MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-322K02
Chromosome	2 (Build37)
Map Location	129,145,522 - 129,243,890
singlet/doublet	doublet
Overlap gene	Il1b, OTTMUSG00000015529, LOC668896
Upstream gene	LOC100043424, LOC100043729, LOC383791, LOC100043730, Gm355, Anapc1, Mertk, Tmem87b, 1600015H20Rik, Zc3h8, LOC100043735, LOC100043736, Zc3h6, LOC668894, Ttl, LOC100043738, Rpo1-2, Chchd5, LOC545461, LOC100043431, Slc20a1, A730036I17Rik, LOC671466, Ckap2l, Il1a
Downstream gene	F830045P16Rik, Sirpa, Pdyn, Ppia-ps2_1620.1, Stk35, Tgm3, AU015228, LOC100043438, Tgm6, Snrpb, Tmc2, Nol5a, Idh3b, Ebf4, LOC668899, Cpxm1, LOC100043446, 1700020A23Rik, 4933425O20Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100043424 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100043729 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC383791 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100043730 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043730
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	Gm355 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241634 MGI:2685201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Anapc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17222 MGI:103097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mertk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17289 MGI:96965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem87b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72477 MGI:1919727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1600015H20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70370 MGI:1917620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3h8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57432 MGI:1930128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043735 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043736 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043736
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs

name	Zc3h6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78751 MGI:1926001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ttl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69737 MGI:1916987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043738 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043738
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Rpo1-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20017 MGI:108014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chchd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66170 MGI:1913420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545461 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 184 ESTs pseudo : _no_value

name	LOC100043431 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Slc20a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20515 MGI:108392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A730036I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329513 MGI:3041182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671466 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Ckap2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70466 MGI:1917716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16175 MGI:96542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16176 MGI:96543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000015529 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329514 MGI:3650458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668896 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668896
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 4 Proteins pseudo : _no_value

name	F830045P16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228592 MGI:3045317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sirpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19261 MGI:108563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdyn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18610 MGI:97535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppia-ps2_1620.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545463
definition	note : peptidylprolyl isomerase A (Ppia) pseudogene 2_1620.1 pseudo : _no_value

name	Stk35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67333 MGI:1914583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tgm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21818 MGI:98732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AU015228 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99169 MGI:2139152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043438 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Tgm6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241636 MGI:3044321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20638 MGI:98342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192140 MGI:2151017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67134 MGI:1914384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Idh3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170718 MGI:2158650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ebf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228598 MGI:2385972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668899 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 788 ESTs, 7 Proteins

name	Cpxm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56264 MGI:1934569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043446 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	1700020A23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75656 MGI:1922906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins

name	4933425O20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66766 MGI:1914016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043424 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250003 GeneID:100043424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043424 transcript_id : XM_001480133.1

name	LOC100043729 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250118 GeneID:100043729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100043729 transcript_id : XM_001480842.1

name	Gm355 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367229 GeneID:241634 MGI:2685201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : gene model 355, (NCBI) transcript_id : XM_141353.7

name	Anapc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678833 GeneID:17222 MGI:103097
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anaphase promoting complex subunit 1 transcript_id : NM_008569.1

name	Mertk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106354 GeneID:17289 MGI:96965
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : c-mer proto-oncogene tyrosine kinase transcript_id : NM_008587.1

name	Tmem87b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487302 GeneID:72477 MGI:1919727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 87B transcript_id : NM_028248.2

name	1600015H20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387777 GeneID:70370 MGI:1917620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600015H20 gene transcript_id : NM_024237.3

name	Zc3h8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719325 GeneID:57432 MGI:1930128
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 8 transcript_id : NM_020594.2

name	LOC100043736 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250121 GeneID:100043736
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs product : hypothetical protein LOC100043736 transcript_id : XM_001480858.1

name	Zc3h6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341560 GeneID:78751 MGI:1926001
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 6 transcript_id : NM_178404.2

name	LOC668894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367240 GeneID:668894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to catenin, alpha 2 transcript_id : XM_001004454.1

name	Ttl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076928 GeneID:69737 MGI:1916987
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase transcript_id : NM_027192.1

name	LOC100043738 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250127 GeneID:100043738
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100043738 transcript_id : XM_001480861.1

name	Rpo1-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677788 GeneID:20017 MGI:108014
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase 1-2 transcript_id : NM_009086.1

name	Chchd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353048 GeneID:66170 MGI:1913420
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 5 transcript_id : NM_025395.2

name	LOC100043431 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250006 GeneID:100043431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : hypothetical protein LOC100043431 transcript_id : XM_001480152.1

name	Slc20a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657578 GeneID:20515 MGI:108392
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 20, member 1 transcript_id : NM_015747.1

