MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-332B09
Chromosome	2 (Build37)
Map Location	85,474,535 - 85,607,221
singlet/doublet	doublet
Overlap gene	Olfr1002, GA_x5J8B7W531T-1558688-1559570, Olfr1004-ps1, Olfr154, GA_x5J8B7W531T-1577060-1577325, Olfr1006, GA_x5J8B7W531T-1588603-1588734, Olfr1008, Olfr1009, Olfr1010, Olfr1012
Upstream gene	Ctnnd1, 2700094K13Rik, Txndc14, Med19, Zdhhc5, Clp1, Ypel4, Serping1, Ube2l6, Smtnl1, Timm10, Slc43a1, Rtn4rl2, Slc43a3, Prg2, Prg3, P2rx3, Ssrp1, Tnks1bp1, Agtrl1, LOC625033, Lrrc55, Olfr987, GA_x5J8B7W531T-1241080-1240524, Olfr988, GA_x5J8B7W531T-1286425-1285652, Olfr990-ps1, Olfr991-ps1, Olfr992, Olfr993, Olfr994, Olfr995, 4833423E24Rik, Olfr996, Olfr997-ps1, Olfr998, Olfr999-ps1, Olfr1000, Olfr1001-ps1
Downstream gene	Olfr1013, Olfr1014, Olfr1015, Olfr1016, GA_x5J8B7W3KVV-518538-519236, Olfr1018, Olfr1019, Olfr1020, Olfr1021-ps1, Olfr1022, Olfr1023, Olfr1024, Olfr1025-ps1, Olfr1026, Olfr1027-ps1, Olfr1028, Olfr1029, Olfr1030, Olfr1031, Olfr1032, LOC100042075, Olfr1033, Olfr1034, Olfr1533-ps1, Olfr1035-ps1, Olfr1036, Olfr1037, LOC100041372, Olfr1038, Olfr1039, Olfr1040, GA_x5J8B7W3KVV-170014-170572, Olfr1042, Olfr1043, Olfr1044, Olfr52, Olfr1045, Olfr1046, Olfr1047, Olfr1048, Olfr1049, Olfr1050-ps1, Olfr1051, GA_x5J8B7W3KVV-25848-25992, Olfr1052, Olfr1053-ps1, Olfr1054, Olfr1055, Olfr1056, Olfr1057, GA_x5J8B7TRQ4E-1174-939, Olfr1058, Olfr1059-ps1, Olfr1515, Olfr1062, Olfr1063-ps1, Olfr1064-ps1, Olfr1065, Olfr1066, Olfr1069-ps1, Olfr1070-ps1, Olfr228, Olfr1073-ps1, Olfr1075-ps1, GA_x5J8B7W4CQV-104617-103730, Olfr1076, LOC625853, Olfr1078-ps1, GA_x5J8B7W4CQV-78329-78805, Olfr1079, Olfr1080, Olfr1081-ps1, Olfr1082, GA_x5J8B7W4CQV-18360-18784, Olfr1083, Olfr1084, Olfr1085, Olfr1086, Olfr1087, Olfr1088-ps1, Olfr1089, Olfr1090
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ctnnd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12388 MGI:105100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700094K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72657 MGI:1919907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Txndc14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66958 MGI:1914208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381379 MGI:1914234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228136 MGI:1923573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98985 MGI:2138968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ypel4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241525 MGI:3605071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serping1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12258 MGI:894696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2l6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56791 MGI:1914500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smtnl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68678 MGI:1915928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30059 MGI:1353429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc43a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72401 MGI:1931352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Rtn4rl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269295 MGI:2669796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc43a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58207 MGI:1931054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19074 MGI:103294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53856 MGI:1858200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228139 MGI:1097160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20833 MGI:107912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnks1bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228140 MGI:2446193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agtrl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23796 MGI:1346086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625033 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Lrrc55 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241528 MGI:2685197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr987 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257951 MGI:3030821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1241080-1240524 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257732
definition	note : olfactory receptor GA_x5J8B7W531T-1241080-1240524 pseudo : _no_value

name	Olfr988 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258166 MGI:3030822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1286425-1285652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257816
definition	note : olfactory receptor GA_x5J8B7W531T-1286425-1285652 pseudo : _no_value

name	Olfr990-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258009 MGI:3030824
definition	gene_synonym : MOR203-6P note : olfactory receptor 990, pseudogene 1 pseudo : _no_value

name	Olfr991-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404455 MGI:3030825
definition	note : olfactory receptor 991, pseudogene 1 pseudo : _no_value

name	Olfr992 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258865 MGI:3030826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr993 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258427 MGI:3030827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr994 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258425 MGI:3030828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr995 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258426 MGI:3030829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4833423E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228151 MGI:2687041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr996 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258429 MGI:3030830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr997-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257998 MGI:3030831
definition	gene_synonym : MOR175-8P note : olfactory receptor 997, pseudogene 1 pseudo : _no_value

name	Olfr998 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258428 MGI:3030832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr999-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258076 MGI:3030833
definition	gene_synonym : MOR175-7P note : olfactory receptor 999, pseudogene 1 pseudo : _no_value

name	Olfr1000 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257899 MGI:3030834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1001-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258078 MGI:3030835
definition	gene_synonym : MOR175-6 note : olfactory receptor 1001, pseudogene 1 pseudo : _no_value

name	Olfr1002 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258566 MGI:3030836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1558688-1559570 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257814
definition	note : olfactory receptor GA_x5J8B7W531T-1558688-1559570 pseudo : _no_value

name	Olfr1004-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258244 MGI:3030838
definition	gene_synonym : GA_x5J8B7W2F7R-2521-3120; MOR213-8 note : olfactory receptor 1004, pseudogene 1 pseudo : _no_value

name	Olfr154 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27216 MGI:1351316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1577060-1577325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257813
definition	note : olfactory receptor GA_x5J8B7W531T-1577060-1577325 pseudo : _no_value

name	Olfr1006 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258563 MGI:3030840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1588603-1588734 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257812
definition	note : olfactory receptor GA_x5J8B7W531T-1588603-1588734 pseudo : _no_value

name	Olfr1008 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258866 MGI:3030842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1009 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258565 MGI:3030843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1010 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258255 MGI:3030844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1012 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258561 MGI:3030846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1013 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258757 MGI:3030847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1014 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258562 MGI:3030848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1015 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258564 MGI:3030849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1016 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257915 MGI:3030850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3KVV-518538-519236 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257840
definition	note : olfactory receptor GA_x5J8B7W3KVV-518538-519236 pseudo : _no_value

name	Olfr1018 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258579 MGI:3030852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1019 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259017 MGI:3030853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1020 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258573 MGI:3030854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1021-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258574 MGI:3030855
definition	gene_synonym : MOR201-1 note : olfactory receptor 1021, pseudogene 1 pseudo : _no_value

name	Olfr1022 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258582 MGI:3030856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1023 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258580 MGI:3030857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1024 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257900 MGI:3030858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1025-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258083 MGI:3030859
definition	gene_synonym : MOR196-5P; MOR196-6_p note : olfactory receptor 1025, pseudogene 1 pseudo : _no_value

name	Olfr1026 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258577 MGI:3030860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1027-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258082 MGI:3030861
definition	gene_synonym : MOR198-2P; MOR198-5_p note : olfactory receptor 1027, pseudogene 1 pseudo : _no_value

name	Olfr1028 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257936 MGI:3030862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1029 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258154 MGI:3030863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1030 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258581 MGI:3030864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1031 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257916 MGI:3030865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1032 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258572 MGI:3030866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042075 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs

name	Olfr1033 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258571 MGI:3030867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1034 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258216 MGI:3030868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1533-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258080 MGI:3031367
definition	gene_synonym : MOR227-8P note : olfactory receptor 1533, pseudogene 1 pseudo : _no_value

