MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-314F01
Chromosome	2 (Build37)
Map Location	29,413,119 - 29,444,398
singlet/doublet	doublet
Overlap gene	none
Upstream gene	Cel, Gtf3c5, Gfi1b, Tsc1, 1700026L06Rik, 1190002A17Rik, LOC665643, Gtf3c4, Ddx31, Barhl1, LOC100033452, 1700101E01Rik, LOC100039666, Ttf1, Setx, Ntng2, Crsp8
Downstream gene	Rapgef1, LOC433415, OTTMUSG00000012686, Trub2, Coq4, Slc27a4, Urm1, LOC100041002, Ceecam1, Odf2, Gle1l, Spna2, LOC665532, Wdr34, Set, Pkn3, Zdhhc12, Zer1, LOC100041114, Tbc1d13, Slc39a1-ps, Endog, D2Wsu81e, Ccbl1, 1700084E18Rik, Lrrc8a, Phyhd1, Dolk, Nup188, Sh3glb2, 5730472N09Rik, Dolpp1, Crat, Ppp2r4, Ier5l
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cel (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12613 MGI:88374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtf3c5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70239 MGI:1917489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfi1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14582 MGI:1276578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64930 MGI:1929183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700026L06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69987 MGI:1917237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190002A17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68870 MGI:1916120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665643 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665643
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Gtf3c4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269252 MGI:2138937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227674 MGI:2682639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Barhl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54422 MGI:1859288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100033452 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100033452
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	1700101E01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329375 MGI:2685669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	LOC100039666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ttf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22130 MGI:105044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Setx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269254 MGI:2443480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ntng2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171171 MGI:2159341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Crsp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68975 MGI:1916225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rapgef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107746 MGI:104580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC433415 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	OTTMUSG00000012686 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433416 MGI:3650473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trub2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227682 MGI:2442186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coq4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227683 MGI:1098826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc27a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26569 MGI:1347347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Urm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68205 MGI:1915455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Ceecam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99151 MGI:2139134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Odf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18286 MGI:1098824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gle1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74412 MGI:1921662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spna2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20740 MGI:98386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665532 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs

name	Wdr34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71820 MGI:1919070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Set (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56086 MGI:1860267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:263803 MGI:2388285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66220 MGI:1913470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zer1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227693 MGI:2442511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Tbc1d13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70296 MGI:2385326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a1-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194642 MGI:3615375
definition	gene_synonym : Slc39a1p note : solute carrier family 39 (zinc transporter), member 1, pseudogene pseudo : _no_value

name	Endog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13804 MGI:1261433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D2Wsu81e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227695 MGI:106544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccbl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70266 MGI:1917516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700084E18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67350 MGI:1914600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs

name	Lrrc8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241296 MGI:2652847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phyhd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227696 MGI:3612860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dolk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227697 MGI:2677836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup188 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227699 MGI:2446190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3glb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227700 MGI:2385131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730472N09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108958 MGI:1922035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dolpp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57170 MGI:1914093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12908 MGI:109501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110854 MGI:1346006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ier5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72500 MGI:1919750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cel (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753405 GeneID:12613 MGI:88374
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxyl ester lipase transcript_id : NM_009885.1

name	Gtf3c5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22507322 GeneID:70239 MGI:1917489
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor IIIC, polypeptide 5 transcript_id : NM_148928.1

name	Gfi1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328121 GeneID:14582 MGI:1276578
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor independent 1B transcript_id : NM_008114.2

name	Tsc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922702 GeneID:64930 MGI:1929183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tuberous sclerosis 1 transcript_id : NM_022887.3

name	1700026L06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037188 GeneID:69987 MGI:1917237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700026L06 gene transcript_id : NM_027283.1

name	1190002A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76443657 GeneID:68870 MGI:1916120
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190002A17 gene transcript_id : NM_001033874.1

name	Gtf3c4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385912 GeneID:269252 MGI:2138937
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor IIIC, polypeptide 4 transcript_id : NM_172977.2

name	Ddx31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802168 GeneID:227674 MGI:2682639
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31 transcript_id : NM_001033294.2

name	Barhl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346452 GeneID:54422 MGI:1859288
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BarH-like 1 (Drosophila) transcript_id : NM_019446.3

name	1700101E01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366337 GeneID:329375 MGI:2685669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : RIKEN cDNA 1700101E01 gene, transcript variant 1 transcript_id : XM_986644.1

name	Ttf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111154069 GeneID:22130 MGI:105044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription termination factor 1 transcript_id : NM_009442.2

name	Setx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113722130 GeneID:269254 MGI:2443480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : senataxin transcript_id : NM_198033.2

name	Ntng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19424139 GeneID:171171 MGI:2159341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : netrin G2 transcript_id : NM_133500.1

name	Ntng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281647 GeneID:171171 MGI:2159341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : netrin G2 transcript_id : NM_133501.1

name	Crsp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386722 GeneID:68975 MGI:1916225
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 8 transcript_id : NM_026896.2

name	Rapgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875505 GeneID:107746 MGI:104580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF) 1 transcript_id : NM_001039087.1

name	Rapgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875507 GeneID:107746 MGI:104580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF) 1 transcript_id : NM_054050.2

name	Rapgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875503 GeneID:107746 MGI:104580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF) 1 transcript_id : NM_001039086.1