name	A730036I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367589 GeneID:329513 MGI:3041182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A730036I17 gene transcript_id : NM_177847.3

name	LOC671466 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250132 GeneID:671466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical LOC671466 transcript_id : XM_001480876.1

name	Ckap2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31795584 GeneID:70466 MGI:1917716
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytoskeleton associated protein 2-like transcript_id : NM_181589.2

name	Il1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130060 GeneID:16175 MGI:96542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 alpha transcript_id : NM_010554.4

name	Il1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130747 GeneID:16176 MGI:96543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 beta transcript_id : NM_008361.3

name	OTTMUSG00000015529 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377485 GeneID:329514 MGI:3650458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000015529 transcript_id : NM_177848.3

name	F830045P16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821686 GeneID:228592 MGI:3045317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F830045P16 gene transcript_id : NM_177653.3

name	Sirpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626108 GeneID:19261 MGI:108563
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal-regulatory protein alpha transcript_id : NM_007547.2

name	Pdyn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24476002 GeneID:18610 MGI:97535
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prodynorphin transcript_id : NM_018863.2

name	Stk35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490406 GeneID:67333 MGI:1914583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 35 transcript_id : NM_183262.2

name	Stk35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490408 GeneID:67333 MGI:1914583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 35 transcript_id : NM_001038635.1

name	Tgm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001550 GeneID:21818 MGI:98732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transglutaminase 3, E polypeptide transcript_id : NM_009374.2

name	AU015228 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359103 GeneID:99169 MGI:2139152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU015228 transcript_id : NM_001033197.2

name	LOC100043438 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250008 GeneID:100043438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to Ubtf protein transcript_id : XM_001480168.1

name	Tgm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893375 GeneID:241636 MGI:3044321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transglutaminase 6 transcript_id : NM_177726.3

name	Snrpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378002 GeneID:20638 MGI:98342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein B transcript_id : NM_009225.2

name	Tmc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149733 GeneID:192140 MGI:2151017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane channel-like gene family 2 transcript_id : NM_138655.1

name	Nol5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090931 GeneID:67134 MGI:1914384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 5A transcript_id : NM_024193.2

name	Idh3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801765 GeneID:170718 MGI:2158650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : isocitrate dehydrogenase 3 (NAD+) beta transcript_id : NM_130884.2

name	Ebf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23308719 GeneID:228598 MGI:2385972
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : early B-cell factor 4 transcript_id : NM_152993.1

name	LOC668899 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250143 GeneID:668899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 788 ESTs, 7 Proteins product : similar to ribosomal protein L27a transcript_id : XM_001004506.2

name	Cpxm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9789916 GeneID:56264 MGI:1934569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase X 1 (M14 family) transcript_id : NM_019696.1

name	1700020A23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367228 GeneID:75656 MGI:1922906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins product : RIKEN cDNA 1700020A23 gene, transcript variant 2 transcript_id : XM_894775.2

name	4933425O20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801888 GeneID:66766 MGI:1914016
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933425O20 gene transcript_id : NM_025753.3

name	LOC100043424 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250004 GeneID:100043424
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480183.1

name	LOC100043729 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250119 GeneID:100043729
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480892.1

name	Gm355 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82886935 GeneID:241634 MGI:2685201
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141353.6

name	Anapc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678834 CCDS:CCDS16715.1 GeneID:17222 MGI:103097
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : meiotic check point regulator product : anaphase promoting complex subunit 1 protein_id : NP_032595.1

name	Mertk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106355 CCDS:CCDS16716.1 GeneID:17289 MGI:96965
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : Tyro 12 product : c-mer proto-oncogene tyrosine kinase protein_id : NP_032613.1

name	Tmem87b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487303 GeneID:72477 MGI:1919727
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : novel lung seven transmembrane receptor domain containing protein product : hypothetical protein LOC72477 protein_id : NP_082524.2

name	1600015H20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789193 GeneID:70370 MGI:1917620
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC70370 protein_id : NP_077199.1

name	Zc3h8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719326 CCDS:CCDS16718.1 GeneID:57432 MGI:1930128
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : fetal liver zinc finger 1; zinc finger CCCH type domain containing 8 product : zinc finger CCCH type containing 8 protein_id : NP_065619.2

name	LOC100043736 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250122 GeneID:100043736
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480908.1

name	Zc3h6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409960 GeneID:78751 MGI:1926001
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger CCCH type domain containing 6 product : zinc finger CCCH type containing 6 protein_id : NP_848491.1

name	LOC668894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367241 GeneID:668894
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004454.1