name	Olfr1035-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258081 MGI:3030869
definition	gene_synonym : MOR171-31P note : olfactory receptor 1035, pseudogene 1 pseudo : _no_value

name	Olfr1036 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258245 MGI:3030870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1037 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259151 MGI:3030871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr1038 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259015 MGI:3030872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1039 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257950 MGI:3030873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr1040 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404323 MGI:3030874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3KVV-170014-170572 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257843
definition	note : olfactory receptor GA_x5J8B7W3KVV-170014-170572 pseudo : _no_value

name	Olfr1042 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257941 MGI:3030876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1043 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258570 MGI:3030877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1044 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259013 MGI:3030878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18352 MGI:1333748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1045 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259019 MGI:3030879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1046 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258575 MGI:3030880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1047 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259014 MGI:3030881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1048 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259016 MGI:3030882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1049 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259018 MGI:3030883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1050-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404461 MGI:3030884
definition	gene_synonym : MOR194-2_p note : olfactory receptor 1050, pseudogene 1 pseudo : _no_value

name	Olfr1051 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404324 MGI:3030885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3KVV-25848-25992 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257842
definition	note : olfactory receptor GA_x5J8B7W3KVV-25848-25992 pseudo : _no_value

name	Olfr1052 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259012 MGI:3030886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1053-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257974 MGI:3030887
definition	gene_synonym : MOR187-4 note : olfactory receptor 1053, pseudogene 1 pseudo : _no_value

name	Olfr1054 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259021 MGI:3030888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1055 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259023 MGI:3030889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1056 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259020 MGI:3030890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1057 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404325 MGI:3030891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7TRQ4E-1174-939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257867
definition	note : olfactory receptor GA_x5J8B7TRQ4E-1174-939 pseudo : _no_value

name	Olfr1058 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258386 MGI:3030892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1059-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404462 MGI:3030893
definition	gene_synonym : MOR190-6_p note : olfactory receptor 1059, pseudogene 1 pseudo : _no_value

name	Olfr1515 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259022 MGI:3031349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr1062 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259082 MGI:3030896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1063-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259140 MGI:3030897
definition	gene_synonym : MOR190-3P note : olfactory receptor 1063, pseudogene 1 pseudo : _no_value

name	Olfr1064-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404463 MGI:3030898
definition	note : olfactory receptor 1064, pseudogene 1 pseudo : _no_value

name	Olfr1065 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258403 MGI:3030899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1066 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257880 MGI:3030900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1069-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404465 MGI:3030903
definition	gene_synonym : MOR189-8_p note : olfactory receptor 1069, pseudogene 1 pseudo : _no_value

name	Olfr1070-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404466 MGI:3030904
definition	note : olfactory receptor 1070, pseudogene 1 pseudo : _no_value

name	Olfr228 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258400 MGI:3030062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1073-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257989 MGI:3030907
definition	gene_synonym : MOR188-6P note : olfactory receptor 1073, pseudogene 1 pseudo : _no_value

name	Olfr1075-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404470 MGI:3030909
definition	note : olfactory receptor 1075, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W4CQV-104617-103730 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257829
definition	note : olfactory receptor GA_x5J8B7W4CQV-104617-103730 pseudo : _no_value

name	Olfr1076 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258401 MGI:3030910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625853 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins

name	Olfr1078-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404471 MGI:3030912
definition	note : olfactory receptor 1078, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W4CQV-78329-78805 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257825
definition	note : olfactory receptor GA_x5J8B7W4CQV-78329-78805 pseudo : _no_value

name	Olfr1079 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258402 MGI:3030913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1080 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258404 MGI:3030914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1081-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404472 MGI:3030915
definition	gene_synonym : MOR191-4_p note : olfactory receptor 1081, pseudogene 1 pseudo : _no_value

name	Olfr1082 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404473 MGI:3030916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W4CQV-18360-18784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257826
definition	note : olfactory receptor GA_x5J8B7W4CQV-18360-18784 pseudo : _no_value

name	Olfr1083 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404326 MGI:3030917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1084 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258235 MGI:3030918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1085 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258583 MGI:3030919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1086 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258585 MGI:3030920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1087 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258843 MGI:3030921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1088-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404474 MGI:3030922
definition	note : olfactory receptor 1088, pseudogene 1 pseudo : _no_value

name	Olfr1089 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257933 MGI:3030923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1090 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258844 MGI:3030924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctnnd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131110 GeneID:12388 MGI:105100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catenin (cadherin associated protein), delta 1 transcript_id : NM_007615.3

name	2700094K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82546882 GeneID:72657 MGI:1919907
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700094K13 gene transcript_id : NM_001037279.1

name	2700094K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82546880 GeneID:72657 MGI:1919907
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700094K13 gene transcript_id : NM_001033166.2

name	Txndc14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385816 GeneID:66958 MGI:1914208
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 14 transcript_id : NM_025868.2

name	Med19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922679 GeneID:381379 MGI:1914234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 19 homolog (yeast) transcript_id : NM_025885.2

name	Zdhhc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476269 GeneID:228136 MGI:1923573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 5 transcript_id : NM_144887.3

name	Clp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130843 GeneID:98985 MGI:2138968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae) transcript_id : NM_133840.2

name	Ypel4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53292601 GeneID:241525 MGI:3605071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : yippee-like 4 (Drosophila) transcript_id : NM_001005342.2

name	Serping1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370111 GeneID:12258 MGI:894696
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade G, member 1 transcript_id : NM_009776.2

name	Ube2l6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910601 GeneID:56791 MGI:1914500
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2L 6 transcript_id : NM_019949.1

name	Smtnl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129859 GeneID:68678 MGI:1915928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : smoothelin-like 1 transcript_id : NM_024230.2

name	Timm10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305574 GeneID:30059 MGI:1353429
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 10 homolog (yeast) transcript_id : NM_013899.1

name	Slc43a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139949131 GeneID:72401 MGI:1931352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 1 transcript_id : NM_001081349.2

name	Slc43a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948640 GeneID:72401 MGI:1931352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 1 transcript_id : NM_024497.1

name	Slc43a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948178 GeneID:72401 MGI:1931352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 1 transcript_id : NM_001083809.1

name	Rtn4rl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40363806 GeneID:269295 MGI:2669796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 4 receptor-like 2 transcript_id : NM_199223.1

name	Slc43a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120587004 GeneID:58207 MGI:1931054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 3 transcript_id : NM_021398.2

name	Prg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376074 GeneID:19074 MGI:103294
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteoglycan 2, bone marrow transcript_id : NM_008920.3

name	Prg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130834 GeneID:53856 MGI:1858200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteoglycan 3 transcript_id : NM_016914.2

name	P2rx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781757 GeneID:228139 MGI:1097160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 3 transcript_id : NM_145526.2

name	Ssrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366943 GeneID:20833 MGI:107912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : structure specific recognition protein 1 transcript_id : NM_182990.3

name	Tnks1bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486922 GeneID:228140 MGI:2446193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tankyrase 1 binding protein 1 transcript_id : NM_001081260.1

name	Agtrl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542120 GeneID:23796 MGI:1346086
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiotensin receptor-like 1 transcript_id : NM_011784.2

name	LOC625033 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367084 GeneID:625033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC625033 transcript_id : XM_898561.2

name	Lrrc55 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796638 GeneID:241528 MGI:2685197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 55 transcript_id : NM_001033346.2

name	Olfr987 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801339 GeneID:257951 MGI:3030821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 987 transcript_id : NM_001011785.1

name	Olfr988 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372139 GeneID:258166 MGI:3030822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 988 transcript_id : NM_001011534.1

name	Olfr992 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129146 GeneID:258865 MGI:3030826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 992 transcript_id : NM_146865.1

