattccttaagttttgtgtcactgtaactcattg gatgtatctcgcctggtttcttgttattgttctgtataaaaagttcgatg ctcgacttgacaaattacattcagattctacacaacctcttgtgttgcgt ctatttgtcatttgccaactccttgtccatctgcaaccagagacccatcc tacccagacaagggaccaagagggtctgcggcaaggagtaaacagtaaaa aataatcaaactctggactgaaatcaacaaagtagaaacaaagagaccaa tacaaagaatcatggaaacaaagagttgggttttaaggtcccaggaatca atgaagaaagacgcaagactcaaaagtatgcaaaagtaaagagcatttat tctgcagaaacaaacaatatgcaagagtcagccatttattcaaaattgca acctcaaaataagcttgcaggctgcattttagttcacctaggaaattttt caggatggttagttcatttttgatatgattagataagtaacagcaattat attagtgcatttgtaatttgtcattatatttgtttaatcatttttggtct gtctttagaagaagtttcaggtactgtctcagttccttggactggttatc actctcagctaaaacaggaccatttctgattaatggtctattttctctct gggtgtgtgatgtgtgggggtgggtatttgtaggagccttacttgctctt gagaaaagtgctaacatccactcgagttgtggactatgcatgacaaagac cttgtgagcgtgtctgaatctcatggaagaatctccagaaacttaaccct cctgggaactatggtacattccactacgcgatcgagagtgc	gaattcacattcaataatatacagagctagagttgcagatggatgaggct tctaggtagcagagagtcagcaataaacatgagctctaaatagtatcatt aaataagagtgatcttatactaaaccatttcttccaagctaggcattgtt agaatgaaagggtctgttttgtactccatctgctttatagtcaattgctt catggcttggttaggacattttgaaaataacaatcaacttagactacttt ccctttgaaattcacataggaagttcaggcacagagagaatgctaacgaa gacaatccacatttccaagctatactcatgcctagcattgttaggaaatc tgagtaataaggaattcagaagtatgctttagtttatattttggaaggta acctagcaaaagggtttaagagcacaaactctaggatccgagtttgaatc ctagttccttattcaccatatggatcttaaacatattattttacttcttg ttgattctgtcatttctcttgtacagtttagtggggtggtatggaaggta aatgtactgatgaacataaattattcaatacagcatctggcatgttgaaa atagtatgttttaccattgtcatttgaacagattctgcgtgtgattctct atccctaagagatggaatgtgttgcataaagtggatatttaagaagattt tcttggctcgggtgacagtattaattaatgcagtgaaagaagttgaggtt tggattgagaaaagttaattagtact
quality values	Open. Hide. 58 33 35 26 58 32 23 58 58 58 52 58 54 47 39 62 41 31 62 62 62 62 62 62 62 62 47 42 62 62 47 46 24 27 27 27 27 16 21 27 45 46 38 33 44 62 59 51 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 59 59 62 59 59 56 42 56 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 59 59 59 62 62 62 62 59 62 62 54 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 49 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 56 56 59 59 56 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 56 62 56 62 62 62 56 56 43 56 51 56 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 56 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 47 40 52 52 52 62 52 46 47 43 43 38 43 52 62 62 62 62 52 52 54 62 52 48 58 41 42 41 52 52 37 52 52 46 40 52 48 52 52 52 42 54 52 52 52 58 58 52 45 39 54 49 52 58 58 47 58 58 58 52 52 48 52 42 53 54 54 54 54 58 58 54 58 50 52 54 54 52 52 54 58 58 58 58 58 54 42 58 58 54 54 40 52 52 52 54 54 58 54 51 51 42 49 54 58 58 54 54 50 48 50 51 38 49 58 51 53 58 50 50 50 50 49 39 50 58 52 49 46 37 43 47 50 40 41 41 40 33 39 58 51 58 41 40 50 52 52 58 51 50 50 28 50 30 