name	Ttl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076929 CCDS:CCDS16719.1 GeneID:69737 MGI:1916987
definition	GO_component : GO:0005874 - microtubule [Evidence IC] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IMP] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0030516 - regulation of axon extension [Evidence IMP] codon_start : 1 product : tubulin tyrosine ligase protein_id : NP_081468.1

name	LOC100043738 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250128 GeneID:100043738
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480911.1

name	Rpo1-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677789 CCDS:CCDS16720.1 GeneID:20017 MGI:108014
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RNA polymerase 1-2, 128 kDa subunit; DNA-directed RNA polymerase I 135kDa polypeptide; RNA polymerase I subunit 2 product : RNA polymerase I polypeptide B protein_id : NP_033112.1

name	Chchd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076873 CCDS:CCDS16721.1 GeneID:66170 MGI:1913420
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : coiled-coil-helix-coiled-coil-helix domain containing 5 protein_id : NP_079671.1

name	LOC100043431 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250007 GeneID:100043431
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480202.1

name	Slc20a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657579 CCDS:CCDS16722.1 GeneID:20515 MGI:108392
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 20, member 1 protein_id : NP_056562.1

name	A730036I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244436 GeneID:329513 MGI:3041182
definition	codon_start : 1 product : hypothetical protein LOC329513 protein_id : NP_808515.1

name	LOC671466 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250133 GeneID:671466
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480926.1

name	Ckap2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712008 CCDS:CCDS16724.1 GeneID:70466 MGI:1917716
definition	codon_start : 1 product : cytoskeleton associated protein 2-like protein_id : NP_853620.1

name	Il1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059075 CCDS:CCDS16725.1 GeneID:16175 MGI:96542
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0001660 - fever [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : interleukin 1 alpha protein_id : NP_034684.2

name	Il1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680415 CCDS:CCDS16726.1 GeneID:16176 MGI:96543
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IDA]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0001660 - fever [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0050900 - leukocyte migration [Evidence IDA]; GO:0030593 - neutrophil chemotaxis [Evidence IDA]; GO:0045080 - positive regulation of chemokine biosynthesis [Evidence IDA]; GO:0045410 - positive regulation of interleukin-6 biosynthesis [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : interleukin 1, beta protein_id : NP_032387.1

name	OTTMUSG00000015529 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244430 GeneID:329514 MGI:3650458
definition	codon_start : 1 product : hypothetical protein LOC329514 protein_id : NP_808516.1

name	F830045P16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244066 CCDS:CCDS16728.1 GeneID:228592 MGI:3045317
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : novel immunoglobulin C1-set domain containing protein product : hypothetical protein LOC228592 protein_id : NP_808321.1

name	Sirpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626109 CCDS:CCDS16729.1 GeneID:19261 MGI:108563
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0045309 - protein phosphorylated amino acid binding [Evidence IPI] GO_process : GO:0007015 - actin filament organization [Evidence IMP]; GO:0006928 - cell motility [Evidence IMP]; GO:0007160 - cell-matrix adhesion [Evidence IMP]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IMP]; GO:0006911 - phagocytosis, engulfment [Evidence IDA]; GO:0006910 - phagocytosis, recognition [Evidence IDA]; GO:0050766 - positive regulation of phagocytosis [Evidence IDA] codon_start : 1 note : brain immunological-like with tyrosine-based motifs; protein tyrosine phosphatase, non-receptor type substrate 1 product : signal-regulatory protein alpha protein_id : NP_031573.2

name	Pdyn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256622 GeneID:18610 MGI:97535
definition	GO_function : GO:0005184 - neuropeptide hormone activity [Evidence ISS]; GO:0001515 - opioid peptide activity [Evidence IEA] GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007268 - synaptic transmission [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : beta-neoendorphin-dynorphin preproprotein protein_id : NP_061351.1

name	Stk35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490409 CCDS:CCDS16731.1 GeneID:67333 MGI:1914583
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; CLP-36 interacting kinase product : serine/threonine kinase 35 isoform b protein_id : NP_001033724.1

name	Stk35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490407 CCDS:CCDS16732.1 GeneID:67333 MGI:1914583
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; CLP-36 interacting kinase product : serine/threonine kinase 35 isoform a protein_id : NP_899085.2