name	Olfr993 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27544950 GeneID:258427 MGI:3030827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 993 transcript_id : NM_146435.1

name	Olfr994 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239125 GeneID:258425 MGI:3030828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 994 transcript_id : NM_146433.1

name	Olfr995 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239123 GeneID:258426 MGI:3030829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 995 transcript_id : NM_146434.1

name	4833423E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157489 GeneID:228151 MGI:2687041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833423E24 gene transcript_id : NM_001081664.1

name	Olfr996 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239183 GeneID:258429 MGI:3030830
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 996 transcript_id : NM_146437.1

name	Olfr998 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239185 GeneID:258428 MGI:3030832
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 998 transcript_id : NM_146436.1

name	Olfr1000 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58743311 GeneID:257899 MGI:3030834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1000 transcript_id : NM_001011695.1

name	Olfr1002 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583706 GeneID:258566 MGI:3030836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1002 transcript_id : NM_146573.2

name	Olfr154 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305340 GeneID:27216 MGI:1351316
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 154 transcript_id : NM_013728.1

name	Olfr1006 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983508 GeneID:258563 MGI:3030840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1006 transcript_id : NM_146570.2

name	Olfr1008 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129140 GeneID:258866 MGI:3030842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1008 transcript_id : NM_146866.1

name	Olfr1009 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129498 GeneID:258565 MGI:3030843
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1009 transcript_id : NM_146572.1

name	Olfr1010 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821663 GeneID:258255 MGI:3030844
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1010 transcript_id : NM_207149.2

name	Olfr1012 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129506 GeneID:258561 MGI:3030846
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1012 transcript_id : NM_146568.1

name	Olfr1013 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583642 GeneID:258757 MGI:3030847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1013 transcript_id : NM_146762.2

name	Olfr1014 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582636 GeneID:258562 MGI:3030848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1014 transcript_id : NM_146569.2

name	Olfr1015 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129504 GeneID:258564 MGI:3030849
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1015 transcript_id : NM_146571.1

name	Olfr1016 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801303 GeneID:257915 MGI:3030850
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1016 transcript_id : NM_001011758.1

name	Olfr1018 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583728 GeneID:258579 MGI:3030852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1018 transcript_id : NM_146586.2

name	Olfr1019 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128910 GeneID:259017 MGI:3030853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1019 transcript_id : NM_147015.1

name	Olfr1020 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129488 GeneID:258573 MGI:3030854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1020 transcript_id : NM_146580.1

name	Olfr1022 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129468 GeneID:258582 MGI:3030856
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1022 transcript_id : NM_146589.1

name	Olfr1023 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195675 GeneID:258580 MGI:3030857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1023 transcript_id : NM_146587.2

name	Olfr1024 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52421325 GeneID:257900 MGI:3030858
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1024 transcript_id : NM_001005230.1

name	Olfr1026 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583708 GeneID:258577 MGI:3030860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1026 transcript_id : NM_146584.2

name	Olfr1028 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801323 GeneID:257936 MGI:3030862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1028 transcript_id : NM_001011774.1

name	Olfr1029 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801461 GeneID:258154 MGI:3030863
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1029 transcript_id : NM_001011852.1

name	Olfr1030 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129472 GeneID:258581 MGI:3030864
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1030 transcript_id : NM_146588.1

name	Olfr1031 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801305 GeneID:257916 MGI:3030865
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1031 transcript_id : NM_001011759.1

name	Olfr1032 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129486 GeneID:258572 MGI:3030866
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1032 transcript_id : NM_146579.1

name	LOC100042075 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249883 GeneID:100042075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs product : similar to gag protein transcript_id : XM_001477698.1

name	Olfr1033 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84697029 GeneID:258571 MGI:3030867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1033 transcript_id : NM_146578.2

name	Olfr1034 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801503 GeneID:258216 MGI:3030868
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1034 transcript_id : NM_001011872.1

name	Olfr1036 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369492 GeneID:258245 MGI:3030870
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1036 transcript_id : NM_207142.1

name	Olfr1037 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372135 GeneID:259151 MGI:3030871
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1037 transcript_id : NM_001011532.1

name	Olfr1038 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983542 GeneID:259015 MGI:3030872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1038 transcript_id : NM_147013.2

name	Olfr1039 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801337 GeneID:257950 MGI:3030873
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 1039 transcript_id : NM_001011784.1

name	Olfr1040 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807190 GeneID:404323 MGI:3030874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1040 transcript_id : NM_207561.2

name	Olfr1042 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801329 GeneID:257941 MGI:3030876
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1042 transcript_id : NM_001011777.1

name	Olfr1043 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195668 GeneID:258570 MGI:3030877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1043 transcript_id : NM_146577.2

name	Olfr1044 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128918 GeneID:259013 MGI:3030878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1044 transcript_id : NM_147011.1

name	Olfr52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22208857 GeneID:18352 MGI:1333748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 52 transcript_id : NM_146583.1

name	Olfr1045 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735413 GeneID:259019 MGI:3030879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1045 transcript_id : NM_147017.2

name	Olfr1046 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129484 GeneID:258575 MGI:3030880
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1046 transcript_id : NM_146582.1

name	Olfr1047 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128912 GeneID:259014 MGI:3030881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1047 transcript_id : NM_147012.1

name	Olfr1048 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128908 GeneID:259016 MGI:3030882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1048 transcript_id : NM_147014.1

name	Olfr1049 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056730 GeneID:259018 MGI:3030883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1049 transcript_id : NM_147016.2

name	Olfr1051 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430575 GeneID:404324 MGI:3030885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1051 transcript_id : NM_207562.1

name	Olfr1052 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128916 GeneID:259012 MGI:3030886
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1052 transcript_id : NM_147010.1

name	Olfr1054 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128900 GeneID:259021 MGI:3030888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1054 transcript_id : NM_147019.1

name	Olfr1055 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128896 GeneID:259023 MGI:3030889
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1055 transcript_id : NM_147021.1

name	Olfr1056 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27544964 GeneID:259020 MGI:3030890
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1056 transcript_id : NM_147018.1

name	Olfr1057 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807187 GeneID:404325 MGI:3030891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1057 transcript_id : NM_207563.2

name	Olfr1058 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671316 GeneID:258386 MGI:3030892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1058 transcript_id : NM_146391.2

name	Olfr1515 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128902 GeneID:259022 MGI:3031349
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 1515 transcript_id : NM_147020.1

name	Olfr1062 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301220 GeneID:259082 MGI:3030896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1062 transcript_id : NM_147078.2

name	Olfr1065 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575925 GeneID:258403 MGI:3030899
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1065 transcript_id : NM_146408.1

name	Olfr1066 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801263 GeneID:257880 MGI:3030900
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1066 transcript_id : NM_001011735.1

name	Olfr228 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174771 GeneID:258400 MGI:3030062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 228 transcript_id : NM_146405.2

name	Olfr1076 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239151 GeneID:258401 MGI:3030910
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1076 transcript_id : NM_146406.1

name	LOC625853 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249879 GeneID:625853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins product : similar to olfactory receptor MOR189-2 transcript_id : XM_001476746.1

name	Olfr1079 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239157 GeneID:258402 MGI:3030913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1079 transcript_id : NM_146407.1

name	Olfr1080 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665724 GeneID:258404 MGI:3030914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1080 transcript_id : NM_146409.2

name	Olfr1082 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983510 GeneID:404473 MGI:3030916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1082 transcript_id : NM_207674.2

name	Olfr1083 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056732 GeneID:404326 MGI:3030917
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1083 transcript_id : NM_207564.2

name	Olfr1084 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953201 GeneID:258235 MGI:3030918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1084 transcript_id : NM_207135.2

name	Olfr1085 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129470 GeneID:258583 MGI:3030919
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1085 transcript_id : NM_146590.1