46 50 53 53 52 41 54 50 58 58 32 58 58 32 48 50 33 58 31 40 49 50 46 50 48 43 35 41 39 51 50 49 54 51 50 34 58 38 27 39 53 33 34 50 33 33 42 39 29 53 50 32 58 58 49 52 53 41 39 47 39 31 37 58 50 38 39 28 54 54 40 51 37 41 31 39 49 53 35 51 39 42 52 37 30 52 29 52 32 23 35 31 32 40 41 34 38 52 34 30 36 32 29 49 23 51 24 37 28 37 27 29 39 24 35 31 42 40 45 42 25 21 54 54 21 19 54 34 40 28 32 33 35 40 26 13 54 46 31 34 26 18 19 30 18 42 40 41 32 30 52 37 40 34 31 26 32 45 49 30 37 33 53 26 24 22 15 23 32 40 31 43 43 52 21 18 52 52 53 33 24 11 11 46 41 22 31 51 26 31 43 31 29 29 31 29 31 51 51 51 31 29 39 33 32 34 34 39 28 31 34 28 33 20 27 28 27 31 31 28 32 28 26 29 22 36 16 25 30 31 31 31 33 41 20 31 42 31 32 34 46 28 38 23 30 34 21 46 32 46 16 34 30 38 29 31 24 31 30 46 31 37 21 46 30 28 44 30 32 27 31 48 47 46 32 36 30 20 36 24 41 29 28 21 46 31 29 16 20 20 14 31 35 18 31 47 21 31 11 27 24 21 23 31 24 35 13 15 13 23 31 13 22 11 25 22 22 30 28 21 31 27 24 24 29 13 18 28 32 21 20 20 23 26 25 27 21 16 27 19 29 41 33 15 14 10 19 14 32 20 23 10 13 21 9 21 8 27 33 13 25 22 31 9 34 26 5 20 11 32 11 48 39 12 12 5 12 6 23 12 28 9 18 6 24 9 27 5 9 4 7 30 7 30 6 12 5 6 6 13 6 14 13 16 10 6 16 11 27 7 3 3 3 3 21 4 9 17 6 7 6 13 8 9 13 11 12 5 5 3 5 13 6 4 10 34 7 8 9 28 16 12 8 6 12 7 11 12 10 5 18 7 7 5 6 5 5 5 1 3 11 8 18 7 6 11 7 13 5 9 10 8 14 9 12 18 5 6 7 6 12 5 6 23 6 4 17 6 7 5 3 3 4 5 11 15 8 10 8 7 4 5 2 4 12 3 3 2 1 3 3 3 1 2 1 3 3 2 7 15 11 18 22 7 9 4 7 12 4 5 8 6 9 14 21 8 18 11 11 4 7 7 5 12 3 3 6 6 6 3 2 2 3 3 7 15 2 3 3 6 10 7 7 7 5 1 3 5 4 3 3	Open. Hide. 62 47 51 44 62 59 41 62 59 62 34 36 20 23 25 27 25 32 43 36 49 37 54 56 54 62 62 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 59 62 62 62 62 62 59 62 51 62 40 48 48 56 56 50 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 54 54 62 54 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 54 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 56 62 54 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 52 58 54 58 54 54 58 58 58 58 44 46 42 54 58 58 46 58 46 37 54 42 54 41 39 46 51 43 50 52 52 41 46 33 49 53 39 49 50 41 37 33 46 37 34 33 47 48 43 49 50 49 46 38 37 50 48 48 33 37 46 47 50 58 39 36 43 42 46 49 52 53 51 50 50 46 46 33 29 27 28 35 36 19 19 15 27 50 21 32 50 38 50 41 37 32 39 52 52 52 58 39 28 32 46 40 39 43 37 38 39 37 36 12 21 13 9 16 18 36 50 50 33 21 10 18 9 10 15 31 25 23 29 6 11 9 32 39 31 35 37 21 21 17 30 25 29 15 21 13 12 15 14 28 23 25 21 15 12 6 49 28 33 9 15 14 11 13 18 16 24 27 17 13 15 16 21 28 29 28 8 15 14 25 14 32 14 12 14 9 13 16 13 26 21 19 6 13 19 11 17 10 10 13 15 18 31 25 16 9 6 16 24 25 19 18 16 22 8 22 12 31 9 15 23 16 14 9 16 10 9 6 12 10 9 7 6 13 14 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_36132468_36133237
seq2: B6Ng01-293A14.g_67_842