name	Tgm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001551 GeneID:21818 MGI:98732
definition	GO_component : GO:0001533 - cornified envelope [Evidence TAS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0031234 - extrinsic to internal side of plasma membrane [Evidence ISS] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA] [Evidence ISS]; GO:0019003 - GDP binding [Evidence ISS]; GO:0005525 - GTP binding [Evidence ISS]; GO:0003924 - GTPase activity [Evidence ISS]; GO:0000287 - magnesium ion binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003810 - protein-glutamine gamma-glutamyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016746 - transferase activity, transferring acyl groups [Evidence ISS] GO_process : GO:0043163 - cell envelope organization and biogenesis [Evidence ISS]; GO:0035315 - hair cell differentiation [Evidence TAS]; GO:0031069 - hair follicle morphogenesis [Evidence ISS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence ISS]; GO:0018149 - peptide cross-linking [Evidence IEA] [Evidence TAS] [Evidence ISS]; GO:0051262 - protein tetramerization [Evidence ISS]; GO:0043588 - skin development [Evidence TAS] codon_start : 1 note : E polypeptide; protein-glutamine-gamma-glutamyltransferase; TG E product : transglutaminase 3, E polypeptide protein_id : NP_033400.2

name	AU015228 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701612 GeneID:99169 MGI:2139152
definition	GO_component : GO:0005673 - transcription factor TFIIE complex [Evidence IEA] GO_function : GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006367 - transcription initiation from RNA polymerase II promoter [Evidence IEA] codon_start : 1 note : general transcription factor II E, polypeptide 1-like product : hypothetical protein LOC99169 protein_id : NP_001028369.1

name	LOC100043438 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250009 GeneID:100043438
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480218.1

name	Tgm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244202 CCDS:CCDS16734.1 GeneID:241636 MGI:3044321
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003810 - protein-glutamine gamma-glutamyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018149 - peptide cross-linking [Evidence IEA] codon_start : 1 product : transglutaminase 6 protein_id : NP_808394.1

name	Snrpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678053 CCDS:CCDS16735.1 GeneID:20638 MGI:98342
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA] codon_start : 1 product : small nuclear ribonucleoprotein B protein_id : NP_033251.1

name	Tmc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149734 CCDS:CCDS16736.1 GeneID:192140 MGI:2151017
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane, cochlear expressed 2 product : transmembrane channel-like gene family 2 protein_id : NP_619596.1

name	Nol5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090932 CCDS:CCDS16737.1 GeneID:67134 MGI:1914384
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : 56kDa with KKE/D repeat product : nucleolar protein 5A protein_id : NP_077155.2

name	Idh3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700024 CCDS:CCDS16738.1 GeneID:170718 MGI:2158650
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016652 - oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor [Evidence IEA] codon_start : 1 note : N14A tumor-related protein; isocitrate dehydrogenase 3 beta product : isocitrate dehydrogenase 3, beta subunit protein_id : NP_570954.1

name	Ebf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23308720 GeneID:228598 MGI:2385972
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Olf-1/EBF-like 4; Olf-1/EBF-like-4/132 transcription factor; early B-cell factor 3 product : early B-cell factor 4 protein_id : NP_694538.1

name	LOC668899 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367245 GeneID:668899
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004506.1

name	Cpxm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789917 CCDS:CCDS16740.1 GeneID:56264 MGI:1934569
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA]; GO:0004180 - carboxypeptidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : metallocarboxypeptidase CPX-1; metallocarboxypeptidase 1; carboxypeptidase X (M14 family) product : carboxypeptidase X 1 (M14 family) protein_id : NP_062670.1

name	1700020A23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82886863 GeneID:75656 MGI:1922906
definition	codon_start : 1 product : hypothetical protein LOC75656 isoform 2 protein_id : XP_899868.1

name	4933425O20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313328 CCDS:CCDS16742.1 GeneID:66766 MGI:1914016
definition	codon_start : 1 product : hypothetical protein LOC66766 protein_id : NP_080029.1

name	LOC383791 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383791
definition	number : 1 pseudo : _no_value

name	LOC100043735 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043735
definition	number : 1 pseudo : _no_value

name	LOC100043446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043446
definition	number : 1 pseudo : _no_value

name	LOC100043446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043446
definition	number : 2 pseudo : _no_value

name	LOC100043446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043446
definition	number : 3 pseudo : _no_value

name	LOC100043446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043446
definition	number : 4 pseudo : _no_value

name	LOC100043730 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250120 GeneID:100043730
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to high mobility group nucleosomal binding domain 2 pseudo : _no_value transcript_id : XR_034868.1

name	LOC545461 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250131 GeneID:545461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 184 ESTs product : similar to SET domain containing 3 pseudo : _no_value transcript_id : XR_034879.1

name	LOC668896 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250136 GeneID:668896
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 4 Proteins product : similar to signal peptidase complex subunit 2 homolog pseudo : _no_value transcript_id : XR_034890.1

