MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-332N08
Chromosome	2 (Build37)
Map Location	177,161,095 - 177,162,177
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC627914, LOC100039093, LOC668039, LOC100039109, LOC100043381, LOC100043387, LOC100039123, LOC626877, LOC100039156, LOC100039166, 6230416C02Rik, LOC635470, LOC100043403, LOC100039198, LOC100043406
Downstream gene	LOC668066, LOC621442, LOC628308, OTTMUSG00000016571, LOC100039233, LOC626802, LOC329575, LOC433515, LOC665205, OTTMUSG00000016327, LOC100039263, LOC626848, 2810021G02Rik, Phactr3, Sycp2, Ppp1r3d, 9030418K01Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC627914 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 3 Proteins

name	LOC100039093 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 ESTs, 3 Proteins pseudo : _no_value

name	LOC668039 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 3 Proteins

name	LOC100039109 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043381 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 1 Protein

name	LOC100043387 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 1 Protein

name	LOC100039123 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 2 Proteins

name	LOC626877 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 1 Protein

name	LOC100039156 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100039166 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	6230416C02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545490 MGI:3615331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 1 Protein

name	LOC635470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 532 ESTs, 8 Proteins

name	LOC100043403 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 66 ESTs, 1 Protein

name	LOC100039198 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100043406 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs

name	LOC668066 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668066
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	LOC621442 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 1184 ESTs, 5 Proteins pseudo : _no_value

name	LOC628308 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs

name	OTTMUSG00000016571 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433520 MGI:3649813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC626802 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	LOC329575 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:329575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433515 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 647 ESTs, 7 Proteins pseudo : _no_value

name	LOC665205 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	OTTMUSG00000016327 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665211 MGI:3709298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 57 ESTs

name	LOC100039263 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC626848 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins pseudo : _no_value

name	2810021G02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353208 MGI:2441662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Phactr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74189 MGI:1921439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Sycp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320558 MGI:1933281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r3d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228966 MGI:1917664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 37 ESTs, 2 Proteins

name	9030418K01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71532 MGI:1918782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627914 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250479 GeneID:627914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 3 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 6 transcript_id : XM_902680.3

name	LOC668039 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250481 GeneID:668039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 3 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 10 transcript_id : XM_902710.3

name	LOC100039109 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250472 GeneID:100039109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001472282.1

name	LOC100043381 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250483 GeneID:100043381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 1 Protein product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 1 transcript_id : XM_001480586.1

name	LOC100043381 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250485 GeneID:100043381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 50 ESTs, 1 Protein product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 2 transcript_id : XM_001480589.1

name	LOC100043387 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250487 GeneID:100043387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 61 ESTs, 1 Protein product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 1 transcript_id : XM_001480593.1

name	LOC100043387 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250489 GeneID:100043387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 59 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 2 transcript_id : XM_001480597.1

name	LOC100039123 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250474 GeneID:100039123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 2 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001472314.1

name	LOC635470 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250491 GeneID:635470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 532 ESTs, 8 Proteins product : similar to ribosomal protein L27a-like transcript_id : XM_915945.3

name	LOC100043403 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250492 GeneID:100043403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 66 ESTs, 1 Protein product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001480607.1

name	LOC100043406 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250494 GeneID:100043406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs product : similar to gag protein transcript_id : XM_001480617.1

name	LOC668066 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367735 GeneID:668066
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 4 transcript_id : XM_001004338.1

name	LOC628308 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250496 GeneID:628308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs product : similar to Zinc finger protein 14 (Zinc finger protein KOX6) (Gonadotropin inducible transcription repressor-4) (GIOT-4) transcript_id : XM_001480623.1

name	OTTMUSG00000016571 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701565 GeneID:433520 MGI:3649813
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000016571 transcript_id : NM_001024825.1

name	LOC626802 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367751 GeneID:626802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : similar to zinc finger protein 709, transcript variant 1 transcript_id : XM_894982.2

name	LOC329575 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:85701571 GeneID:329575
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC329575 transcript_id : NM_001024849.1

name	OTTMUSG00000016327 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250513 GeneID:665211 MGI:3709298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 57 ESTs product : predicted gene, OTTMUSG00000016327, transcript variant 25 transcript_id : XM_902322.3