name	LOC433415 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94366325 GeneID:433415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to NG5 protein transcript_id : XM_484985.3

name	OTTMUSG00000012686 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360716 GeneID:433416 MGI:3650473
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000012686 transcript_id : NM_001034887.2

name	Trub2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803129 GeneID:227682 MGI:2442186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TruB pseudouridine (psi) synthase homolog 2 (E. coli) transcript_id : NM_145520.3

name	Coq4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365161 GeneID:227683 MGI:1098826
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coenzyme Q4 homolog (yeast) transcript_id : NM_178693.3

name	Slc27a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374126 GeneID:26569 MGI:1347347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 27 (fatty acid transporter), member 4 transcript_id : NM_011989.2

name	Urm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365925 GeneID:68205 MGI:1915455
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin related modifier 1 homolog (S. cerevisiae) transcript_id : NM_026615.3

name	LOC100041002 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249261 GeneID:100041002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100041002 transcript_id : XM_001477254.1

name	Ceecam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131058 GeneID:99151 MGI:2139134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cerebral endothelial cell adhesion molecule 1 transcript_id : NM_207298.2

name	Odf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129797 GeneID:18286 MGI:1098824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : outer dense fiber of sperm tails 2 transcript_id : NM_013615.2

name	Gle1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130556 GeneID:74412 MGI:1921662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GLE1 RNA export mediator-like (yeast transcript_id : NM_028923.2

name	Spna2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115496849 GeneID:20740 MGI:98386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spectrin alpha 2 transcript_id : NM_001076554.1

name	LOC665532 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94366329 GeneID:665532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs product : hypothetical LOC665532 transcript_id : XM_977598.1

name	Wdr34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948826 GeneID:71820 MGI:1919070
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 34 transcript_id : NM_001008498.2

name	Set (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130684 GeneID:56086 MGI:1860267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET translocation transcript_id : NM_023871.3

name	Pkn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418928 GeneID:263803 MGI:2388285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase N3 transcript_id : NM_153805.1

name	Zdhhc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649750 GeneID:66220 MGI:1913470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 12 transcript_id : NM_001037762.1

name	Zdhhc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649754 GeneID:66220 MGI:1913470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 12 transcript_id : NM_025428.2

name	Zer1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542270 GeneID:227693 MGI:2442511
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zer-1 homolog (C. elegans) transcript_id : NM_178694.3

name	LOC100041114 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249267 GeneID:100041114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100041114 transcript_id : XM_001477522.1

name	Tbc1d13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368502 GeneID:70296 MGI:2385326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 13 transcript_id : NM_146252.2

name	Endog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679646 GeneID:13804 MGI:1261433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endonuclease G transcript_id : NM_007931.1

name	D2Wsu81e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801856 GeneID:227695 MGI:106544
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 2, Wayne State University 81, expressed transcript_id : NM_172660.2

name	Ccbl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982062 GeneID:70266 MGI:1917516
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine conjugate-beta lyase 1 transcript_id : NM_172404.2

name	1700084E18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366331 GeneID:67350 MGI:1914600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs product : RIKEN cDNA 1700084E18 gene transcript_id : XM_977942.1

name	Lrrc8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62388880 GeneID:241296 MGI:2652847
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 8A transcript_id : NM_177725.3

name	Phyhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62388881 GeneID:227696 MGI:3612860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phytanoyl-CoA dioxygenase domain containing 1 transcript_id : NM_172267.2

name	Dolk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930710 GeneID:227697 MGI:2677836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dolichol kinase transcript_id : NM_177648.3

name	Nup188 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38678525 GeneID:227699 MGI:2446190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 188 transcript_id : NM_198304.2

name	Sh3glb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314837 GeneID:227700 MGI:2385131
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-domain GRB2-like endophilin B2 transcript_id : NM_139302.1

name	5730472N09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982182 GeneID:108958 MGI:1922035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730472N09 gene transcript_id : NM_175392.3

name	Dolpp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384824 GeneID:57170 MGI:1914093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dolichyl pyrophosphate phosphatase 1 transcript_id : NM_020329.2

name	Crat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198337 GeneID:12908 MGI:109501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carnitine acetyltransferase transcript_id : NM_007760.3

name	Ppp2r4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350306 GeneID:110854 MGI:1346006
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2A, regulatory subunit B (PR 53) transcript_id : NM_138748.3

name	Ier5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508419 GeneID:72500 MGI:1919750
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immediate early response 5-like transcript_id : NM_030244.3

name	Cel (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753406 CCDS:CCDS15841.1 GeneID:12613 MGI:88374
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0004104 - cholinesterase activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA]; GO:0004771 - sterol esterase activity [Evidence IEA]; GO:0004806 - triacylglycerol lipase activity [Evidence IEA] GO_process : GO:0046514 - ceramide catabolism [Evidence IMP]; GO:0006707 - cholesterol catabolism [Evidence ISS]; GO:0009062 - fatty acid catabolism [Evidence ISS]; GO:0044258 - intestinal lipid catabolism [Evidence ISS]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0018350 - protein amino acid esterification [Evidence ISS] codon_start : 1 product : carboxyl ester lipase protein_id : NP_034015.1

name	Gtf3c5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507323 CCDS:CCDS15842.1 GeneID:70239 MGI:1917489
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TFIIICepsilon product : general transcription factor III polypeptide 5 protein_id : NP_683730.1