clone name	MSMg01-083O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116C17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271A03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-322K02.b	B6Ng01-322K02.g
ACC	GA111423	GA111424
length	911	1,130
definition	B6Ng01-322K02.b	B6Ng01-322K02.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(129,242,981 - 129,243,890)	(129,145,522 - 129,146,652)
sequence	gaattctctctgccccacccattcagttggatttctctgccttcctccct cctcttatcccttgctcctgtgggaaaatgaaaacactcagatgctgaca cggcttttctgagagtagtgtcttgtcgggtccaatcttccaagtgctgc tgctgactgtaacaggttctcagaccttagtaggccccagaccttaaaac aactgatcccatgatggaaatgccattcaggctgtaaaactcagcatgta gacagcaccacctgccaaaacgaaaacaaagtcctaatccatcaaatgcc attggaagcttttcaggttctgtagttctgcttcaggctaactgctcttg ttaaatgaagtatgtcagcccaggacatggtttttgtgattaaaagctca ccctgagaaaagcttggtgctacactggggtctcaaacacccagtatagt cacaggctggctaataaagactttctatcggtttaaactcatgtctgagc agtctcctctggtgaatgcccctcaacattgaccctttgacataaaagtc cctcttcttatggaaagacagcaacattaattgacaagctacacgtcatt ttaaacctcattttaaattttaagccatatttctatgttggaatttgact tagtaattaacaaataatgaaacataaaggttttcaatggattttataca cagaaagaaaaatggagaaattatagtctttctctagagaatgctataat tttggccagatggcagtggcacacctttaatctcagcactcagatggcaa aggcaggaggatttgagttcaaggccagtttgatgtacagagtgagttcc aggatagccaggggtacacagaaaagaggaacccgaactcaaaatgaggg gggggggagaa	gaattcatccccagaattacataaaaattggcctttcatagctcttgatg gtttataattgagtgttttatgtttaagtctttcatttatttgggattta ggcatgacttgaaattctataagtttggcattgaaacgtagcctgctgtc tcttagacagcctttgaggaaatcagggaccagggagtcagaagtttcta tttccctccttagagggatgtgaatgtcacttcccctctttctattttgt ttcttcgaattctttctttccatactgcaagacccgctagttcagttctc tagaaattcccacgggctgaaggcaaagcagaactagatggtggggaaat ctgggtaatgcttctgtattcatgaagcttaccctacacagtgactcaaa ttgcccagagagatcatccgtttcttctagacttctccatttttctagtc cagactccagtcatcacagaatccccttctactctcctgcacccccaggc gacctcgagtcagtcctcacttccttctgcctgtccattccttccatccc ctggccgccaccatcagactgatcaccgatttccttcacccactctttcc tcaccatactcctggaggatgagtcacttctggtgctcatctgtcatgtt tgtcactctcagaatctctcatgttacatttatatctttgcttaattcct agaattcctcattgttcacaattgaaagttcaaatgctaaaaaccctaca gacacaggaaccatagagcctcacataggagttcatcaccaaaactaaaa aaagattgttattgtccttgattagctgactggctggctggtgttttgag aaaagatcttgctcctataattcgcctataaatttggtactactcaatct acattcaattttttttttaaataaagatttaagaaaattgctagtatgta catttgggtagttagtattagttgtcaaccagaccacatctaggatcacc ttgggagagaggtgagagactgtctcatcaggctgggctggggggtgact gtcttaataggttattgattgttggagaccattccactggggggtggcac atccctagccatggaatcctgaatcctgta