name	Phactr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55741466 GeneID:74189 MGI:1921439
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatase and actin regulator 3 transcript_id : NM_028806.1

name	Phactr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803159 GeneID:74189 MGI:1921439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatase and actin regulator 3 transcript_id : NM_001007154.2

name	Sycp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109689712 GeneID:320558 MGI:1933281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptonemal complex protein 2 transcript_id : NM_177191.3

name	Ppp1r3d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367764 GeneID:228966 MGI:1917664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 37 ESTs, 2 Proteins product : protein phosphatase 1, regulatory subunit 3D transcript_id : XM_141580.3

name	9030418K01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486858 GeneID:71532 MGI:1918782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030418K01 gene transcript_id : NM_001081289.1

name	LOC627914 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250480 GeneID:627914
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 6 protein_id : XP_907773.3

name	LOC668039 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250482 GeneID:668039
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 10 protein_id : XP_907803.2

name	LOC100039109 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250473 GeneID:100039109
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001472332.1

name	LOC100043381 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250484 GeneID:100043381
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 1 protein_id : XP_001480636.1

name	LOC100043381 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250486 GeneID:100043381
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 2 protein_id : XP_001480639.1

name	LOC100043387 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250488 GeneID:100043387
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 1 protein_id : XP_001480643.1

name	LOC100043387 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250490 GeneID:100043387
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 2 protein_id : XP_001480647.1

name	LOC100039123 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250475 GeneID:100039123
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001472364.1

name	LOC635470 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82888947 GeneID:635470
definition	codon_start : 1 product : similar to ribosomal protein L27a-like protein_id : XP_921038.1

name	LOC100043403 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250493 GeneID:100043403
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001480657.1

name	LOC100043406 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250495 GeneID:100043406
definition	codon_start : 1 product : similar to gag protein protein_id : XP_001480667.1

name	LOC668066 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367736 GeneID:668066
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 4 protein_id : XP_001004338.1

name	LOC628308 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250497 GeneID:628308
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480673.1

name	OTTMUSG00000016571 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701566 GeneID:433520 MGI:3649813
definition	codon_start : 1 product : hypothetical protein LOC433520 protein_id : NP_001019996.1

name	LOC626802 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367752 GeneID:626802
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 1 protein_id : XP_900075.2

name	LOC329575 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:85701572 GeneID:329575
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC329575 protein_id : NP_001020020.1

name	OTTMUSG00000016327 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250514 GeneID:665211 MGI:3709298
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 25 protein_id : XP_907415.3

name	Phactr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55741467 CCDS:CCDS17158.1 GeneID:74189 MGI:1921439
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0004864 - protein phosphatase inhibitor activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : phosphatase and actin regulator 3 isoform 1 protein_id : NP_083082.1

name	Phactr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55741465 CCDS:CCDS17159.1 GeneID:74189 MGI:1921439
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0004864 - protein phosphatase inhibitor activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : phosphatase and actin regulator 3 isoform 2 protein_id : NP_001007155.1

name	Sycp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109689713 GeneID:320558 MGI:1933281
definition	codon_start : 1 product : synaptonemal complex protein 2 protein_id : NP_796165.2

name	Ppp1r3d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20863582 GeneID:228966 MGI:1917664
definition	codon_start : 1 product : protein phosphatase 1, regulatory subunit 3D protein_id : XP_141580.1

name	9030418K01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486859 GeneID:71532 MGI:1918782
definition	codon_start : 1 product : hypothetical protein LOC71532 protein_id : NP_001074758.1

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 7 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 6 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 5 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 4 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 3 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 2 pseudo : _no_value

name	LOC100039156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039156
definition	number : 1 pseudo : _no_value

name	LOC100039166 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039166
definition	number : 3 pseudo : _no_value

name	LOC100039166 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039166
definition	number : 2 pseudo : _no_value

name	LOC100039166 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039166
definition	number : 1 pseudo : _no_value

name	LOC100039198 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039198
definition	number : 8 pseudo : _no_value

name	LOC100039198 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039198
definition	number : 7 pseudo : _no_value

name	LOC100039198 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039198
definition	number : 6 pseudo : _no_value

name	LOC100039198 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039198
definition	number : 5 pseudo : _no_value

name	LOC100039198 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039198
definition	number : 4 pseudo : _no_value