name	Olfr1086 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129466 GeneID:258585 MGI:3030920
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1086 transcript_id : NM_146592.1

name	Olfr1087 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129174 GeneID:258843 MGI:3030921
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1087 transcript_id : NM_146846.1

name	Olfr1089 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801319 GeneID:257933 MGI:3030923
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1089 transcript_id : NM_001011771.1

name	Olfr1090 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129168 GeneID:258844 MGI:3030924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1090 transcript_id : NM_146847.1

name	2700094K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76781489 CCDS:CCDS16187.1 GeneID:72657 MGI:1919907
definition	GO_function : GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA] codon_start : 1 product : selenoprotein H protein_id : NP_001028338.1 transl_except : (pos:complement(84510538..84510540),aa:Sec)

name	2700094K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82546883 CCDS:CCDS16187.1 GeneID:72657 MGI:1919907
definition	GO_function : GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA] codon_start : 1 product : selenoprotein H protein_id : NP_001032356.1 transl_except : (pos:complement(84510538..84510540),aa:Sec)

name	Txndc14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313210 CCDS:CCDS16188.1 GeneID:66958 MGI:1914208
definition	GO_function : GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 product : thioredoxin-related transmembrane protein 2 protein_id : NP_080144.1

name	Med19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313194 CCDS:CCDS16189.1 GeneID:381379 MGI:1914234
definition	GO_component : GO:0000119 - mediator complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : lung cancer metastasis-related protein 1 homolog protein_id : NP_080161.1

name	Zdhhc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450253 CCDS:CCDS16190.1 GeneID:228136 MGI:1923573
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, DHHC domain containing 5 protein_id : NP_659136.1

name	Clp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527056 CCDS:CCDS16191.1 GeneID:98985 MGI:2138968
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : ATP/GTP-binding protein protein_id : NP_598601.1

name	Ypel4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52693937 CCDS:CCDS16192.1 GeneID:241525 MGI:3605071
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : yippee-like 4 protein_id : NP_001005342.1

name	Serping1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753218 CCDS:CCDS16193.1 GeneID:12258 MGI:894696
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0006956 - complement activation [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : complement component 1 inhibitor; serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1 product : serine (or cysteine) proteinase inhibitor, clade G, member 1 protein_id : NP_033906.1

name	Ube2l6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910602 CCDS:CCDS16194.1 GeneID:56791 MGI:1914500
definition	GO_function : GO:0042296 - ISG15 conjugating enzyme activity [Evidence IDA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008639 - small protein conjugating enzyme activity [Evidence IDA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0032020 - ISG15-protein conjugation [Evidence IDA]; GO:0019941 - modification-dependent protein catabolism [Evidence IDA]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ubiquitin-conjugating enzyme 8 product : E2 ubiquitin conjugating enzyme protein_id : NP_064333.1

name	Smtnl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195656 CCDS:CCDS16195.1 GeneID:68678 MGI:1915928
definition	codon_start : 1 note : calponin homology-associated smooth muscle protein product : smoothelin-like 1 protein_id : NP_077192.1

name	Timm10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305575 GeneID:30059 MGI:1353429
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy product : translocase of inner mitochondrial membrane 13 homolog a protein_id : NP_038927.1

name	Slc43a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139949132 GeneID:72401 MGI:1931352
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA]; GO:0015175 - neutral amino acid transporter activity [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0015804 - neutral amino acid transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; prostate cancer overexpressed gene 1 product : solute carrier family 43, member 1 isoform 1 protein_id : NP_001074818.2

name	Slc43a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948179 GeneID:72401 MGI:1931352
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA]; GO:0015175 - neutral amino acid transporter activity [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0015804 - neutral amino acid transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; prostate cancer overexpressed gene 1 product : solute carrier family 43, member 1 isoform 3 protein_id : NP_001077278.1

name	Slc43a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948641 GeneID:72401 MGI:1931352
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA]; GO:0015175 - neutral amino acid transporter activity [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0015804 - neutral amino acid transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; prostate cancer overexpressed gene 1 product : solute carrier family 43, member 1 isoform 2 protein_id : NP_078773.1

name	Rtn4rl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40363807 CCDS:CCDS16197.1 GeneID:269295 MGI:2669796
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0031103 - axon regeneration [Evidence TAS] codon_start : 1 note : nogo-66 receptor-related protein 2; nogo receptor-like 3; nogo-66 receptor homolog 1 product : reticulon 4 receptor-like 2 protein_id : NP_954693.1

name	Slc43a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120587005 GeneID:58207 MGI:1931054
definition	codon_start : 1 note : selectively expressed in embryonic epithelia protein-1; embryonic epithelial gene 1 product : solute carrier family 43, member 3 protein_id : NP_067373.2

name	Prg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679457 CCDS:CCDS16198.1 GeneID:19074 MGI:103294
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : proteoglycan 2, bone marrow protein_id : NP_032946.1

name	Prg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394042 CCDS:CCDS16199.1 GeneID:53856 MGI:1858200
definition	GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : major basic protein 2 product : proteoglycan 3 protein_id : NP_058610.1

name	P2rx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781758 CCDS:CCDS16200.1 GeneID:228139 MGI:1097160
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004931 - ATP-gated cation channel activity [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : P2X purinoceptor 3 product : purinergic receptor P2X3 protein_id : NP_663501.2

name	Ssrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111154063 GeneID:20833 MGI:107912
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : structure specific recognition protein 1 protein_id : NP_892035.2

name	Tnks1bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486923 GeneID:228140 MGI:2446193
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : tankyrase 1 binding protein 1 protein_id : NP_001074729.1

name	Agtrl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753014 CCDS:CCDS16201.1 GeneID:23796 MGI:1346086
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : apelin receptor product : angiotensin II receptor-like 1 protein_id : NP_035914.1

name	LOC625033 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82886411 GeneID:625033
definition	codon_start : 1 product : hypothetical protein protein_id : XP_903654.1

name	Lrrc55 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701836 GeneID:241528 MGI:2685197
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 55 protein_id : NP_001028518.1

name	Olfr987 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801340 CCDS:CCDS16203.1 GeneID:257951 MGI:3030821
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-46808500-46807571; olfactory receptor MOR203-7P product : olfactory receptor 987 protein_id : NP_001011785.1

name	Olfr988 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372140 CCDS:CCDS16204.1 GeneID:258166 MGI:3030822
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-46830591-46829662; olfactory receptor MOR203-5P product : olfactory receptor 988 protein_id : NP_001011534.1

name	Olfr992 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129147 CCDS:CCDS16205.1 GeneID:258865 MGI:3030826
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-46877170-46876241; olfactory receptor MOR203-1 product : olfactory receptor 992 protein_id : NP_667076.1

name	Olfr993 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27544951 CCDS:CCDS16206.1 GeneID:258427 MGI:3030827
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-46891524-46890580; olfactory receptor MOR203-2 product : olfactory receptor 993 protein_id : NP_666646.1

name	Olfr994 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239126 CCDS:CCDS16207.1 GeneID:258425 MGI:3030828
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-46907515-46906571; olfactory receptor MOR203-4 product : olfactory receptor 994 protein_id : NP_666644.1

name	Olfr995 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239124 CCDS:CCDS16208.1 GeneID:258426 MGI:3030829
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-46915844-46914897; olfactory receptor MOR203-3 product : olfactory receptor 995 protein_id : NP_666645.1

name	4833423E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157490 GeneID:228151 MGI:2687041
definition	codon_start : 1 product : hypothetical protein LOC228151 protein_id : NP_001075133.1

name	Olfr996 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239184 CCDS:CCDS16209.1 GeneID:258429 MGI:3030830
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47058060-47059004; olfactory receptor MOR175-4 product : olfactory receptor 996 protein_id : NP_666648.1