quality values	Open. Hide. 62 31 24 31 62 56 62 62 62 62 62 62 62 62 62 37 27 62 62 44 32 62 62 59 39 62 62 62 62 62 46 46 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 38 38 58 58 58 54 58 52 58 58 58 54 58 58 54 58 58 58 58 58 58 58 58 54 51 58 49 58 58 51 52 58 58 58 58 58 51 58 58 58 46 49 58 58 51 58 58 51 54 58 58 58 41 51 58 53 58 58 58 45 48 58 58 58 51 50 58 51 51 58 58 58 58 58 58 58 54 58 58 39 58 51 46 58 58 58 58 51 58 58 53 53 39 51 51 50 53 53 58 51 50 58 58 53 58 41 41 58 58 58 50 53 52 53 53 58 51 51 44 39 58 58 54 47 29 58 52 58 47 40 30 54 54 47 44 49 52 54 42 52 51 51 54 54 50 42 49 38 33 38 40 49 54 50 51 24 54 49 32 42 53 45 53 42 52 45 53 46 49 53 53 52 52 41 32 32 51 32 54 41 27 46 37 37 42 41 29 40 40 54 54 52 54 38 31 52 31 40 52 31 34 46 32 38 29 45 52 40 31 33 45 40 45 51 47 49 40 30 46 41 51 53 45 42 36 53 47 31 51 43 43 20 33 30 31 46 31 51 46 40 17 46 27 33 16 46 46 23 42 27 18 51 38 31 38 31 51 43 39 32 42 22 46 31 42 31 33 42 48 42 30 34 32 37 28 30 36 31 30 46 29 42 42 33 18 46 36 34 42 31 31 42 29 15 30 31 42 37 31 39 41 46 32 31 21 30 35 41 31 31 44 41 37 39 26 33 7 32 28 33 29 41 38 24 41 31 31 32 32 25 41 43 12 18 31 31 17 47 44 44 44 44 44 44 44 11 21 18 22 9	Open. Hide. 62 49 37 39 62 47 39 62 62 62 62 54 47 36 37 43 59 62 56 62 44 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 39 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 58 58 58 58 58 58 58 58 54 41 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 52 58 58 58 58 58 58 58 54 42 58 58 58 58 58 58 58 58 54 58 58 58 58 52 54 58 54 58 58 52 53 58 49 58 58 58 58 58 50 58 58 58 58 58 58 51 54 51 58 58 58 50 49 58 50 50 58 58 58 58 58 48 50 58 58 58 50 51 54 41 53 51 58 58 58 58 51 58 48 36 25 58 39 33 51 58 31 51 52 50 54 58 58 58 51 58 58 53 58 51 58 53 52 52 50 51 58 52 50 49 50 58 54 58 53 54 49 47 51 49 58 53 51 52 52 32 51 51 52 53 58 53 58 53 50 50 58 44 40 38 53 41 58 58 53 52 53 50 47 52 50 54 54 51 50 51 41 42 42 49 47 39 49 39 51 24 54 34 45 39 41 44 49 45 33 53 42 54 37 51 49 32 49 39 39 49 47 52 53 54 42 37 47 36 30 21 54 41 42 49 44 37 32 54 54 54 38 42 54 47 39 43 45 38 42 45 27 26 45 32 31 46 33 27 32 36 34 52 37 31 53 33 37 51 45 40 40 40 32 52 32 20 32 35 22 48 31 32 32 43 40 27 28 35 15 49 46 33 34 37 23 51 46 51 51 51 33 26 11 6 14 40 24 31 39 36 43 43 34 31 24 15 29 32 32 26 31 29 28 31 30 29 41 26 26 16 27 28 43 31 30 28 34 19 32 28 42 37 48 47 31 31 37 26 38 48 46 33 20 31 31 31 26 33 31 31 21 31 41 31 31 21 27 25 19 34 31 36 32 26 31 34 31 36 46 37 27 48 32 35 21 22 30 36 34 32 32 36 31 23 27 24 31 30 32 35 23 31 48 14 19 13 37 44 36 44 44 41 41 41 37 20 22 44 24 21 25 43 25 16 19 22 44 31 14 17 13 29 44 44 19 14 8 17 29 32 34 28 31 31 27 25 8 12 32 31 38 48 30 18 48 22 22 33 34 27 29 26 32 32 32 23 29 30 23 24 23 32 24 34 17 16 14 28 12 7 18 7 9 11 19 11 28 22 11 13 9 13 17 27 20 13 7 20 6 9 7 30 6 5 5 8 9 28 16 20 27 18 28 11 8 5 10 16 20 16 7 19 11 13 9 20 16 12 11 9 20 16 10 32 6 5 3 11 13 19 28 28 11 8 9 21 16 16 21 16 21 20 22 7 14 4 3 4 6 16 8 5 3 6 7 7 6 8 11 4 8 20 9 3 3 11 12 17 3 4 4 4 6 12 13 13 18 25 28 30 29 18 4 8 15 7 9 23 4 3 2 28 17 4 5 8 16 12 4 1 11 17 3 6 25 4 4 4 10 13 24 5 5 5 21 11 4 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_129242981_129243890
seq2: B6Ng01-322K02.b_45_955 (reverse)