name	LOC100039198 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039198
definition	number : 3 pseudo : _no_value

name	LOC100039198 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039198
definition	number : 2 pseudo : _no_value

name	LOC100039198 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039198
definition	number : 1 pseudo : _no_value

name	LOC100039233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039233
definition	number : 1 pseudo : _no_value

name	LOC100039233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039233
definition	number : 2 pseudo : _no_value

name	LOC100039233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039233
definition	number : 3 pseudo : _no_value

name	LOC100039233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039233
definition	number : 4 pseudo : _no_value

name	LOC100039233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039233
definition	number : 5 pseudo : _no_value

name	LOC100039233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039233
definition	number : 6 pseudo : _no_value

name	LOC100039233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039233
definition	number : 7 pseudo : _no_value

name	LOC100039263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039263
definition	number : 5 pseudo : _no_value

name	LOC100039263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039263
definition	number : 4 pseudo : _no_value

name	LOC100039263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039263
definition	number : 3 pseudo : _no_value

name	LOC100039263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039263
definition	number : 2 pseudo : _no_value

name	LOC100039263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039263
definition	number : 1 pseudo : _no_value

name	LOC100039093 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250471 GeneID:100039093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 ESTs, 3 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein pseudo : _no_value transcript_id : XR_030632.1

name	LOC626877 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250476 GeneID:626877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 1 Protein product : similar to zinc finger protein 709 transcript_id : XR_030668.1

name	6230416C02Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149250477 GeneID:545490 MGI:3615331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 1 Protein product : RIKEN cDNA 6230416C02 gene transcript_id : XR_030701.1

name	LOC621442 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250478 GeneID:621442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 1184 ESTs, 5 Proteins product : similar to ribosomal protein S8 pseudo : _no_value transcript_id : XR_030711.1

name	LOC433515 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250499 GeneID:433515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 647 ESTs, 7 Proteins product : similar to ribosomal protein S8 pseudo : _no_value transcript_id : XR_030740.1

name	LOC665205 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250500 GeneID:665205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein pseudo : _no_value transcript_id : XR_035652.1

name	LOC626848 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250501 GeneID:626848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein pseudo : _no_value transcript_id : XR_030782.1

name	2810021G02Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149250502 GeneID:353208 MGI:2441662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : RIKEN cDNA 2810021G02 gene transcript_id : XR_030794.1