seq1  GAATTCACATTCAATAATATACAGAGCTAGAGTTGCAGATGGATGAGGCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACATTCAATAATATACAGAGCTAGAGTTGCAGATGGATGAGGCT  50

seq1  TCTAGGTAGCAGAGAGTCAGCAATAAACATGAGCTCTAAATAGTATCATT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAGGTAGCAGAGAGTCAGCAATAAACATGAGCTCTAAATAGTATCATT  100

seq1  AAATAAGAGTGATCTTATACTAAACCATTTCTTCCAAGCTAGGCATTGTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAGAGTGATCTTATACTAAACCATTTCTTCCAAGCTAGGCATTGTT  150

seq1  AGAATGAAAGGGTCTGTTTTGTACTCCATCTGCTTTATAGTCAATTGCTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATGAAAGGGTCTGTTTTGTACTCCATCTGCTTTATAGTCAATTGCTT  200

seq1  CATGGCTTGGTTAGGACATTTTGAAAATAACAATCAACTTAGACTACTTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGCTTGGTTAGGACATTTTGAAAATAACAATCAACTTAGACTACTTT  250

seq1  CCCTTTGAAATTCACATAGGAAGTTCAGGCACAGAGAGAATGCTAACGAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTTGAAATTCACATAGGAAGTTCAGGCACAGAGAGAATGCTAACGAA  300

seq1  GACAATCCACATTTCCAAGCTATACTCATGCCTAGCATTGTTAGGAAATC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAATCCACATTTCCAAGCTATACTCATGCCTAGCATTGTTAGGAAATC  350

seq1  TGAGTAATAAGGAATTCAGAAGTATGCTTTAGTTTATATTTTGGAAGGTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTAATAAGGAATTCAGAAGTATGCTTTAGTTTATATTTTGGAAGGTA  400

seq1  ACCTAGCAAAAGGGTTTAAGAGCACAAACTCTAGGATCCGAGTTTGAATC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTAGCAAAAGGGTTTAAGAGCACAAACTCTAGGATCCGAGTTTGAATC  450

seq1  CTAGTTCCTTATTCACCATATGGATCTTAAACATATTATTTTACTTCTTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGTTCCTTATTCACCATATGGATCTTAAACATATTATTTTACTTCTTG  500

seq1  TTGATTCTGTCATTTCTCTTGTACAGTTTAGTGGGGTGGTATGGAAGGTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATTCTGTCATTTCTCTTGTACAGTTTAGTGGGGTGGTATGGAAGGTA  550

seq1  AATGTACTGATGAACATAAATTATTCAATACAGCATCTGGCATGTTGAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTACTGATGAACATAAATTATTCAATACAGCATCTGGCATGTTGAAA  600

seq1  ATAGTATGTTTTACCATTGTCA-TTGAACAGATTCTGCGTGTGATTCTCT  649
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  ATAGTATGTTTTACCATTGTCATTTGAACAGATTCTGCGTGTGATTCTCT  650

seq1  ATCCCTAAGAGATGGAATGTGTTGCATAAAGTGGATATTTAAGAAGATTT  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCCTAAGAGATGGAATGTGTTGCATAAAGTGGATATTTAAGAAGATTT  700

seq1  TCTT-GCTC-GGTGACAGTATTAATTAATGCAGTGAAAGAAGTTGAGG-T  746
      |||| |||| |||||||||||||||||||||||||||||||||||||| |
seq2  TCTTGGCTCGGGTGACAGTATTAATTAATGCAGTGAAAGAAGTTGAGGTT  750

seq1  TGGA-TGAGAAAAG-TAATTAGTACT  770
      |||| ||||||||| |||||||||||
seq2  TGGATTGAGAAAAGTTAATTAGTACT  776

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information