MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-341O19
Chromosome	2 (Build37)
Map Location	150,627,295 - 150,767,160
singlet/doublet	doublet
Overlap gene	Pygb, Abhd12, Gins1, LOC668925, 4930519N13Rik
Upstream gene	C530025M09Rik, OTTMUSG00000015750, LOC279056, Zfp120, EG245174, 3300002I08Rik, LOC100043832, OTTMUSG00000015730, LOC668924, OTTMUSG00000015743, LOC545472, Cst7, 2310001A20Rik, Acss1, Vsx1, Entpd6, LOC100043605
Downstream gene	LOC668926, Nanp, LOC433486, LOC381390, 4930442J19Rik, LOC100043839, LOC100043840, 4921509C19Rik, Nsfl1c, Fkbp1a, Sdcbp2, Snph, LOC668929, BC052486, 5430405G05Rik, Psmf1, Rspo4, Angpt4
Link	Open Mouse BAC browser

Click to get alignment info.

name	C530025M09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319470 MGI:2442090
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs

name	OTTMUSG00000015750 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433485 MGI:3702158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 ESTs, 3 Proteins

name	LOC279056 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:279056
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 7 Proteins pseudo : _no_value

name	Zfp120 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104348 MGI:1345179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG245174 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245174 MGI:3644476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 2 Proteins

name	3300002I08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69277 MGI:1916527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043832 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 30 ESTs, 34 Proteins pseudo : _no_value

name	OTTMUSG00000015730 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668923 MGI:3651999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 1 Protein

name	LOC668924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 3 Proteins pseudo : _no_value

name	OTTMUSG00000015743 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545471 MGI:3652219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545472 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 177 ESTs, 23 Proteins

name	Cst7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13011 MGI:1298217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310001A20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71881 MGI:1919131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68738 MGI:1915988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vsx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114889 MGI:1890816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Entpd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12497 MGI:1202295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043605 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Pygb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110078 MGI:97828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76192 MGI:1923442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gins1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69270 MGI:1916520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 53 ESTs, 3 Proteins

name	LOC668925 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	4930519N13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78177 MGI:1925427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668926 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins pseudo : _no_value

name	Nanp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67311 MGI:1914561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433486 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 39 Proteins

name	LOC381390 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381390
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 38 Proteins

name	4930442J19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74660 MGI:1921910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100043839 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 140 ESTs, 5 Proteins

name	LOC100043840 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 53 mRNAs, 2805 ESTs, 35 Proteins pseudo : _no_value

name	4921509C19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381393 MGI:2685851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsfl1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:386649 MGI:3042273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14225 MGI:95541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdcbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228765 MGI:2385156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241727 MGI:2139270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668929 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	BC052486 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228767 MGI:3039588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs

name	5430405G05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108832 MGI:1918629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 3 Proteins

name	Psmf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228769 MGI:1346072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rspo4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228770 MGI:1924467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Angpt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11602 MGI:1336887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C530025M09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367298 GeneID:319470 MGI:2442090
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs product : RIKEN cDNA C530025M09 gene transcript_id : XM_893535.2

name	OTTMUSG00000015750 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250196 GeneID:433485 MGI:3702158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 ESTs, 3 Proteins product : predicted gene, OTTMUSG00000015750, transcript variant 1 transcript_id : XM_485077.5

name	Zfp120 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91064881 GeneID:104348 MGI:1345179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 120 transcript_id : NM_023266.4

name	Zfp120 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91064879 GeneID:104348 MGI:1345179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 120 transcript_id : NM_181266.2

name	EG245174 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250048 GeneID:245174 MGI:3644476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 2 Proteins product : predicted gene, EG245174 transcript_id : XM_893600.3

name	3300002I08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21746148 GeneID:69277 MGI:1916527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3300002I08 gene transcript_id : NM_027017.1

name	OTTMUSG00000015730 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250198 GeneID:668923 MGI:3651999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 1 Protein product : predicted gene, OTTMUSG00000015730 transcript_id : XM_001481090.1