clone name	MSMg01-495B08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518C07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368D11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-376H03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-454H19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-538K03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450G10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-212D15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-327M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-332N08.b	B6Ng01-332N08.g
ACC	GA118822	GA118823
length	1,012	1,073
definition	B6Ng01-332N08.b	B6Ng01-332N08.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaaggcccatatctaaacataataaaagtaatctacagcaaacca gaaggcaacatccaagtaaatggagagaagctggaagcaatcccactaaa atcagggactagacaaggctgcccactttctccctttctattcaatatag tactcaaagtcctagccagaacaattagacaacaaaaggaggtcaagcgg atacaaatttgtaaggaagaagtcaaaatatcactatttgcagatgatat gatagtatatattagtgaccctaaaaattccaccagagaactcctaaacc tgataaacagcttcagtgaactagctgcatataaaattaactcaaacaaa tcaatggcctttctctacagaaaggataaacaggctgagaaagaaattag ggggctggtgagatggctcagtgggtaagagcacccgactgctcttctga aggtcaggagttcaaatcccagcaaccacatggtggctcaccaccatcca taacaagatctgactccctcttctggagtgtctgaggacagctacagtgt acttacatataataaataaataaatattaaaaaaaaaagaaattagggaa acagtacccttcacaatagtcacaaataatataaaataccttggtgtgac actaactaaggaagtgaaagatctgtatgattagaacctcaagtgtctga agaaagaaatcaaagaaaatctcagaagatggaaagatctctgatgcaca tggattggcaggatcaatatagtgaaaatggctatcttgccaaaagcaat ctttagattcaatgcaattgctataaaaattccaactcaattcttcatcg aattagaaagggcaatttgcaaattcatctgtattaacaaaaaaaaccta ggataggaaatattcttctcaatgataaaagaatctctagtggaatcacc atgcctgacctaaagtgtactacagagcaattgtgatgaaactgcatggt atggtatagcga	gaattcaatagaagtgatgaaagacccccgttttgggggagactctcctc aagtcccgggatgagccgacaccccagtaactctaaagaaaaagttcttg atgcaatgttgcgtgaggtttattcgggtatcagcatcctaaggctgagc tcgtaacccacacaggggcagagtagatccacccccagcagttgtagtcg agggtttttaaagaataaactgcaaagtgaggagagaataagaccacaaa gaatggggaagctgagtaaacatcttaagaatggagatggtgaattactg ctcatctctcacgtaaaggttacagactacctttggcaaacattctaggt cccttacactatgggtcaggtgccttggtgagtcacccagtggtcatcat tctcttaggctgaaggcaaaaaacaaagaactccctgctgggctttgttt ctaggggtctaagaaacacattgagttggagtcttacattccccactcct tctagtaaatagttctaatcatagaacaagaaaaattaaacctctgactc agtacatcccgtatcagcctgttttactttttgatattgttggctcagca taagaacttgtacattgccagcatgatggcagcacaaaactttaatccca gcacttgggaagcagaggcaggcggatttctgagttcaaggccagcctgg tcttcaaagtgagtttcaaaaaaaaaaaaaaaaaaagaccctgtatagca ctgatctgctctctgacaaaagtcattatcttgttaattatgcaggggcc tatcgtaaataaaagaagcaaaactaataaggggccaatgagggaagata gtaaagtagtcatccatggggattttgtgaaccaaccttcaaaccatcct tcattagcctctcactctcattttcatatttctaacctttctttgagttt ggctatagagtctctaattgccctgatggtcatatgagcagcatctcttt aaagctgcccgactagctgggcaaggggtattaaggaagaatccacaact caaggggggtgggggagggaatt