name	Gfi1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679991 CCDS:CCDS15843.1 GeneID:14582 MGI:1276578
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : growth factor independent 1B protein_id : NP_032140.1

name	Tsc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:79750409 CCDS:CCDS15844.1 GeneID:64930 MGI:1929183
definition	codon_start : 1 product : tuberous sclerosis 1 protein_id : NP_075025.2

name	1700026L06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037189 CCDS:CCDS15845.1 GeneID:69987 MGI:1917237
definition	codon_start : 1 product : Rsb-66 protein protein_id : NP_081559.1

name	1190002A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76443658 CCDS:CCDS15846.1 GeneID:68870 MGI:1916120
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0019201 - nucleotide kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68870 protein_id : NP_001029046.1

name	Gtf3c4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370486 CCDS:CCDS15847.1 GeneID:269252 MGI:2138937
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004402 - histone acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : general transcription factor IIIC, polypeptide 4 protein_id : NP_766565.1

name	Ddx31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677496 CCDS:CCDS15848.1 GeneID:227674 MGI:2682639
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31 protein_id : NP_001028466.1

name	Barhl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506423 CCDS:CCDS15849.1 GeneID:54422 MGI:1859288
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0001764 - neuron migration [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : transcription factor product : BarH-like 1 protein_id : NP_062319.1

name	1700101E01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366338 GeneID:329375 MGI:2685669
definition	codon_start : 1 product : similar to FLJ46082 protein isoform 1 protein_id : XP_991738.1

name	Ttf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111154070 GeneID:22130 MGI:105044
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003716 - RNA polymerase I transcription termination factor activity [Evidence IDA] GO_process : GO:0006338 - chromatin remodeling [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006361 - transcription initiation from RNA polymerase I promoter [Evidence IDA] codon_start : 1 product : transcription termination factor 1 protein_id : NP_033468.2

name	Setx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113722131 GeneID:269254 MGI:2443480
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : amyotrophic lateral sclerosis 4 homolog product : senataxin protein_id : NP_932150.2

name	Ntng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19424140 CCDS:CCDS15851.1 GeneID:171171 MGI:2159341
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant a; laminet 2 product : netrin G2 isoform a protein_id : NP_598007.1

name	Ntng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281648 CCDS:CCDS15852.1 GeneID:171171 MGI:2159341
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant b; laminet 2 product : netrin G2 isoform b protein_id : NP_598008.1

name	Crsp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76253678 CCDS:CCDS15853.1 GeneID:68975 MGI:1916225
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0003713 - transcription coactivator activity [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence ISS] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcriptional co-activator CRSP8 homolog protein_id : NP_081172.2

name	Rapgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875506 GeneID:107746 MGI:104580
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence TAS] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0048008 - platelet-derived growth factor receptor signaling pathway [Evidence IMP]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; guanine nucleotide releasing factor 2 product : Rap guanine nucleotide exchange factor (GEF) 1 isoform 1 protein_id : NP_001034176.1

name	Rapgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905083 CCDS:CCDS15854.1 GeneID:107746 MGI:104580
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence TAS] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0048008 - platelet-derived growth factor receptor signaling pathway [Evidence IMP]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; guanine nucleotide releasing factor 2 product : Rap guanine nucleotide exchange factor (GEF) 1 isoform 3 protein_id : NP_473391.1

name	Rapgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875504 GeneID:107746 MGI:104580
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence TAS] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0048008 - platelet-derived growth factor receptor signaling pathway [Evidence IMP]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; guanine nucleotide releasing factor 2 product : Rap guanine nucleotide exchange factor (GEF) 1 isoform 2 protein_id : NP_001034175.1

name	LOC433415 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94366326 GeneID:433415
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484985.3

name	OTTMUSG00000012686 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702238 GeneID:433416 MGI:3650473
definition	codon_start : 1 product : hypothetical protein LOC433416 protein_id : NP_001030059.1

name	Trub2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560759 CCDS:CCDS15856.1 GeneID:227682 MGI:2442186
definition	codon_start : 1 exception : mismatches in translation product : TruB pseudouridine (psi) synthase homolog 2 protein_id : NP_663495.2

name	Coq4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520093 CCDS:CCDS15857.1 GeneID:227683 MGI:1098826
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : coenzyme Q4 homolog protein_id : NP_848808.1

name	Slc27a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45597453 CCDS:CCDS15858.1 GeneID:26569 MGI:1347347
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0001676 - long-chain fatty acid metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fatty acid transport protein 4 product : solute carrier family 27 (fatty acid transporter), member 4 protein_id : NP_036119.1

name	Urm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311875 CCDS:CCDS15859.1 GeneID:68205 MGI:1915455
definition	codon_start : 1 product : ubiquitin related modifier 1 homolog protein_id : NP_080891.1

name	LOC100041002 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249262 GeneID:100041002
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477304.1

name	Ceecam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46411176 CCDS:CCDS15860.1 GeneID:99151 MGI:2139134
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007155 - cell adhesion [Evidence ISS] codon_start : 1 product : cerebral endothelial cell adhesion molecule 1 protein_id : NP_997181.1

name	Odf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305339 CCDS:CCDS15861.1 GeneID:18286 MGI:1098824
definition	GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence TAS] codon_start : 1 note : cenexin product : outer dense fiber of sperm tails 2 protein_id : NP_038643.1