name	Olfr998 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239186 CCDS:CCDS16210.1 GeneID:258428 MGI:3030832
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47069356-47070300; olfactory receptor MOR175-5 product : olfactory receptor 998 protein_id : NP_666647.1

name	Olfr1000 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58743312 CCDS:CCDS16211.1 GeneID:257899 MGI:3030834
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47087719-47086775; olfactory receptor MOR175-9 product : olfactory receptor 1000 protein_id : NP_001011695.1

name	Olfr1002 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583707 CCDS:CCDS16212.1 GeneID:258566 MGI:3030836
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47127746-47126790; olfactory receptor MOR175-2 product : olfactory receptor 1002 protein_id : NP_666784.2

name	Olfr154 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305341 CCDS:CCDS16213.1 GeneID:27216 MGI:1351316
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor MOR175-1; olfactory receptor 4 cluster, gene 3; GA_x6K02T2Q125-47143827-47142871 product : olfactory receptor 154 protein_id : NP_038756.1

name	Olfr1006 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983509 GeneID:258563 MGI:3030840
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47154544-47153606; olfactory receptor MOR213-4 product : olfactory receptor 1006 protein_id : NP_666781.2

name	Olfr1008 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129141 CCDS:CCDS16215.1 GeneID:258866 MGI:3030842
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47170431-47171372; olfactory receptor MOR187-3 product : olfactory receptor 1008 protein_id : NP_667077.1

name	Olfr1009 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129499 CCDS:CCDS16216.1 GeneID:258565 MGI:3030843
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47195323-47196267; olfactory receptor MOR175-3 product : olfactory receptor 1009 protein_id : NP_666783.1

name	Olfr1010 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821664 GeneID:258255 MGI:3030844
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-47228321-47229256; olfactory receptor MOR213-1 product : olfactory receptor 1010 protein_id : NP_997032.2

name	Olfr1012 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129507 CCDS:CCDS16217.1 GeneID:258561 MGI:3030846
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47239120-47238185; olfactory receptor MOR213-6 product : olfactory receptor 1012 protein_id : NP_666779.1

name	Olfr1013 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583643 CCDS:CCDS16218.1 GeneID:258757 MGI:3030847
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47248551-47249468; olfactory receptor MOR213-2 product : olfactory receptor 1013 protein_id : NP_666973.2

name	Olfr1014 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582637 CCDS:CCDS16219.1 GeneID:258562 MGI:3030848
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47255337-47256254; olfactory receptor MOR213-5 product : olfactory receptor 1014 protein_id : NP_666780.2

name	Olfr1015 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129505 CCDS:CCDS16220.1 GeneID:258564 MGI:3030849
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47264151-47265089; olfactory receptor MOR213-3 product : olfactory receptor 1015 protein_id : NP_666782.1

name	Olfr1016 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801304 CCDS:CCDS16221.1 GeneID:257915 MGI:3030850
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47278889-47277960; olfactory receptor MOR213-9 product : olfactory receptor 1016 protein_id : NP_001011758.1

name	Olfr1018 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583729 CCDS:CCDS16222.1 GeneID:258579 MGI:3030852
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47301584-47302519; olfactory receptor MOR260-5 product : olfactory receptor 1018 protein_id : NP_666797.2

name	Olfr1019 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128911 CCDS:CCDS16223.1 GeneID:259017 MGI:3030853
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47320309-47319377; olfactory receptor MOR180-1 product : olfactory receptor 1019 protein_id : NP_667226.1

name	Olfr1020 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129489 CCDS:CCDS16224.1 GeneID:258573 MGI:3030854
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47327964-47328917; olfactory receptor MOR201-2 product : olfactory receptor 1020 protein_id : NP_666791.1

name	Olfr1022 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129469 CCDS:CCDS16225.1 GeneID:258582 MGI:3030856
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47347069-47348016; olfactory receptor MOR196-1 product : olfactory receptor 1022 protein_id : NP_666800.1

name	Olfr1023 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195676 CCDS:CCDS16226.1 GeneID:258580 MGI:3030857
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47363965-47364900; olfactory receptor MOR196-3 product : olfactory receptor 1023 protein_id : NP_666798.2

name	Olfr1024 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52421326 CCDS:CCDS16227.1 GeneID:257900 MGI:3030858
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47384320-47383337; olfactory receptor MOR197-1 product : olfactory receptor 1024 protein_id : NP_001005230.1

name	Olfr1026 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583709 CCDS:CCDS16228.1 GeneID:258577 MGI:3030860
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47402610-47403533; olfactory receptor MOR196-4 product : olfactory receptor 1026 protein_id : NP_666795.2

name	Olfr1028 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801324 CCDS:CCDS16229.1 GeneID:257936 MGI:3030862
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47430129-47431103; olfactory receptor MOR198-4 product : olfactory receptor 1028 protein_id : NP_001011774.1

name	Olfr1029 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801462 CCDS:CCDS16230.1 GeneID:258154 MGI:3030863
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47454152-47455126; olfactory receptor MOR198-1P product : olfactory receptor 1029 protein_id : NP_001011852.1

name	Olfr1030 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129473 CCDS:CCDS16231.1 GeneID:258581 MGI:3030864
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47462755-47463693; olfactory receptor MOR196-2 product : olfactory receptor 1030 protein_id : NP_666799.1

name	Olfr1031 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801306 CCDS:CCDS16232.1 GeneID:257916 MGI:3030865
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47470765-47471775; olfactory receptor MOR200-1 product : olfactory receptor 1031 protein_id : NP_001011759.1

name	Olfr1032 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129487 CCDS:CCDS16233.1 GeneID:258572 MGI:3030866
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47485813-47486745; olfactory receptor MOR199-1 product : olfactory receptor 1032 protein_id : NP_666790.1

name	LOC100042075 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249884 GeneID:100042075
definition	codon_start : 1 product : similar to gag protein protein_id : XP_001477748.1

name	Olfr1033 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129493 CCDS:CCDS16234.1 GeneID:258571 MGI:3030867
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47516301-47517233; olfactory receptor MOR199-2 product : olfactory receptor 1033 protein_id : NP_666789.1

name	Olfr1034 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801504 CCDS:CCDS16235.1 GeneID:258216 MGI:3030868
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47521463-47522395; olfactory receptor MOR245-14P product : olfactory receptor 1034 protein_id : NP_001011872.1

name	Olfr1036 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369493 CCDS:CCDS16236.1 GeneID:258245 MGI:3030870
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47549689-47550621; olfactory receptor MOR262-13 product : olfactory receptor 1036 protein_id : NP_997025.1

name	Olfr1037 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372136 CCDS:CCDS16237.1 GeneID:259151 MGI:3030871
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47560740-47559775; olfactory receptor MOR256-34P product : olfactory receptor 1037 protein_id : NP_001011532.1

name	Olfr1038 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128915 GeneID:259015 MGI:3030872
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-47591072-47592031; olfactory receptor MOR185-3 product : olfactory receptor 1038 protein_id : NP_667224.1

name	Olfr1039 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801338 CCDS:CCDS16238.1 GeneID:257950 MGI:3030873
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47600809-47599850; olfactory receptor MOR185-9P product : olfactory receptor 1039 protein_id : NP_001011784.1

name	Olfr1040 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807191 CCDS:CCDS16239.1 GeneID:404323 MGI:3030874
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47615732-47614791 product : olfactory receptor 1040 protein_id : NP_997444.2

name	Olfr1042 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801330 CCDS:CCDS16240.1 GeneID:257941 MGI:3030876
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47629317-47628376; olfactory receptor MOR185-10 product : olfactory receptor 1042 protein_id : NP_001011777.1