name	OTTMUSG00000015743 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367199 GeneID:545471 MGI:3652219
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000015743 transcript_id : NM_001034900.2

name	LOC545472 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250050 GeneID:545472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 177 ESTs, 23 Proteins product : similar to BTB (POZ) domain containing 1 transcript_id : XM_619824.4

name	Cst7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892388 GeneID:13011 MGI:1298217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystatin F (leukocystatin) transcript_id : NM_009977.2

name	2310001A20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802875 GeneID:71881 MGI:1919131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310001A20 gene transcript_id : NM_027977.2

name	Acss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18034772 GeneID:68738 MGI:1915988
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase short-chain family member 1 transcript_id : NM_080575.1

name	Vsx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254121 GeneID:114889 MGI:1890816
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : visual system homeobox 1 homolog (zebrafish) transcript_id : NM_054068.2

name	Entpd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802024 GeneID:12497 MGI:1202295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 6 transcript_id : NM_172117.3

name	LOC100043605 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250052 GeneID:100043605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043605 transcript_id : XM_001480518.1

name	Pygb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418918 GeneID:110078 MGI:97828
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain glycogen phosphorylase transcript_id : NM_153781.1

name	Abhd12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130714 GeneID:76192 MGI:1923442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 12 transcript_id : NM_024465.2

name	Gins1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250201 GeneID:69270 MGI:1916520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 53 ESTs, 3 Proteins product : GINS complex subunit 1 (Psf1 homolog), transcript variant 1 transcript_id : XM_130416.6

name	4930519N13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402161 GeneID:78177 MGI:1925427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930519N13 gene transcript_id : NM_207204.1

name	Nanp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385585 GeneID:67311 MGI:1914561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylneuraminic acid phosphatase transcript_id : NM_026086.1

name	LOC433486 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367310 GeneID:433486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 39 Proteins product : serine/threonine kinase transcript_id : XM_485079.3

name	LOC381390 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250203 GeneID:381390
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 38 Proteins product : hypothetical LOC381390 transcript_id : XM_355352.4

name	4930442J19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250204 GeneID:74660 MGI:1921910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA 4930442J19 gene transcript_id : XM_001481096.1

name	LOC100043839 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250206 GeneID:100043839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 140 ESTs, 5 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase transcript_id : XM_001481097.1

name	4921509C19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130885 GeneID:381393 MGI:2685851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921509C19 gene transcript_id : NM_198655.2

name	Nsfl1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130836 GeneID:386649 MGI:3042273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NSFL1 (p97) cofactor (p47) transcript_id : NM_198326.2

name	Fkbp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94158952 GeneID:14225 MGI:95541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 1a transcript_id : NM_008019.2

name	Sdcbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704053 GeneID:228765 MGI:2385156
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syndecan binding protein (syntenin) 2 transcript_id : NM_145535.1

name	Snph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130824 GeneID:241727 MGI:2139270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaphilin transcript_id : NM_198214.2

name	LOC668929 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250058 GeneID:668929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to syntaphilin transcript_id : XM_001004826.2

name	BC052486 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367316 GeneID:228767 MGI:3039588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs product : cDNA sequence BC052486 transcript_id : XM_619827.3

name	5430405G05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367317 GeneID:108832 MGI:1918629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 3 Proteins product : RIKEN cDNA 5430405G05 gene transcript_id : XM_130642.6

name	Psmf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74136560 GeneID:228769 MGI:1346072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) inhibitor subunit 1 transcript_id : NM_144889.2

name	Psmf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47078286 GeneID:228769 MGI:1346072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) inhibitor subunit 1 transcript_id : NM_212446.1

name	Rspo4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100817772 GeneID:228770 MGI:1924467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : R-spondin family, member 4 transcript_id : NM_001040689.1

name	Angpt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753005 GeneID:11602 MGI:1336887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiopoietin 4 transcript_id : NM_009641.1