name	Gle1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037369 CCDS:CCDS15862.1 GeneID:74412 MGI:1921662
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0016973 - poly(A)+ mRNA export from nucleus [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : GLE1 RNA export mediator-like (yeast protein_id : NP_083199.1

name	LOC665532 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94366330 GeneID:665532
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982692.1

name	Spna2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115496850 GeneID:20740 MGI:98386
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA] codon_start : 1 note : alpha-spectrin 2, brain; alpha-fodrin product : spectrin alpha 2 protein_id : NP_001070022.1

name	Wdr34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948827 CCDS:CCDS15865.1 GeneID:71820 MGI:1919070
definition	codon_start : 1 product : WD repeat domain 34 protein_id : NP_001008498.2

name	Set (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13591862 CCDS:CCDS15866.1 GeneID:56086 MGI:1860267
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] codon_start : 1 product : SET translocation protein_id : NP_076360.1

name	Pkn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418929 CCDS:CCDS15867.1 GeneID:263803 MGI:2388285
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein kinase N3 protein_id : NP_722500.1

name	Zdhhc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649751 CCDS:CCDS15868.1 GeneID:66220 MGI:1913470
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; zinc finger DHHC domain containing 12 product : zinc finger, DHHC domain containing 12 isoform b protein_id : NP_001032851.1

name	Zdhhc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649755 CCDS:CCDS15869.1 GeneID:66220 MGI:1913470
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; zinc finger DHHC domain containing 12 product : zinc finger, DHHC domain containing 12 isoform a protein_id : NP_079704.2

name	Zer1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542271 CCDS:CCDS15870.1 GeneID:227693 MGI:2442511
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : zyg-11 homolog B (C. elegans)-like protein_id : NP_848809.2

name	LOC100041114 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249268 GeneID:100041114
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477572.1

name	Tbc1d13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122839 CCDS:CCDS15871.1 GeneID:70296 MGI:2385326
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : TBC1 domain family member 13 product : TBC1 domain family, member 13 protein_id : NP_666364.1

name	Endog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679647 CCDS:CCDS15872.1 GeneID:13804 MGI:1261433
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : endonuclease G protein_id : NP_031957.1

name	D2Wsu81e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369948 CCDS:CCDS15873.1 GeneID:227695 MGI:106544
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC227695 protein_id : NP_766248.1

name	Ccbl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982063 CCDS:CCDS15874.1 GeneID:70266 MGI:1917516
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0047804 - cysteine-S-conjugate beta-lyase activity [Evidence IEA]; GO:0047316 - glutamine-phenylpyruvate transaminase activity [Evidence IEA]; GO:0016212 - kynurenine-oxoglutarate transaminase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] codon_start : 1 note : kynurenine aminotransferase I; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase) product : cysteine conjugate-beta lyase 1 protein_id : NP_765992.2

name	1700084E18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366332 GeneID:67350 MGI:1914600
definition	codon_start : 1 product : hypothetical protein LOC67350 protein_id : XP_983036.1

name	Lrrc8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244192 CCDS:CCDS15875.1 GeneID:241296 MGI:2652847
definition	codon_start : 1 product : leucine-rich repeat-containing 8 protein_id : NP_808393.1

name	Phyhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986561 CCDS:CCDS15876.1 GeneID:227696 MGI:3612860
definition	codon_start : 1 product : phytanoyl-CoA dioxygenase domain containing 1 protein_id : NP_758471.1

name	Dolk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244058 CCDS:CCDS15877.1 GeneID:227697 MGI:2677836
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004605 - phosphatidate cytidylyltransferase activity [Evidence IEA] GO_process : GO:0008654 - phospholipid biosynthesis [Evidence IEA] codon_start : 1 product : transmembrane protein 15 protein_id : NP_808316.1

name	Nup188 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38678526 CCDS:CCDS15878.1 GeneID:227699 MGI:2446190
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA] codon_start : 1 product : nucleoporin 188 protein_id : NP_938046.2

name	Sh3glb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314838 CCDS:CCDS15879.1 GeneID:227700 MGI:2385131
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : SH3-containing protein SH3GLB2 product : SH3-domain GRB2-like endophilin B2 protein_id : NP_647463.1

name	5730472N09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425102 CCDS:CCDS15880.1 GeneID:108958 MGI:1922035
definition	codon_start : 1 note : mFLJ00199 protein product : hypothetical protein LOC108958 protein_id : NP_780601.1

name	Dolpp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9966770 CCDS:CCDS15881.1 GeneID:57170 MGI:1914093
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047874 - dolichyldiphosphatase activity [Evidence IDA] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006487 - protein amino acid N-linked glycosylation [Evidence IDA] codon_start : 1 function : expression of this gene product inhibits the growth of E. coli product : dolichyl pyrophosphate phosphatase 1 protein_id : NP_065062.1

name	Crat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662408 CCDS:CCDS15882.1 GeneID:12908 MGI:109501
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004092 - carnitine O-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : carnitine acetyltransferase protein_id : NP_031786.2

name	Ppp2r4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981677 CCDS:CCDS15883.1 GeneID:110854 MGI:1346006
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence ISS]; GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0008601 - protein phosphatase type 2A regulator activity [Evidence ISS] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence ISS] codon_start : 1 exception : mismatches in translation product : protein phosphatase 2A, regulatory subunit B (PR 53) protein_id : NP_620087.2