seq1  TTCT-CCCCCCCCCTCATTTTGAGTTCGGGTTCCTCTTTTCTGTGTACCC  49
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCCCCCCCCCCTCATTTTGAGTTCGGGTTCCTCTTTTCTGTGTACCC  50

seq1  CTGGCTATCCTGGAACTCACTCTGTACATCAAACTGGCCTTGAACTCAAA  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCTATCCTGGAACTCACTCTGTACATCAAACTGGCCTTGAACTCAAA  100

seq1  TCCTCCTGCCTTTGCCATCTGAGTGCTGAGATTAAAGGTGTGCCACTGCC  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCCTGCCTTTGCCATCTGAGTGCTGAGATTAAAGGTGTGCCACTGCC  150

seq1  ATCTGGCCAAAATTATAGCATTCTCTAGAGAAAGACTATAATTTCTCCAT  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGGCCAAAATTATAGCATTCTCTAGAGAAAGACTATAATTTCTCCAT  200

seq1  TTTTCTTTCTGTGTATAAAATCCATTGAAAACCTTTATGTTTCATTATTT  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCTTTCTGTGTATAAAATCCATTGAAAACCTTTATGTTTCATTATTT  250

seq1  GTTAATTACTAAGTCAAATTCCAACATAGAAATATGGCTTAAAATTTAAA  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAATTACTAAGTCAAATTCCAACATAGAAATATGGCTTAAAATTTAAA  300

seq1  ATGAGGTTTAAAATGACGTGTAGCTTGTCAATTAATGTTGCTGTCTTTCC  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGGTTTAAAATGACGTGTAGCTTGTCAATTAATGTTGCTGTCTTTCC  350

seq1  ATAAGAAGAGGGACTTTTATGTCAAAGGGTCAATGTTGAGGGGCATTCAC  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGAAGAGGGACTTTTATGTCAAAGGGTCAATGTTGAGGGGCATTCAC  400

seq1  CAGAGGAGACTGCTCAGACATGAGTTTAAACCGATAGAAAGTCTTTATTA  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGGAGACTGCTCAGACATGAGTTTAAACCGATAGAAAGTCTTTATTA  450

seq1  GCCAGCCTGTGACTATACTGGGTGTTTGAGACCCCAGTGTAGCACCAAGC  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGCCTGTGACTATACTGGGTGTTTGAGACCCCAGTGTAGCACCAAGC  500

seq1  TTTTCTCAGGGTGAGCTTTTAATCACAAAAACCATGTCCTGGGCTGACAT  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCTCAGGGTGAGCTTTTAATCACAAAAACCATGTCCTGGGCTGACAT  550

seq1  ACTTCATTTAACAAGAGCAGTTAGCCTGAAGCAGAACTACAGAACCTGAA  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCATTTAACAAGAGCAGTTAGCCTGAAGCAGAACTACAGAACCTGAA  600

seq1  AAGCTTCCAATGGCATTTGATGGATTAGGACTTTGTTTTCGTTTTGGCAG  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTTCCAATGGCATTTGATGGATTAGGACTTTGTTTTCGTTTTGGCAG  650

seq1  GTGGTGCTGTCTACATGCTGAGTTTTACAGCCTGAATGGCATTTCCATCA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTGCTGTCTACATGCTGAGTTTTACAGCCTGAATGGCATTTCCATCA  700

seq1  TGGGATCAGTTGTTTTAAGGTCTGGGGCCTACTAAGGTCTGAGAACCTGT  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGATCAGTTGTTTTAAGGTCTGGGGCCTACTAAGGTCTGAGAACCTGT  750

seq1  TACAGTCAGCAGCAGCACTTGGAAGATTGGACCCGACAAGACACTACTCT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGTCAGCAGCAGCACTTGGAAGATTGGACCCGACAAGACACTACTCT  800

seq1  CAGAAAAGCCGTGTCAGCATCTGAGTGTTTTCATTTTCCCACAGGAGCAA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAAAGCCGTGTCAGCATCTGAGTGTTTTCATTTTCCCACAGGAGCAA  850

seq1  GGGATAAGAGGAGGGAGGAAGGCAGAGAAATCCAACTGAATGGGTGGGGC  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGATAAGAGGAGGGAGGAAGGCAGAGAAATCCAACTGAATGGGTGGGGC  900

seq1  AGAGAGAATTC  910
      |||||||||||
seq2  AGAGAGAATTC  911

seq1: chr2_129145522_129146652
seq2: B6Ng01-322K02.g_65_1194

seq1  GAATTCATCCCCAGAATTACATAAAAATTGGCCTTTCATAGCTCTTGATG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATCCCCAGAATTACATAAAAATTGGCCTTTCATAGCTCTTGATG  50

seq1  GTTTATAATTGAGTGTTTTATGTTTAAGTCTTTCATTTATTTGGGATTTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTATAATTGAGTGTTTTATGTTTAAGTCTTTCATTTATTTGGGATTTA  100

seq1  GGCATGACTTGAAATTCTATAAGTTTGGCATTGAAACGTAGCCTGCTGTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATGACTTGAAATTCTATAAGTTTGGCATTGAAACGTAGCCTGCTGTC  150

seq1  TCTTAGACAGCCTTTGAGGAAATCAGGGACCAGGGAGTCAGAAGTTTCTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAGACAGCCTTTGAGGAAATCAGGGACCAGGGAGTCAGAAGTTTCTA  200

seq1  TTTCCCTCCTTAGAGGGATGTGAATGTCACTTCCCCTCTTTCTATTTTGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCCTCCTTAGAGGGATGTGAATGTCACTTCCCCTCTTTCTATTTTGT  250