name	C530025M09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82887150 GeneID:319470 MGI:2442090
definition	codon_start : 1 product : hypothetical protein LOC319470 protein_id : XP_898628.1

name	OTTMUSG00000015750 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51706417 GeneID:433485 MGI:3702158
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_485077.1

name	Zfp120 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91064880 GeneID:104348 MGI:1345179
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : zinc finger protein 120 isoform 1 protein_id : NP_851783.2

name	Zfp120 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91064882 GeneID:104348 MGI:1345179
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : zinc finger protein 120 isoform 2 protein_id : NP_075755.4

name	EG245174 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250049 GeneID:245174 MGI:3644476
definition	codon_start : 1 product : similar to novel zinc fingerprotein protein_id : XP_898693.3

name	3300002I08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229083 GeneID:69277 MGI:1916527
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69277 protein_id : NP_081293.2

name	OTTMUSG00000015730 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250199 GeneID:668923 MGI:3651999
definition	codon_start : 1 product : similar to Predicted gene, OTTMUSG00000015730 protein_id : XP_001481140.1

name	OTTMUSG00000015743 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77861899 GeneID:545471 MGI:3652219
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC545471 protein_id : NP_001030072.1

name	LOC545472 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63492503 GeneID:545472
definition	codon_start : 1 product : similar to BTB (POZ) domain containing 1 protein_id : XP_619824.1

name	Cst7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753544 CCDS:CCDS16857.1 GeneID:13011 MGI:1298217
definition	GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : cystatin 7; Leukocystatin; cystatin-like metastasis-associated protein product : cystatin F (leukocystatin) protein_id : NP_034107.1

name	2310001A20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313668 CCDS:CCDS16858.1 GeneID:71881 MGI:1919131
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016844 - strictosidine synthase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : RIKEN cDNA 2310001A20 protein_id : NP_082253.1

name	Acss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18034773 CCDS:CCDS16859.1 GeneID:68738 MGI:1915988
definition	GO_component : GO:0005759 - mitochondrial matrix [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003987 - acetate-CoA ligase activity [Evidence IDA]; GO:0016208 - AMP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0006085 - acetyl-CoA biosynthesis [Evidence IDA] codon_start : 1 note : acetyl-Coenzyme A synthetase 2 (AMP forming)-like product : acetyl-CoA synthetase 2-like protein_id : NP_542142.1

name	Vsx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905095 CCDS:CCDS16860.1 GeneID:114889 MGI:1890816
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 product : visual system homeobox 1 homolog protein_id : NP_473409.1

name	Entpd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921570 CCDS:CCDS16861.1 GeneID:12497 MGI:1202295
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 note : CD39 antigen-like 2 product : ectonucleoside triphosphate diphosphohydrolase 6 protein_id : NP_742115.2

name	LOC100043605 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250053 GeneID:100043605
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480568.1

name	Pygb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418919 CCDS:CCDS16862.1 GeneID:110078 MGI:97828
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004645 - phosphorylase activity [Evidence IEA]; GO:0030170 - pyridoxal phosphate binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 product : brain glycogen phosphorylase protein_id : NP_722476.1

name	Abhd12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277372 GeneID:76192 MGI:1923442
definition	codon_start : 1 product : abhydrolase domain containing 12 protein_id : NP_077785.1

name	Gins1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28487734 GeneID:69270 MGI:1916520
definition	codon_start : 1 product : GINS complex subunit 1 (Psf1 homolog) isoform 1 protein_id : XP_130416.2

name	4930519N13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402162 GeneID:78177 MGI:1925427
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC78177 protein_id : NP_997087.1

name	Nanp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385586 CCDS:CCDS16864.1 GeneID:67311 MGI:1914561
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0050124 - N-acylneuraminate-9-phosphatase activity [Evidence IEA] [Evidence ISS]; GO:0008967 - phosphoglycolate phosphatase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0046380 - N-acetylneuraminate biosynthesis [Evidence ISS] codon_start : 1 product : haloacid dehalogenase-like hydrolase domain containing 4 protein_id : NP_080362.1