name	Olfr1043 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129491 CCDS:CCDS16241.1 GeneID:258570 MGI:3030877
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47631900-47630956; olfactory receptor MOR185-7 product : olfactory receptor 1043 protein_id : NP_666788.1

name	Olfr1044 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128919 CCDS:CCDS16242.1 GeneID:259013 MGI:3030878
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47640742-47639798; olfactory receptor MOR185-4 product : olfactory receptor 1044 protein_id : NP_667222.1

name	Olfr52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208858 CCDS:CCDS16243.1 GeneID:18352 MGI:1333748
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47650922-47649963 product : olfactory receptor 52 protein_id : NP_666794.1

name	Olfr1045 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735414 CCDS:CCDS16244.1 GeneID:259019 MGI:3030879
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47672825-47671878; olfactory receptor MOR185-2 product : olfactory receptor 1045 protein_id : NP_667228.2

name	Olfr1046 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129485 CCDS:CCDS16245.1 GeneID:258575 MGI:3030880
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47692494-47691544; olfactory receptor MOR194-1 product : olfactory receptor 1046 protein_id : NP_666793.1

name	Olfr1047 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128913 CCDS:CCDS16246.1 GeneID:259014 MGI:3030881
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47703682-47702723; olfactory receptor MOR188-3 product : olfactory receptor 1047 protein_id : NP_667223.1

name	Olfr1048 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128909 CCDS:CCDS16247.1 GeneID:259016 MGI:3030882
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47716657-47715716; olfactory receptor MOR187-2 product : olfactory receptor 1048 protein_id : NP_667225.1

name	Olfr1049 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056731 CCDS:CCDS16248.1 GeneID:259018 MGI:3030883
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47735396-47734470; olfactory receptor MOR187-1 product : olfactory receptor 1049 protein_id : NP_667227.2

name	Olfr1051 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430576 CCDS:CCDS16249.1 GeneID:404324 MGI:3030885
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47756192-47755266 product : olfactory receptor 1051 protein_id : NP_997445.1

name	Olfr1052 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128917 CCDS:CCDS16250.1 GeneID:259012 MGI:3030886
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47777498-47778436; olfactory receptor MOR172-1 product : olfactory receptor 1052 protein_id : NP_667221.1

name	Olfr1054 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128901 CCDS:CCDS16251.1 GeneID:259021 MGI:3030888
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47811880-47810942; olfactory receptor MOR188-2 product : olfactory receptor 1054 protein_id : NP_667230.1

name	Olfr1055 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128897 GeneID:259023 MGI:3030889
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-47819205-47818258; olfactory receptor MOR186-1 product : olfactory receptor 1055 protein_id : NP_667232.1

name	Olfr1056 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27544965 CCDS:CCDS16252.1 GeneID:259020 MGI:3030890
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47827833-47826892; olfactory receptor MOR186-2 product : olfactory receptor 1056 protein_id : NP_667229.1

name	Olfr1057 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430586 CCDS:CCDS16253.1 GeneID:404325 MGI:3030891
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47844843-47843896 product : olfactory receptor 1057 protein_id : NP_997446.1

name	Olfr1058 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110671317 CCDS:CCDS16254.1 GeneID:258386 MGI:3030892
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47855818-47854868; olfactory receptor MOR190-2 product : olfactory receptor 1058 protein_id : NP_666503.2

name	Olfr1515 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128903 GeneID:259022 MGI:3031349
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : olfactory receptor MOR188-1 product : olfactory receptor 1515 protein_id : NP_667231.1

name	Olfr1062 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301221 GeneID:259082 MGI:3030896
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47892992-47892045; olfactory receptor MOR185-1 product : olfactory receptor 1062 protein_id : NP_667289.2

name	Olfr1065 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575926 CCDS:CCDS16256.1 GeneID:258403 MGI:3030899
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47915274-47914333; olfactory receptor MOR190-1; odorant receptor B1 product : olfactory receptor 1065 protein_id : NP_666520.1

name	Olfr1066 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801264 CCDS:CCDS16257.1 GeneID:257880 MGI:3030900
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47925557-47924616; olfactory receptor MOR256-52P product : olfactory receptor 1066 protein_id : NP_001011735.1

name	Olfr228 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174772 CCDS:CCDS16258.1 GeneID:258400 MGI:3030062
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T0101M-139-669 product : olfactory receptor 228 protein_id : NP_666517.2

name	Olfr1076 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239152 CCDS:CCDS16259.1 GeneID:258401 MGI:3030910
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47993761-47994702; olfactory receptor MOR189-2 product : olfactory receptor 1076 protein_id : NP_666518.1

name	LOC625853 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249880 GeneID:625853
definition	codon_start : 1 product : similar to olfactory receptor MOR189-2 protein_id : XP_001476796.1

name	Olfr1079 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239158 CCDS:CCDS16260.1 GeneID:258402 MGI:3030913
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48024195-48023254; olfactory receptor MOR189-1 product : olfactory receptor 1079 protein_id : NP_666519.1

name	Olfr1080 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665725 CCDS:CCDS16261.1 GeneID:258404 MGI:3030914
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48039418-48038477; olfactory receptor MOR192-1 product : olfactory receptor 1080 protein_id : NP_666521.2

name	Olfr1082 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983511 GeneID:404473 MGI:3030916
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48079993-48079157; olfactory receptor 1082, pseudogene 1 product : olfactory receptor 1082 protein_id : NP_997557.2

name	Olfr1083 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056733 GeneID:404326 MGI:3030917
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-48092599-48091658 product : olfactory receptor 1083 protein_id : NP_997447.2

name	Olfr1084 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953202 GeneID:258235 MGI:3030918
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48121788-48120847; olfactory receptor MOR192-2 product : olfactory receptor 1084 protein_id : NP_997018.2

name	Olfr1085 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129471 CCDS:CCDS16263.1 GeneID:258583 MGI:3030919
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48147264-48146323; olfactory receptor MOR191-1 product : olfactory receptor 1085 protein_id : NP_666801.1

name	Olfr1086 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129467 CCDS:CCDS16264.1 GeneID:258585 MGI:3030920
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48168771-48167839; olfactory receptor MOR179-2 product : olfactory receptor 1086 protein_id : NP_666803.1

name	Olfr1087 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129175 CCDS:CCDS16265.1 GeneID:258843 MGI:3030921
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48182406-48181465; olfactory receptor MOR188-5 product : olfactory receptor 1087 protein_id : NP_667057.1

name	Olfr1089 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801320 CCDS:CCDS16266.1 GeneID:257933 MGI:3030923
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48226321-48225386; olfactory receptor MOR193-1 product : olfactory receptor 1089 protein_id : NP_001011771.1

name	Olfr1090 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129169 CCDS:CCDS16267.1 GeneID:258844 MGI:3030924
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48247345-48246404; olfactory receptor MOR188-4 product : olfactory receptor 1090 protein_id : NP_667058.1

name	LOC100041372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041372
definition	number : 3 pseudo : _no_value

name	LOC100041372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041372
definition	number : 2 pseudo : _no_value

name	LOC100041372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041372
definition	number : 1 pseudo : _no_value