seq1  TTCTTCGAATTCTTTCTTTCCATACTGCAAGACCCGCTAGTTCAGTTCTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTCGAATTCTTTCTTTCCATACTGCAAGACCCGCTAGTTCAGTTCTC  300

seq1  TAGAAATTCCCACGGGCTGAAGGCAAAGCAGAACTAGATGGTGGGGAAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAATTCCCACGGGCTGAAGGCAAAGCAGAACTAGATGGTGGGGAAAT  350

seq1  CTGGGTAATGCTTCTGTATTCATGAAGCTTACCCTACACAGTGACTCAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGTAATGCTTCTGTATTCATGAAGCTTACCCTACACAGTGACTCAAA  400

seq1  TTGCCCAGAGAGATCATCCGTTTCTTCTAGACTTCTCCATTTTTCTAGTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCCAGAGAGATCATCCGTTTCTTCTAGACTTCTCCATTTTTCTAGTC  450

seq1  CAGACTCCAGTCATCACAGAATCCCCTTCTACTCTCCTGCACCCCCAGGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACTCCAGTCATCACAGAATCCCCTTCTACTCTCCTGCACCCCCAGGC  500

seq1  GACCTCGAGTCAGTCCTCACTTCCTTCTGCCTGTCCATTCCTTCCATCCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTCGAGTCAGTCCTCACTTCCTTCTGCCTGTCCATTCCTTCCATCCC  550

seq1  CTGGCCGCCACCATCAGACTGATCACCGATTTCCTTCACCCACTCTTTCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCCGCCACCATCAGACTGATCACCGATTTCCTTCACCCACTCTTTCC  600

seq1  TCACCATACTCCTGGAGGATGAGTCACTTCTGGTGCTCATCTGTCATGTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCATACTCCTGGAGGATGAGTCACTTCTGGTGCTCATCTGTCATGTT  650

seq1  TGTCACTCTCAGAATCTCTCATGTTACATTTATATCTTTGCTTAATTCCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCACTCTCAGAATCTCTCATGTTACATTTATATCTTTGCTTAATTCCT  700

seq1  AGAATTCCTCATTGTTCACAATTGAAAGTTCAAATGCTAAAAACCCTACA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATTCCTCATTGTTCACAATTGAAAGTTCAAATGCTAAAAACCCTACA  750

seq1  GACACAGGAACCATAGAGCCTCACATAGGAGTTCATCACCAAAACT-AAA  799
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  GACACAGGAACCATAGAGCCTCACATAGGAGTTCATCACCAAAACTAAAA  800

seq1  AAAGATTGTTATTGTCCTTGATTAGCTGACTGGCTGGCTGGTGTTTTGAG  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGATTGTTATTGTCCTTGATTAGCTGACTGGCTGGCTGGTGTTTTGAG  850

seq1  AAAAGATCTTGCTCCTATAATTCGCCTATAAAATTTGGTACTACTCAATC  899
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  AAAAGATCTTGCTCCTATAATTCGCCTAT-AAATTTGGTACTACTCAATC  899

seq1  TACATTCAA-TTTTTTTTTAAATAAAGATTTAAGAAAATTGCTAGTATGT  948
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  TACATTCAATTTTTTTTTTAAATAAAGATTTAAGAAAATTGCTAGTATGT  949

seq1  ACATTT-GGTAGTTAGTATTAGTTGTCAACCAGA-CACATCTAGGATCAC  996
      |||||| ||||||||||||||||||||||||||| |||||||||||||||
seq2  ACATTTGGGTAGTTAGTATTAGTTGTCAACCAGACCACATCTAGGATCAC  999

seq1  CTGGGAAGAGAGGTGAGAGACTGTCTCCATCAGGCTGGCCT-GGGGGTGA  1045
      || || |||||||||||||||||||| ||||||||||| || ||||||||
seq2  CTTGGGAGAGAGGTGAGAGACTGTCT-CATCAGGCTGGGCTGGGGGGTGA  1048

seq1  CTGTCTTAATTAAGTTAATTGA-TGTGGGAAGACCCATCCCACT-GGGGG  1093
      ||||||||||  || | ||||| ||| || ||| |||| ||||| |||||
seq2  CTGTCTTAAT--AGGTTATTGATTGTTGG-AGA-CCATTCCACTGGGGGG  1094

seq1  TGGCACCATTCCCTAGCCAGGGGATTCTGAATCTTGTA  1131
      ||||||   |||||||||| || || ||||||| ||||
seq2  TGGCAC--ATCCCTAGCCATGGAATCCTGAATCCTGTA  1130

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information