name	LOC433486 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51706423 GeneID:433486
definition	codon_start : 1 product : hypothetical protein protein_id : XP_485079.1

name	LOC381390 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:38075170 GeneID:381390
definition	codon_start : 1 product : hypothetical protein protein_id : XP_355352.1

name	4930442J19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250205 GeneID:74660 MGI:1921910
definition	codon_start : 1 product : hypothetical protein LOC74660 protein_id : XP_001481146.1

name	LOC100043839 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250207 GeneID:100043839
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481147.1

name	4921509C19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348544 GeneID:381393 MGI:2685851
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : novel protein tyrosine kinase (4921509C19Rik) product : hypothetical protein LOC381393 protein_id : NP_941057.1

name	Nsfl1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38198665 CCDS:CCDS16868.1 GeneID:386649 MGI:3042273
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : p47 protein protein_id : NP_938085.1

name	Fkbp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679803 CCDS:CCDS16869.1 GeneID:14225 MGI:95541
definition	GO_function : GO:0005528 - FK506 binding [Evidence ISS]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : FK506 binding protein 1a (12 kDa); FK506 Binding Protein12-T1; FK506 binding protein12-T2 product : FK506 binding protein 1a protein_id : NP_032045.1

name	Sdcbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704054 CCDS:CCDS16870.1 GeneID:228765 MGI:2385156
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008022 - protein C-terminus binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0046907 - intracellular transport [Evidence ISS]; GO:0007399 - nervous system development [Evidence ISS] codon_start : 1 product : syndecan binding protein (syntenin) 2 protein_id : NP_663510.1

name	Snph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016174 CCDS:CCDS16871.1 GeneID:241727 MGI:2139270
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0045806 - negative regulation of endocytosis [Evidence ISS]; GO:0006906 - vesicle fusion [Evidence ISS] codon_start : 1 product : syntaphilin protein_id : NP_937857.1

name	LOC668929 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250059 GeneID:668929
definition	codon_start : 1 product : similar to syntaphilin protein_id : XP_001004826.2

name	BC052486 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63492515 GeneID:228767 MGI:3039588
definition	codon_start : 1 product : hypothetical protein protein_id : XP_619827.1

name	5430405G05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94367318 GeneID:108832 MGI:1918629
definition	codon_start : 1 product : hypothetical protein LOC108832 protein_id : XP_130642.2

name	Psmf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47078287 CCDS:CCDS16872.1 GeneID:228769 MGI:1346072
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : proteasome inhibitor subunit 1 isoform a protein_id : NP_997611.1

name	Psmf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74136561 CCDS:CCDS16873.1 GeneID:228769 MGI:1346072
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : proteasome inhibitor subunit 1 isoform b protein_id : NP_659138.2

name	Rspo4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100817773 GeneID:228770 MGI:1924467
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; R-spondin-like protein product : R-spondin family, member 4 isoform 1 protein_id : NP_001035779.1

name	Angpt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753006 CCDS:CCDS16874.1 GeneID:11602 MGI:1336887
definition	GO_function : GO:0005172 - vascular endothelial growth factor receptor binding [Evidence TAS] GO_process : GO:0007492 - endoderm development [Evidence TAS]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : angiopoietin 3 product : angiopoietin 4 protein_id : NP_033771.1

name	LOC668925 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668925
definition	number : 1 pseudo : _no_value

name	LOC279056 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250047 GeneID:279056
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 7 Proteins product : similar to XPMC2 prevents mitotic catastrophe 2 homolog pseudo : _no_value transcript_id : XR_034724.1

name	LOC100043832 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250197 GeneID:100043832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 30 ESTs, 34 Proteins product : similar to protein phosphatase 1, catalytic subunit, gamma isoform pseudo : _no_value transcript_id : XR_034989.1

name	LOC668924 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250200 GeneID:668924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 3 Proteins product : similar to RIKEN cDNA 1110005A03 gene pseudo : _no_value transcript_id : XR_034990.1