clone name	MSMg01-538I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079K10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-107E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172N04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488P03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-309O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-235K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211H16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-428B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499J15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-516N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311C11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-405D20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-531N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433H10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-145P09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-530A18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-537H04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-336F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364I01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-337D13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-386P09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-527A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-268N23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-407O08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-502M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114N09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-114O09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137L11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-189E02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464P20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454D06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-396J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173M01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-332B09.b	B6Ng01-332B09.g
ACC	GA118288	GA118289
length	631	1,102
definition	B6Ng01-332B09.b	B6Ng01-332B09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(85,474,535 - 85,475,165)	(85,606,110 - 85,607,221)
sequence	gaattctctttgtgtgagacctaaaatgtggctgtaaactttatgttaaa gagcactgaagtacgaatcagaggccacatgatgaatctggtaatgaagt ttttattctgtttgaaaagtcaagatagtcctaaatagttttatactctg tctctttttgtgatgtggtaatgctagtaaaatatagatgtagattgaga agaaatgcaaatatatactagaagataacttagatgaatatttatatgaa ggtttgattatttttcataatattatttggaatatttgggaatttcacat cgtgtgtgaaatcatacttcccagtcctcccagatctaccctctaccttg tgaccttcccccccccaaaaaaaaagaagaaaaagaaagaaggggggaag gagaaggaggaggagaaggaggagaaggaggaggatcaccacaacaaaac caacaacaaagtctaatttgtgttgcccatatactcactggagcatggtc aaacctccactggtcagtcccttaaagaagagagtccttgctcaccctca tccctgccagaagctatcaattatagagagccacccttaagctttttttt ccacaatgtttaagagttcttttcagggttt	gaattcctcatggttttgcagctcagggaaattacaagcaggacaattaa tcaacagtctgttggtgatgttggtttaatattatttaatgagataaaga aagatagtctatggggtatattcccattgtattcaattgtaatctctaca cattctgtattgttttagtgaattcaaataaatgcatataattatttgca tatttgagcatatatttgtgtgggcatcttcatttatacatggagatatt tgaaaatttataaactcatgtccttaggaatacctacaacaggatataga taagcaaattcttccaaatcaatggccatttttttaatcttgttctatgt cccaagagatttagaaatgagagtgttaactgctaggtgttgtgtcactc tgttttcttgctcatcctctcttcccctctctccttcttcctagttccag aaacattattgtcttttaatcagaacaactgcatggctacagtacttata tatcttacccaaacctttataatttgaaaaagcttctagttttttttttt cctttatgaaaacatccacccacccatcttactctttctggaaatatcaa tccattcgtgctattttttttaagcattaacccttctttattataaacaa tttccatctttccatctgtataatattttttttatttcttaataccatga gacatagtagtattaaatgaatttacaatctattgtgagaattctctccc ttgtggaaggaggactaaggagtgtctatccactcttcatgtgatcccaa tgattaaaaaaaaataaaagttcaatttcaaagttcatactggagaacta tgagtttggattagagacaattggtgcaaagttactgatgggagtgtagg tgacccagaagcagctacaatgaaaagcttttactcagcctgcatgatgg tattttatagtttcataaatagatctttaaaaaaaacataggccagacta aaataaaacttgaaaatcccatttatctgtttggtatattctttctggag tagactcacttcccgtaccagtttttctagtgtcatagttctttcataga ga
quality values	Open. Hide. 62 47 22 41 62 62 62 62 62 62 62 49 49 47 47 49 62 62 47 42 62 62 62 62 62 62 59 47 39 32 27 23 48 28 35 24 27 49 62 62 62 62 62 59 59 62 59 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 59 59 49 62 56 54 59 62 59 62 59 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 54 54 62 62 62 49 54 62 62 62 62 62 62 62 62 54 49 49 54 54 54 54 48 54 62 62 54 54 43 56 35 39 12 18 35 13 10 28 27 11 29 19 28 34 23 45 31 29 46 34 27 29 28 30 23 36 30 30 37 34 27 27 34 34 26 56 34 49 32 34 46 34 27 23 23 12 16 18 18 23 14 19 16 27 23 46 33 25 12 13 17 30 36 24 18 21 13 22 13 17 18 36 24 11 18 18 8 33 18 23 28 23 13 13 19 11 11 18 13 34 18 12 11 17 13 13 23 6 34 39 30 30 13 19 19 34 24 23 30 36 30 27 15 24 11 13 18 11 16 17 17 14 13 18 25 8 16 25 10 13 13 9 23 11 18 24 16 21 30 30 24 24 34 23 43 41 30 41 13 32 10 14 13 18 13 11 18 11 8 12 18 18 11 41 30 20 22 17 13 16 5 8 14 8 11 22 12 8 10 9 10 10 11 15 11 11 24 23 20 23 10 10 31 24 10 30 26	Open. Hide. 62 59 62 59 62 62 62 41 43 28 28 34 32 32 32 28 42 54 59 59 62 62 62 59 59 62 62 54 54 62 62 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 54 38 38 56 46 54 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 47 47 58 58 58 54 54 58 52 58 54 58 58 58 52 58 58 58 52 58 58 49 52 58 58 58 48 58 58 47 46 58 58 58 54 58 58 58 54 51 58 58 58 58 58 53 49 49 47 51 58 54 58 45 47 58 58 58 53 50 58 58 42 50 49 58 58 58 58 58 58 43 48 58 51 54 50 48 43 43 48 48 41 43 48 54 49 50 58 48 46 47 37 52 52 50 58 51 46 49 58 50 58 50 58 50 46 58 58 51 58 49 51 50 37 58 50 58 58 53 50 49 58 58 39 51 40 58 58 58 58 58 58 40 38 37 58 49 53 50 50 51 50 40 47 52 53 37 51 54 54 32 33 39 39 53 50 52 45 54 49 41 49 49 37 52 54 54 41 51 51 35 39 54 49 34 53 46 51 52 53 37 45 52 31 51 32 40 53 39 53 16 31 54 40 53 53 42 32 32 44 39 45 40 27 49 40 52 52 20 47 45 37 46 25 23 31 47 31 9 49 38 33 31 41 24 40 32 32 38 30 53 27 33 39 33 37 53 34 31 31 52 32 34 31 34 31 46 32 24 46 31 31 37 26 26 31 51 51 51 51 51 51 51 31 31 30 46 46 31 31 28 30 31 28 30 32 51 29 30 32 51 32 28 32 31 33 31 28 31 37 34 46 29 29 16 46 31 18 31 34 32 30 42 23 31 48 41 40 31 31 28 36 32 23 46 23 24 13 17 22 18 31 33 35 21 32 33 36 48 36 23 20 41 21 27 31 41 32 30 39 46 31 27 30 34 31 27 16 19 21 26 32 31 26 32 35 31 9 26 25 16 32 32 21 34 34 32 14 24 13 24 31 31 48 48 36 31 31 38 48 48 31 22 21 20 31 13 32 22 25 23 38 31 28 32 32 32 17 23 33 27 20 18 43 43 22 13 9 21 14 18 37 24 11 6 13 19 39 23 18 22 18 25 27 12 19 33 14 33 39 39 39 43 43 43 21 8 11 32 9 16 8 19 25 21 12 33 20 17 13 34 34 20 11 14 47 40 6 13 3 8 21 18 34 34 12 21 13 29 18 18 25 40 14 11 14 18 20 27 12 32 24 11 3 3 3 3 4 21 7 3 4 34 11 12 10 16 11 18 10 10 10 7 28 12 21 11 14 4 3 5 4 27 17 5 2 5 4 4 6 7 16 28 28 25 15 12 5 16 4 2 5 7 22 8 8 13 4 3 5 7 8 8 1 1 1 2 6 6 5 4 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_85474535_85475165
seq2: B6Ng01-332B09.b_46_676

seq1  GAATTCTCTTTGTGTGAGACCTAAAATGTGGCTGTAAACTTTATGTTAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTTTGTGTGAGACCTAAAATGTGGCTGTAAACTTTATGTTAAA  50

seq1  GAGCACTGAAGTACGAATCAGAGGCCACATGATGAATCTGGTAATGAAGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCACTGAAGTACGAATCAGAGGCCACATGATGAATCTGGTAATGAAGT  100

seq1  TTTTATTCTGTTTGAAAAGTCAAGATAGTCCTAAATAGTTTTATACTCTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTATTCTGTTTGAAAAGTCAAGATAGTCCTAAATAGTTTTATACTCTG  150