name	Ier5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508420 GeneID:72500 MGI:1919750
definition	codon_start : 1 product : immediate early response 5-like protein_id : NP_084520.3

name	LOC665643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665643
definition	number : 1 pseudo : _no_value

name	LOC100039666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039666
definition	number : 1 pseudo : _no_value

clone name	MSMg01-149I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483A05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-130J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-266H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-358B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225M02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-314F01.b	B6Ng01-314F01.g
ACC	GA105284	GA105285
length	1,127	1,030
definition	B6Ng01-314F01.b	B6Ng01-314F01.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(29,443,269 - 29,444,398)	(29,413,119 - 29,414,151)
sequence	gaattcagaaatccacctgcctctgcctcccaagtgctgggattaaaggt gtgcgccaccactgcctggctgctccctttctttatatcttccctacctc cccatcacatagctgttcatcatggtggtgcccaccatccaggaccatgg tgggcaggccctgggttgtcttcctcctcctcttcctcctcctccctctc ctttcccttaggtaacctgcgcccgccccccctgccccatcaatgcattc ttgttggggattcttagattctgtgcccactgctatgattctcccctgaa acaaggcaatggagctgcggttcccacttctcgaagactctgttcctctc aggagcttttgatggctgctttaagcttgaacataccagactggcttctg tatcccacccagacgccctgcagtctctggtcttgcacccctcccccagc tttgctgtccaccccctaccccattgccttctgtcagctgtgctgaccat agacactccacatccttccacctttcccaaataccaccaggaagcccttc cacggcagccctcaccatttaataaatgaattctgttcttcccgtgcaac acaggcatgcctatctggggccattgtgtagcctgggctggcactgaacc agagcgatcctactgcaacttccagactgctgggatgatgggaggaagcc agggtgcctggcctatgattcatctgacttattttagaatgatatctagt ttctatgtggtgttagggatggactttggggacttgtgtatgccaggaaa acaatacttgatgagacattctttgctttgagcacaaaaccgtcagtgtg tccatttaaataaacaaactaacaaaaaaccaagattttactttttagcc caggctagcctggaactcactatacatcattgagggtagcccttgaactt gtgactgtcctgcctatcagccctctgggtctgtggtggttacagttaga gccatttacactcagtttaaaaagtagaaacttttaacgatttttaaaaa aacctgttatgatctttgtgagttccatcaatgcaactcaatccacccat ctcccatctctcagatctccctatacc	gaattcacagctgctggggggctcatgaattatgcacagtcccagatcaa cccatcagctactgtcagggaggaatcaaaggccctgtgatgggtgacag ccttctgtggcacctagaaccctttgcaagagtcctgatgtcaccagatc ctgtagttctccgatctctacccctcccagatggccctctctctgtttca atgccaggtgcgggtctgatggactggaaggggacctcaacaacaaaaag cctggcccatgttttctgagttcgttccgaaatgctcaggctgaataatt gatggcagcactatatttgtgagggaaatgtcaccttgggtatagctaca gcatcgaagcttcctttggtcaagtcacacttggtagtggattcttgtaa tcccagggtgggggtggtagggtagaagcagtaagatcaggtgttcaggg tcagcctcaactacatagagagttcaaggacagacttggctaggtgagac ctctgtccagggtgtgtgaaggatccacacaagtaaagataaactgagcc acaaaacagggaatgaatctagacacaggtactctcctgcccagaatgca gtggggcaaccccactgtcacaggggcagaattatcccaaaccactcatt acagataaggaaaagttcatcgagggaggactggagggctgactgtgaaa gtgctcagaggagatagaagatgggacgtggaaaatagtgtcacccatac ctcaggcaaaatgattccccacataccgtcacacacgtggaatggcccag ctctcgtgacacaatggcttctcaggtaaccagccccatcctgaagccat tagggtaccagccactagccacagtagggcatactcaagaaagtctgccc agaccagagacttcaggagtctctgaatgtcaggacagggactgagaccc cttggaatctaaatgtctatgttctcagtcatatatattataaagtttac gcgcgcacacaacacacatgcacagagaca
quality values	Open. Hide. 58 34 27 29 62 39 20 43 62 62 43 39 62 37 39 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 35 44 62 62 59 62 56 59 62 62 54 54 38 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 49 54 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 49 42 54 62 62 59 62 62 62 59 62 62 62 59 62 54 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 56 59 56 38 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 49 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 49 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 36 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 54 46 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 52 54 58 58 58 58 58 58 46 49 58 58 58 58 58 54 