quality values	Open. Hide. 62 41 22 39 62 38 23 47 62 62 62 62 47 29 62 59 62 62 62 59 56 59 59 59 62 59 59 43 30 27 28 27 29 37 27 28 35 51 62 62 62 59 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 59 62 62 62 56 54 54 42 49 56 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 59 62 54 62 62 62 62 59 62 62 59 59 59 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 59 49 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 58 58 46 49 58 58 58 58 58 58 58 58 58 54 58 58 52 58 58 58 58 46 58 54 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 42 48 58 49 47 58 58 58 58 50 50 50 58 58 50 54 58 58 51 54 51 52 51 41 58 53 51 54 54 58 46 53 39 58 54 53 53 53 53 53 51 54 58 58 54 53 53 41 58 48 50 58 58 52 58 50 58 35 39 52 53 39 33 51 54 49 50 51 39 58 49 51 50 53 51 49 58 51 50 46 32 52 54 58 42 53 53 42 47 28 47 47 38 54 41 32 54 53 53 37 49 52 53 53 42 52 49 49 54 44 27 38 36 44 39 53 54 40 42 45 39 54 54 42 54 17 36 25 40 45 53 52 40 35 54 34 23 33 21 54 34 33 54 39 41 32 29 52 52 53 40 52 41 29 52 42 30 45 31 35 51 46 27 26 33 41 52 36 32 41 39 27 30 37 28 47 32 35 35 32 32 31 52 37 52 51 42 31 47 51 33 45 32 31 43 30 31 45 23 41 31 51 46 31 31 43 32 41 28 31 35 51 42 31 30 33 20 31 33 15 38 32 45 26 32 30 30 30 43 32 36 27 27 19 46 47 46 30 31 31 28 30 29 31 31 31 31 24 24 31 38 36 32 36 38 33 34 31 26 43 22 11 31 30 24 43 48 37 27 48 32 29 19 21 30 47 31 31 32 26 39 22 24 31 35 24 31 32 38 34 24 32 32 20 10 25 28 17 44 48 48 48 44 44 26 17 25 32 15 16 12 31 16 32 27 38 38 48 29 20 16 18 36 34 21 19 20 17 31 26 18 21 31 31 23 27 43 43 25 18 18 17 23 27 27 32 31 25 14 21 25 13 16 16 15 32 17 9 24 8 18 23 19 22 27 23 24 9 18 32 12 22 4 4 5 14 17 28 32 29 32 21 6 10 37 14 28 21 8 27 12 12 8 11 12 10 24 27 40 23 9 19 27 24 20 24 15 21 4 6 28 6 21 9 10 20 19 15 28 17 24	Open. Hide. 62 54 59 59 62 59 43 15 24 17 13 23 18 18 23 28 33 20 42 56 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 43 43 51 46 50 48 56 56 62 62 54 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 54 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 49 52 58 58 58 58 58 58 54 58 58 58 58 58 58 54 46 58 54 58 58 58 58 58 58 58 58 54 54 58 58 54 54 58 54 58 54 58 58 58 58 58 58 58 58 58 52 52 58 58 58 58 58 58 58 58 52 47 58 58 58 58 58 58 58 52 52 58 58 58 42 58 58 46 49 58 53 41 50 58 51 53 53 58 46 58 54 49 58 58 58 58 48 44 39 44 58 58 51 58 46 51 58 50 54 58 46 36 58 58 49 51 53 51 50 49 48 43 49 25 40 51 58 58 52 50 54 49 58 46 36 52 54 42 43 58 51 51 58 54 49 51 32 52 52 42 58 32 46 39 39 33 51 32 47 54 29 31 54 49 41 51 41 54 32 54 53 42 37 49 42 54 30 49 37 42 53 51 42 50 46 41 53 49 52 39 34 54 45 45 52 47 47 32 39 54 51 31 32 54 54 54 54 54 54 54 54 54 54 49 36 49 54 54 54 54 52 35 41 13 49 47 40 53 35 32 32 53 32 45 32 33 34 43 33 32 31 36 52 35 42 32 34 32 31 31 52 24 21 52 52 40 25 30 33 36 34 42 31 30 43 51 25 42 30 35 27 30 26 34 31 31 30 30 31 28 51 46 31 25 34 32 30 30 30 39 23 22 48 32 36 25 46 46 43 30 42 42 29 31 31 42 46 27 27 32 31 27 32 26 21 27 47 46 31 25 28 15 22 27 31 41 18 47 31 29 27 31 29 18 31 32 33 38 48 32 25 31 31 27 32 36 33 36 32 41 24 31 39 46 48 35 11 8 46 46 46 32 44 22 27 26 10 24 11 24 30 37 34 21 19 21 41 21 25 38 32 38 26 22 12 21 19 19 23 19 11 14 28 10 17 30 36 25 22 25 29 22 18 22 20 33 48 48 33 16 24 27 32 32 48 26 29 27 26 23 17 21 31 48 26 20 9 43 16 11 23 16 18 43 12 17 25 19 31 16 18 24 27 34 22 32 31 17 23 27 17 25 16 15 22 18 47 9 5 6 14 8 16 21 10 13 30 5 11 6 4 3 3 23 20 21 25 14 27 12 22 8 13 47 23 8 40 22 27 17 19 17 28 40 30 15 22 20 27 24 18 20 27 19 28 21 9 14 7 27 38 34 18 5 6 11 11 3 3 10 6 23 17 8 12 20 4 11 23 7 9 6 17 15 11 8 10 4 22 23 27 30 25 14 4 7 22 28 28 14 8 5 7 12 3 9 9 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_177161095_177162177
seq2: B6Ng01-332N08.g_68_1140