name	LOC668926 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250202 GeneID:668926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins product : similar to 60S ribosomal protein L7a (Surfeit locus protein 3) pseudo : _no_value transcript_id : XR_034992.1

name	LOC100043840 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250208 GeneID:100043840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 53 mRNAs, 2805 ESTs, 35 Proteins product : similar to alpha-tubulin isotype M-alpha-2 pseudo : _no_value transcript_id : XR_034993.1

clone name	MSMg01-478A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-498L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-311H06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539F24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-342L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352J23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-420N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408H09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533K23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339N08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-098O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-501F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155L23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-341O19.b	B6Ng01-341O19.g
ACC	GA125168	GA125169
length	803	962
definition	B6Ng01-341O19.b	B6Ng01-341O19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(150,766,357 - 150,767,160)	(150,627,295 - 150,628,248)
sequence	gaattctggaatgatgtgaatgaagctgacatttagaagcattttcttaa acgagtgtttgacctccatattcatatccttatttctccggtaaatatat aaagacagcatagaggctggctggctgttcaagccttggtaatcttcctc tggcaacacctcacaatccgtaattatttccctttagcttcagttgtacc aatggcctgggtgcatcaggcatagccgagaagactgagagggagaactt gaactactttgatcagtgtttctttctcctggaggcttgggagttagaga ctacacgtgtttctgttcatagtgatctgtgacgtgtgaatttctgctca tgctcaaaaaaaaagttcttcagacaaaaatgatgtttaggaacgaagca gctacagggaaagattcccagaaaccttctaggtcctggatacatcctgc tctttagactcaacttcttgtatatatttatggtacatttctcctttgga gctgaagctaaggaaaggttttcctactttagttaaatcattaataaatt cataacatgtacataaaaatgtgtttgaactctttttgctatagactcaa aagtacaaggatgaaatgtcacagctcaactgcagggtccttcagctgga aggagagccttctggtctccatacacagaaggaagagaaccacggtgcta tccaggtgttaatgaagaagctggaggaggcagggtgccgggaggagcag cagtcaggggctaggctgtcccacaaaccttggtgggtgggtgggtggaa gga	gaattctacatgggccgcacgctgcagaataccatggtgaacctgggcct tcagactgcatgcgacgaagccacttatcaggtgtgtttaatctgtcccc tgaagagtgaccactgacattaggacacctgtgccctggagtgttttacc ctgtcaggaaggatcatgtcccttcctcaaggggagaacataagactgta agggatgataataaatggaattatgagaagactggtttgagtggtgatgc tgtggtttagaagtttctagaaatgtactcccttctcccagtccaggggt aggttttgaatatgtcatgatctatttgatttccctctctgatcttcaga catcctcctgacctcattgtgctgtgcaggtgtagaagtgcctcctctca tggaagaagccaactgttcaggcattttctttgccttaattttacacagg tcgtttgtaccctcagcagagctgtgcttatctcccagtctctcttcact ctcctctctcctctggaacgctggtctcagatggggaagttctgtagtga gaccttgcaacatgggtacatgaaggtctttagagaggggtgccccccat gttgccgcagcaccccatctgctttgttcagagcttaggtatgaggagtt tgggggcctggtagggacataagtccagcatgggagtaagtctcgtttgg agaccaccttctctcctgaggatgtttagtcaccattctattgctatgaa aaaataatgtagagaaatcgaaagaaagaaagatccatttcggttccagt ctcagtgggcctgagacaggcagccctgcatgtaatgaagccgcttacag gtgagcatgttggcagaagtcggcctgcccacttcccagagccagcaatc aggacagagacgcaggggccaggacgcacttcctggaggggtgccttccc ccgcagggaccc