58 58 58 58 58 41 58 58 54 58 58 58 58 58 58 58 52 58 58 58 58 58 52 58 58 58 58 58 53 53 53 51 58 58 58 49 58 52 58 58 54 54 58 58 51 47 58 58 58 58 58 58 58 53 58 52 58 58 58 58 58 48 50 51 52 53 58 51 37 58 48 50 58 58 58 58 58 50 58 58 58 58 49 58 58 50 58 50 47 51 49 50 58 52 58 50 44 58 51 58 58 58 54 50 58 58 42 53 49 58 51 38 44 50 53 53 52 58 32 58 51 58 50 51 58 53 53 49 49 58 42 51 51 52 58 49 50 49 38 39 51 32 49 54 51 54 54 54 54 35 27 54 46 31 51 33 42 28 20 54 44 54 39 53 53 39 50 49 49 38 54 49 54 47 46 47 42 54 53 53 52 46 53 40 51 42 40 52 53 47 51 37 26 52 53 52 35 36 54 42 45 31 54 51 33 53 53 33 46 32 52 33 41 34 52 52 47 40 29 53 47 51 53 51 47 32 51 32 42 41 25 49 40 31 29 47 46 33 31 23 49 16 28 46 52 33 27 22 32 31 41 32 51 31 31 30 30 31 43 40 17 43 46 51 51 45 31 30 31 45 31 31 31 27 33 31 29 32 51 21 29 27 31 38 42 32 36 47 22 30 31 42 47 46 32 42 20 31 31 31 28 46 46 46 27 38 31 30 31 31 31 30 32 29 36 31 31 32 33 31 47 37 33 48 37 41 31 46 39 31 23 46 39 31 28 29 39 30 26 47 47 46 46 32 27 37 24 31 26 19 15 44 48 44 21 31 32 44 47 43 25 32 31 38 41 21 20 25 38 34 42 32 21 31 24 19 31 25 26 26 26 31 31 31 32 32 30 32 27 32 19 32 32 30 22 30 32 31 11 47 23 20 34 23 8 43 7 19 11 19 19 24 16 19 12 21 22 27 26 24 32 34 23 14 25 16 20 20 20 21 25 28 27 28 15 19 30 9 27 15 6 13 28 11 8 27 24 27 20 28 27 14 19 16 6 5 11 19 24 6 14 7 26 10 20 13 13 20 15 7 34 8 27 28 17 20 27 28 25 8 13 30 6 28 40 40 38 25 16 13 24 20 15 17 17 18 11 28 17 12 5 11 5 3 5 14 28 29 28 16 11 25 26 27 30 28 15 9 15 6 3 5 2 2 2 5 5 13 9 8 25 20 8 8 8 3 1 3 15 3 4 5 9 15 7 7 12 11 11 5 4 14 4 8 7 16 5 11 13 13 14 17 12 5 4 7 18 15 29 14 8 8 18 5 11 3 2 1 3 2 1 3 3 4 13 8 1 5 4 4 3 3	Open. Hide. 62 47 39 39 62 47 56 62 47 62 62 62 62 62 56 62 49 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 59 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 54 32 54 62 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 48 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 58 54 54 54 58 45 54 58 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 45 54 39 58 58 54 58 58 58 54 48 54 54 52 58 54 58 58 58 58 58 58 58 48 58 42 49 54 58 54 58 54 54 58 58 54 58 54 58 58 51 47 41 54 58 47 58 58 58 58 48 58 58 50 58 50 51 58 58 50 51 46 58 58 58 51 41 58 58 54 48 51 58 54 52 58 50 53 58 53 46 58 48 43 58 58 58 53 53 58 51 58 46 58 49 52 53 58 40 47 58 50 53 53 51 58 58 58 58 51 50 49 42 41 41 49 50 47 50 58 51 53 41 49 50 30 49 44 54 51 51 41 58 41 53 58 40 53 53 44 43 40 42 52 40 49 37 49 51 52 38 49 47 50 42 52 41 39 37 29 46 18 54 44 49 33 46 34 49 51 53 45 53 42 40 39 39 54 49 39 18 51 38 29 50 49 44 49 25 49 49 37 54 51 33 22 34 54 46 52 43 54 51 42 53 53 39 53 53 42 25 42 13 54 51 20 25 29 52 33 49 46 25 41 24 45 47 40 35 32 32 51 41 27 47 51 52 31 32 40 34 39 52 36 34 31 29 41 40 30 52 24 17 32 40 32 33 10 34 30 31 51 46 31 39 42 34 23 40 30 45 45 40 31 31 31 45 30 30 51 30 30 30 24 42 31 42 31 43 31 31 29 51 41 42 31 43 28 28 46 36 28 25 42 33 28 30 31 30 31 34 27 25 28 33 26 25 31 33 31 25 22 46 30 24 30 23 6 9 14 32 37 31 39 31 35 38 39 37 26 16 30 33 30 43 41 39 27 18 37 39 24 25 29 16 18 32 22 17 29 24 31 31 24 19 27 33 34 32 31 32 38 33 26 32 26 32 16 16 10 27 22 22 31 42 25 28 31 21 17 29 12 25 33 25 22 30 32 31 32 26 30 19 15 29 34 18 13 20 19 29 15 32 25 32 29 32 18 26 8 31 21 32 17 24 32 30 24 23 18 20 29 24 28 9 13 24 14 25 14 18 43 18 7 19 27 28 24 7 14 18 21 21 19 8 13 4 12 9 12 28 20 11 18 28 22 8 24 18 22 10 17 10 8 16 7 8 8 26 16 16 8 23 20 26 18 20 17 15 10 21 8 11 11 8 32 7 3 3 14 10 14 15 16 23 7 23 14 12 10 6 6 6 3 6 10 4 11 6 12 11 18 20 20 16 18 21 4 13 7 22 6 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_29443269_29444398
seq2: B6Ng01-314F01.b_43_1169 (reverse)

seq1  GGTATAGGGAAGATACAGAGAGATGGGGAGATGGGTGGGATTGAGGTGCA  50
      ||||||||| |||| | ||||||| ||||||||||| |||||||| ||||
seq2  GGTATAGGG-AGAT-CTGAGAGAT-GGGAGATGGGT-GGATTGAGTTGCA  46