seq1  TCTCTTTTTGTGATGTGGTAATGCTAGTAAAATATAGATGTAGATTGAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTTTTTGTGATGTGGTAATGCTAGTAAAATATAGATGTAGATTGAGA  200

seq1  AGAAATGCAAATATATACTAGAAGATAACTTAGATGAATATTTATATGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAATGCAAATATATACTAGAAGATAACTTAGATGAATATTTATATGAA  250

seq1  GGTTTGATTATTTTTCATAATATTATTTGGAATATTTGGGAATTTCACAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTGATTATTTTTCATAATATTATTTGGAATATTTGGGAATTTCACAT  300

seq1  CGTGTGTGAAATCATACTTCCCAGTCCTCCCAGATCTACCCTCTACCTTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTGTGTGAAATCATACTTCCCAGTCCTCCCAGATCTACCCTCTACCTTG  350

seq1  TGACCTTCCCCCCCCCAAAAAAAAAGAAGAAAAAGAAAGAAGGGGGGAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACCTTCCCCCCCCCAAAAAAAAAGAAGAAAAAGAAAGAAGGGGGGAAG  400

seq1  GAGAAGGAGGAGGAGAAGGAGGAGAAGGAGGAGGATAACAACAACAAAAC  450
      |||||||||||||||||||||||||||||||||||| || ||||||||||
seq2  GAGAAGGAGGAGGAGAAGGAGGAGAAGGAGGAGGATCACCACAACAAAAC  450

seq1  CAACAACAAAGTCTAATTTGTGTTGCCCATATACTCACTGGAGCATGGTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACAACAAAGTCTAATTTGTGTTGCCCATATACTCACTGGAGCATGGTC  500

seq1  AAACCTCCACTGGTCAGTCCCTTAAAGAAGAGAGTCCTTGCTCACCCTCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCTCCACTGGTCAGTCCCTTAAAGAAGAGAGTCCTTGCTCACCCTCA  550

seq1  TCCCTGCCAGAAGCCATCAATTATAGAGAGCCACACTTAAGCATTTTTTT  600
      |||||||||||||| ||||||||||||||||||| ||||||| |||||||
seq2  TCCCTGCCAGAAGCTATCAATTATAGAGAGCCACCCTTAAGCTTTTTTTT  600

seq1  CCACAATTTTTAAGAGTTCTTTTCAGGGTTT  631
      ||||||| |||||||||||||||||||||||
seq2  CCACAATGTTTAAGAGTTCTTTTCAGGGTTT  631

seq1: chr2_85606110_85607221
seq2: B6Ng01-332B09.g_68_1169 (reverse)

seq1  TCTCTATACAAAGAACTATGGACAACTTAGAAAAACTGGTAACGGGGAAA  50
      |||||||  |||||||||| ||||   ||||||||||||| |||||  ||
seq2  TCTCTAT-GAAAGAACTAT-GACA--CTAGAAAAACTGGT-ACGGG--AA  43

seq1  GTGAGTCTACTCCAGAAAGAATATACCAAACAGATAAATGGGATTTTCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGTCTACTCCAGAAAGAATATACCAAACAGATAAATGGGATTTTCAA  93

seq1  GGTTTTTATTTTAGTCTGGCCTATGTTTTTTTTTAAAGATCTATTTATGA  150
      |  |||||||||||||||||||||| ||||||||||||||||||||||||
seq2  G--TTTTATTTTAGTCTGGCCTATG-TTTTTTTTAAAGATCTATTTATGA  140

seq1  AACTATAAAATACCATCATGCAGGCTGAGTAAAAGCTTTTCATTGTAGCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTATAAAATACCATCATGCAGGCTGAGTAAAAGCTTTTCATTGTAGCT  190

seq1  GCTTCTGGGTCACCTACACTCCCATCAGTAACTTTGCACCAATTGTCTCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCTGGGTCACCTACACTCCCATCAGTAACTTTGCACCAATTGTCTCT  240

seq1  AATCCAAACTCATAGTTCTCCAGTATGAACTTTGAAATTGAACTTTTATT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCCAAACTCATAGTTCTCCAGTATGAACTTTGAAATTGAACTTTTATT  290

seq1  TTTTTTTAATCATTGGGATCACATGAAGAGTGGATAGACACTCCTTAGTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTAATCATTGGGATCACATGAAGAGTGGATAGACACTCCTTAGTC  340

seq1  CTCCTTCCACAAGGGAGAGAATTCTCACAATAGATTGTAAATTCATTTAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTTCCACAAGGGAGAGAATTCTCACAATAGATTGTAAATTCATTTAA  390

seq1  TACTACTATGTCTCATGGTATTAAGAAATAAAAAAAATATTATACAGATG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTACTATGTCTCATGGTATTAAGAAATAAAAAAAATATTATACAGATG  440

seq1  GAAAGATGGAAATTGTTTATAATAAAGAAGGGTTAATGCTTAAAAAAAAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGATGGAAATTGTTTATAATAAAGAAGGGTTAATGCTTAAAAAAAAT  490

seq1  AGCACGAATGGATTGATATTTCCAGAAAGAGTAAGATGGGTGGGTGGATG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACGAATGGATTGATATTTCCAGAAAGAGTAAGATGGGTGGGTGGATG  540

seq1  TTTTCATAAAGGAAAAAAAAAAACTAGAAGCTTTTTCAAATTATAAAGGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCATAAAGGAAAAAAAAAAACTAGAAGCTTTTTCAAATTATAAAGGT  590

seq1  TTGGGTAAGATATATAAGTACTGTAGCCATGCAGTTGTTCTGATTAAAAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGTAAGATATATAAGTACTGTAGCCATGCAGTTGTTCTGATTAAAAG  640

seq1  ACAATAATGTTTCTGGAACTAGGAAGAAGGAGAGAGGGGAAGAGAGGATG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAATAATGTTTCTGGAACTAGGAAGAAGGAGAGAGGGGAAGAGAGGATG  690

seq1  AGCAAGAAAACAGAGTGACACAACACCTAGCAGTTAACACTCTCATTTCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAAGAAAACAGAGTGACACAACACCTAGCAGTTAACACTCTCATTTCT  740

seq1  AAATCTCTTGGGACATAGAACAAGATTAAAAAAATGGCCATTGATTTGGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCTCTTGGGACATAGAACAAGATTAAAAAAATGGCCATTGATTTGGA  790

seq1  AGAATTTGCTTATCTATATCCTGTTGTAGGTATTCCTAAGGACATGAGTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATTTGCTTATCTATATCCTGTTGTAGGTATTCCTAAGGACATGAGTT  840

seq1  TATAAATTTTCAAATATCTCCATGTATAAATGAAGATGCCCACACAAATA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAAATTTTCAAATATCTCCATGTATAAATGAAGATGCCCACACAAATA  890

seq1  TATGCTCAAATATGCAAATAATTATATGCATTTATTTGAATTCACTAAAA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGCTCAAATATGCAAATAATTATATGCATTTATTTGAATTCACTAAAA  940

seq1  CAATACAGAATGTGTAGAGATTACAATTGAATACAATGGGAATATACCCC  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATACAGAATGTGTAGAGATTACAATTGAATACAATGGGAATATACCCC  990

seq1  ATAGACTATCTTTCTTTATCTCATTAAATAATATTAAACCAACATCACCA  1050
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGACTATCTTTCTTTATCTCATTAAATAATATTAAACCAACATCACCA  1040

seq1  ACAGACTGTTGATTAATTGTCCTGCTTGTAATTTCCCTGAGCTGCAAAAC  1100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGACTGTTGATTAATTGTCCTGCTTGTAATTTCCCTGAGCTGCAAAAC  1090

seq1  CATGAGGAATTC  1112
      ||||||||||||
seq2  CATGAGGAATTC  1102

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information