seq1  GAATTCAATAGAAGTGATGAAAGACCCCCGTTTTGGGGGAGACTCTCCTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAATAGAAGTGATGAAAGACCCCCGTTTTGGGGGAGACTCTCCTC  50

seq1  AAGTCCCGGGATGAGCCGACACCCCAGTAACTCTAAAGAAAAAGTTCTTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCCCGGGATGAGCCGACACCCCAGTAACTCTAAAGAAAAAGTTCTTG  100

seq1  ATGCAATGTTGCGTGAGGTTTATTCGGGTATCAGCATCCTAAGGCTGAGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCAATGTTGCGTGAGGTTTATTCGGGTATCAGCATCCTAAGGCTGAGC  150

seq1  TCGTAACCCACACAGGGGCAGAGTAGATCCACCCCCAGCAGTTGTAGTCG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGTAACCCACACAGGGGCAGAGTAGATCCACCCCCAGCAGTTGTAGTCG  200

seq1  AGGGTTTTTAAAGAATAAACTGCAAAGTGAGGAGAGAATAAGACCACAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTTTTTAAAGAATAAACTGCAAAGTGAGGAGAGAATAAGACCACAAA  250

seq1  GAATGGGGAAGCTGAGTAAACATCTTAAGAATGGAGATGGTGAATTACTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATGGGGAAGCTGAGTAAACATCTTAAGAATGGAGATGGTGAATTACTG  300

seq1  CTCATCTCTCACGTAAAGGTTACAGACTACCTTTGGCAAACATTCTAGGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATCTCTCACGTAAAGGTTACAGACTACCTTTGGCAAACATTCTAGGT  350

seq1  CCCTTACACTATGGGTCAGGTGCCTTGGTGAGTCACCCAGTGGTCATCAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTACACTATGGGTCAGGTGCCTTGGTGAGTCACCCAGTGGTCATCAT  400

seq1  TCTCTTAGGCTGAAGGCAAAAAACAAAGAACTCCCTGCTGGGCTTTGTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTTAGGCTGAAGGCAAAAAACAAAGAACTCCCTGCTGGGCTTTGTTT  450

seq1  CTAGGGGTCTAAGAAACACATTGAGTTGGAGTCTTACATTCCCCACTCCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGGGGTCTAAGAAACACATTGAGTTGGAGTCTTACATTCCCCACTCCT  500

seq1  TCTAGTAAATAGTTCTAATCATAGAACAAGAAAAATTAAACCTCTGACTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAGTAAATAGTTCTAATCATAGAACAAGAAAAATTAAACCTCTGACTC  550

seq1  AGTACATCCCGTATCAGCCTGTTTTACTTTTTGATATTGTTGGCTCAGCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACATCCCGTATCAGCCTGTTTTACTTTTTGATATTGTTGGCTCAGCA  600

seq1  TAAGAACTTGTACATTGCCAGCATGATGGCAGCACAAAACTTTAATCCCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGAACTTGTACATTGCCAGCATGATGGCAGCACAAAACTTTAATCCCA  650

seq1  GCACTTGGGAAGCAGAGGCAGGCGGATTTCTGAGTTCAAGGCCAGCCTGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTTGGGAAGCAGAGGCAGGCGGATTTCTGAGTTCAAGGCCAGCCTGG  700

seq1  TCTTCAAAGTGAGTTTCAAAAAAAAAAAAAAAAAAAGACCCTGTATAGCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCAAAGTGAGTTTCAAAAAAAAAAAAAAAAAAAGACCCTGTATAGCA  750

seq1  CTGATCTGCTCTCTGACAAAAGTCATTATCTTGTTAATTATGCAGGGGCC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGATCTGCTCTCTGACAAAAGTCATTATCTTGTTAATTATGCAGGGGCC  800

seq1  TATCGTAAATAAAAGAAGCAAAACTAATAAGGGGCCAATGAGGGAAGATA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCGTAAATAAAAGAAGCAAAACTAATAAGGGGCCAATGAGGGAAGATA  850

seq1  GTAAAGTAGTCATCCATGGGGATTTTGTGAACCAACCTTCAAACCATCCT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAAGTAGTCATCCATGGGGATTTTGTGAACCAACCTTCAAACCATCCT  900

seq1  TCATTAGCCTCTCACTCTCATTTTCATATTTCTAACCTTTCTTTGAGTTT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTAGCCTCTCACTCTCATTTTCATATTTCTAACCTTTCTTTGAGTTT  950

seq1  GGCTATAGAGTCTCTAATTGCCCTTGAATGGTCAATATGGAAGCAGCATT  1000
      ||||||||||||||||||||||||   |||||| |||||  ||||||| |
seq2  GGCTATAGAGTCTCTAATTGCCCT--GATGGTC-ATATG--AGCAGCA-T  994

seq1  CTTCTTTTAAAGCTGCCCCGACTAGCTGGGCAAGGGGGTATTTAAAGGAA  1050
      ||   |||||||||| ||||||||||||||||| ||||||||  ||||||
seq2  CT--CTTTAAAGCTG-CCCGACTAGCTGGGCAA-GGGGTATT--AAGGAA  1038

seq1  GAAACCACAACTCAAGGGGG--TGGGGAGGGAATT  1083
      ||| ||||||||||||||||   ||||||||||||
seq2  GAATCCACAACTCAAGGGGGGTGGGGGAGGGAATT  1073

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information