seq1  -TGATGGGAAATTCACAAAGAATCAATAAACAGGTTTTTTAAAAATCCGT  99
       ||||||  || |||||||| ||||   |||||||||||| ||||  || 
seq2  TTGATGG--AACTCACAAAG-ATCA--TAACAGGTTTTTTTAAAAATCG-  90

seq1  TTAAAAGTTTCTACTTTTT-AACTGAGTGT-AATGGCTCTAACTGTAACC  147
      ||||||||||||||||||| |||||||||| |||||||||||||||||||
seq2  TTAAAAGTTTCTACTTTTTAAACTGAGTGTAAATGGCTCTAACTGTAACC  140

seq1  ACCACAGA-CCAGA-GGCTGATAGGCAGGACAGTCACAAGTTCAA-GGCT  194
      |||||||| ||||| |||||||||||||||||||||||||||||| ||||
seq2  ACCACAGACCCAGAGGGCTGATAGGCAGGACAGTCACAAGTTCAAGGGCT  190

seq1  ACCCTCAATGATGTATAGTGAGTTCCAGGCTAGCCTGGGCTAAAAAGTAA  244
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTCAATGATGTATAGTGAGTTCCAGGCTAGCCTGGGCTAAAAAGTAA  240

seq1  AATCTTGGTTTTTTGTTAGTTTGTTTATTTAAATGGACACACTGACGGTT  294
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTTGGTTTTTTGTTAGTTTGTTTATTTAAATGGACACACTGACGGTT  290

seq1  TTGTGCTCAAAGCAAAGAATGTCTCATCAAGTATTGTTTTCCTGGCATAC  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGCTCAAAGCAAAGAATGTCTCATCAAGTATTGTTTTCCTGGCATAC  340

seq1  ACAAGTCCCC-AAGTCCATCCCTAACACCACATAGAAACTAGATATCATT  393
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  ACAAGTCCCCAAAGTCCATCCCTAACACCACATAGAAACTAGATATCATT  390

seq1  CTAAAATAAGTCAGATGAATCATAGGCCAGGCACCCTGGCTTCCTCCCAT  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAAATAAGTCAGATGAATCATAGGCCAGGCACCCTGGCTTCCTCCCAT  440

seq1  CATCCCAGCAGTCTGGAAGTTGCAGTAGGATCGCTCTGGTTCAGTGCCAG  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCCCAGCAGTCTGGAAGTTGCAGTAGGATCGCTCTGGTTCAGTGCCAG  490

seq1  CCCAGGCTACACAATGGCCCCAGATAGGCATGCCTGTGTTGCACGGGAAG  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGGCTACACAATGGCCCCAGATAGGCATGCCTGTGTTGCACGGGAAG  540

seq1  AACAGAATTCATTTATTAAATGGTGAGGGCTGCCGTGGAAGGGCTTCCTG  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGAATTCATTTATTAAATGGTGAGGGCTGCCGTGGAAGGGCTTCCTG  590

seq1  GTGGTATTTGGGAAAGGTGGAAGGATGTGGAGTGTCTATGGTCAGCACAG  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTATTTGGGAAAGGTGGAAGGATGTGGAGTGTCTATGGTCAGCACAG  640

seq1  CTGACAGAAGGCAATGGGGTAGGGGGTGGACAGCAAAGCTGGGGGAGGGG  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACAGAAGGCAATGGGGTAGGGGGTGGACAGCAAAGCTGGGGGAGGGG  690

seq1  TGCAAGACCAGAGACTGCAGGGCGTCTGGGTGGGATACAGAAGCCAGTCT  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAAGACCAGAGACTGCAGGGCGTCTGGGTGGGATACAGAAGCCAGTCT  740

seq1  GGTATGTTCAAGCTTAAAGCAGCCATCAAAAGCTCCTGAGAGGAACAGAG  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTATGTTCAAGCTTAAAGCAGCCATCAAAAGCTCCTGAGAGGAACAGAG  790

seq1  TCTTCGAGAAGTGGGAACCGCAGCTCCATTGCCTTGTTTCAGGGGAGAAT  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCGAGAAGTGGGAACCGCAGCTCCATTGCCTTGTTTCAGGGGAGAAT  840

seq1  CATAGCAGTGGGCACAGAATCTAAGAATCCCCAACAAGAATGCATTGATG  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAGCAGTGGGCACAGAATCTAAGAATCCCCAACAAGAATGCATTGATG  890

seq1  GGGCAGGGGGGGCGGGCGCAGGTTACCTAAGGGAAAGGAGAGGGAGGAGG  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCAGGGGGGGCGGGCGCAGGTTACCTAAGGGAAAGGAGAGGGAGGAGG  940

seq1  AGGAAGAGGAGGAGGAAGACAACCCAGGGCCTGCCCACCATGGTCCTGGA  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAGAGGAGGAGGAAGACAACCCAGGGCCTGCCCACCATGGTCCTGGA  990

seq1  TGGTGGGCACCACCATGATGAACAGCTATGTGATGGGGAGGTAGGGAAGA  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTGGGCACCACCATGATGAACAGCTATGTGATGGGGAGGTAGGGAAGA  1040

seq1  TATAAAGAAAGGGAGCAGCCAGGCAGTGGTGGCGCACACCTTTAATCCCA  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAAAGAAAGGGAGCAGCCAGGCAGTGGTGGCGCACACCTTTAATCCCA  1090

seq1  GCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAATTC  1130
      |||||||||||||||||||||||||||||||||||||
seq2  GCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAATTC  1127

seq1: chr2_29413119_29414151
seq2: B6Ng01-314F01.g_62_1091

seq1  GAATTCACAGCTGCTGGGGGGCTCATGAATTATGCACAGTCCCAGATCAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACAGCTGCTGGGGGGCTCATGAATTATGCACAGTCCCAGATCAA  50

seq1  CCCATCAGCTACTGTCAGGGAGGAATCAAAGGCCCTGTGATGGGTGACAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATCAGCTACTGTCAGGGAGGAATCAAAGGCCCTGTGATGGGTGACAG  100

seq1  CCTTCTGTGGCACCTAGAACCCTTTGCAAGAGTCCTGATGTCACCAGATC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCTGTGGCACCTAGAACCCTTTGCAAGAGTCCTGATGTCACCAGATC  150

seq1  CTGTAGTTCTCCGATCTCTACCCCTCCCAGATGGCCCTCTCTCTGTTTCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTAGTTCTCCGATCTCTACCCCTCCCAGATGGCCCTCTCTCTGTTTCA  200

seq1  ATGCCAGGTGCGGGTCTGATGGACTGGAAGGGGACCTCAACAACAAAAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCCAGGTGCGGGTCTGATGGACTGGAAGGGGACCTCAACAACAAAAAG  250

seq1  CCTGGCCCATGTTTTCTGAGTTCGTTCCGAAATGCTCAGGCTGAATAATT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGCCCATGTTTTCTGAGTTCGTTCCGAAATGCTCAGGCTGAATAATT  300

seq1  GATGGCAGCACTATATTTGTGAGGGAAATGTCACCTTGGGTATAGCTACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGCAGCACTATATTTGTGAGGGAAATGTCACCTTGGGTATAGCTACA  350

seq1  GCATCGAAGCTTCCTTTGGTCAAGTCACACTTGGTAGTGGATTCTTGTAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATCGAAGCTTCCTTTGGTCAAGTCACACTTGGTAGTGGATTCTTGTAA  400

seq1  TCCCAGGGTGGGGGTGGTAGGGTAGAAGCAGTAAGATCAGGTGTTCAGGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAGGGTGGGGGTGGTAGGGTAGAAGCAGTAAGATCAGGTGTTCAGGG  450

seq1  TCAGCCTCAACTACATAGAGAGTTCAAGGACAGACTTGGCTAGGTGAGAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCCTCAACTACATAGAGAGTTCAAGGACAGACTTGGCTAGGTGAGAC  500

seq1  CTCTGTCCAGGGTGTGTGAAGGATCCACACAAGTAAAGATAAACTGAGCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTCCAGGGTGTGTGAAGGATCCACACAAGTAAAGATAAACTGAGCC  550

seq1  ACAAAACAGGGAATGAATCTAGACACAGGTACTCTCCTGCCCAGAATGCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAACAGGGAATGAATCTAGACACAGGTACTCTCCTGCCCAGAATGCA  600

seq1  GTGGGGCAACCCCACTGTCACAGGGGCAGAATTATCCCAAACCACTCATT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGGCAACCCCACTGTCACAGGGGCAGAATTATCCCAAACCACTCATT  650

seq1  ACAGATAAGGAAAAGTTCATCGAGGGAGGACTGGAGGGCTGACTGTGAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGATAAGGAAAAGTTCATCGAGGGAGGACTGGAGGGCTGACTGTGAAA  700

seq1  GTGCTCAGAGGAGATAGAAGATGGGACGTGGAAAATAGTGTCACCCATAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTCAGAGGAGATAGAAGATGGGACGTGGAAAATAGTGTCACCCATAC  750

seq1  CTCAGGCAAAATGATTCCCCACATACCGTCACACACGTGGAATGGCCCAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGGCAAAATGATTCCCCACATACCGTCACACACGTGGAATGGCCCAG  800

seq1  CTCTCGTGACACAATGGCTTCTCAGGTAACCAGCCCCATCCTGAAGCCAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCGTGACACAATGGCTTCTCAGGTAACCAGCCCCATCCTGAAGCCAT  850

seq1  TAGGGTACCAGCCACTAGCCACAGTAGGGCATACTCAAAGAAAGTCTGCC  900
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  TAGGGTACCAGCCACTAGCCACAGTAGGGCATACTC-AAGAAAGTCTGCC  899

seq1  CAGACCAGAGACTTCAGGAGTCTCTGAATGTCAGGGACAGGGACTGAGAC  950
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  CAGACCAGAGACTTCAGGAGTCTCTGAATGTCA-GGACAGGGACTGAGAC  948

seq1  CCCTTGGAATCTAAATGTCTATGTTCTCCAGTCATATATATTATAAAGGT  1000
      ||||||||||||||||||||||||||| |||||||||||||||||||| |
seq2  CCCTTGGAATCTAAATGTCTATGTTCT-CAGTCATATATATTATAAAGTT  997

seq1  TACGCGCGCACAC-ACACACATGCACAAGAGACA  1033
      ||||||||||||| |||||||||||| |||||||
seq2  TACGCGCGCACACAACACACATGCAC-AGAGACA  1030

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information