quality values	Open. Hide. 58 42 30 35 58 52 39 62 47 54 21 31 54 41 25 41 31 47 62 56 38 47 62 62 47 62 62 62 47 42 25 32 27 21 19 17 28 28 19 45 43 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 49 54 59 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 54 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 52 58 58 58 58 58 54 58 58 58 58 47 58 54 58 58 54 45 28 58 58 58 58 58 58 58 58 58 58 58 58 51 58 54 36 58 58 54 58 58 58 58 58 58 58 58 58 54 54 58 58 52 58 47 58 58 48 58 58 58 58 54 51 58 40 58 58 58 51 58 58 53 51 51 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 51 54 58 52 54 58 54 54 54 49 58 58 58 52 58 53 58 53 58 49 58 29 47 58 58 58 50 58 58 53 58 53 53 53 51 58 58 53 42 50 58 53 58 51 41 49 51 58 53 58 58 46 32 50 41 49 58 50 58 50 38 51 24 58 58 39 58 30 41 54 47 39 54 38 54 51 39 53 53 54 53 39 53 52 53 52 53 40 46 54 28 10 54 46 54 41 54 35 54 35 33 54 41 51 44 54 41 44 54 51 31 52 53 42 31 33 51 20 44 42 45 31 45 53 42 52 54 29 54 54 31 53 41 49 34 46 27 32 46 19 40 29 39 28 52 49 26 47 29 51 32 49 49 28 20 53 53 23 53 37 34 45 6 8 12 31 43 45 46 46 51 43 43 31 40 40 31 43 38 42 36 51 51 31 31 32 45 31 42 30 33 28 46 51 25 30 33 40 36 43 46 33 21 26 41 36 23 33 30 30 14 9 9 5	Open. Hide. 62 62 39 41 62 62 62 56 51 31 38 34 27 21 21 38 24 38 51 59 62 62 62 62 62 62 56 62 62 62 62 62 59 59 62 62 49 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 56 59 59 59 54 48 46 59 59 62 59 59 62 59 62 62 59 62 62 62 59 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 59 62 62 59 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 56 56 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 41 56 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 53 52 46 49 39 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 46 42 38 21 41 43 45 49 42 54 47 58 42 54 58 58 41 54 47 54 42 54 58 58 58 49 54 52 54 54 58 54 52 34 58 54 54 54 58 58 54 52 52 47 58 58 52 43 52 52 52 52 42 26 52 52 52 52 52 42 26 54 46 52 58 58 58 35 45 58 54 52 54 45 58 38 49 54 54 52 42 21 58 42 41 45 50 52 26 54 52 40 39 54 58 27 45 49 40 52 54 51 51 51 48 47 40 33 48 50 53 53 50 35 9 47 47 23 24 27 50 42 46 35 42 47 46 34 33 31 24 26 35 21 23 29 18 12 11 23 24 50 47 52 37 26 7 50 17 40 48 41 29 25 12 40 42 53 41 37 52 53 49 39 52 39 46 19 42 26 7 58 41 26 33 13 51 14 16 10 11 24 28 22 28 13 13 40 25 10 21 41 39 37 24 50 29 37 50 50 52 53 51 58 40 35 39 30 24 28 7 18 9 24 40 50 52 47 38 35 17 16 29 47 41 15 9 14 13 12 6 15 29 26 42 41 24 17 53 54 41 34 25 35 24 30 25 20 24 20 32 17 12 21 16 9 19 23 32 17 12 30 38 38 40 23 47 27 32 37 38 15 31 18 25 36 31 22 18 9 10 9 12 25 15 22 11 11 9 12 6 22 20 8 28 27 32 18 15 9 11 27 11 40 32 21 14 9 12 18 12 9 27 9 9 21 12 18 24 11 9 15 13 12 6 10 12 9 11 42 40 12 28 31 30 19 15 23 8 5 9 12 31 22 6 15 14 12 31 45 26 19 29 27 28 30 32 30 31 11 30 16 9 10 8 10 40 30 22 9 11 12 16 25 24 18 12 12 9 30 8 24 17 33 21 31 22 9 7 42 46 9 9 22 14 23 7 46 17 46 42 31 32 20 16 14 14 33 21 11 10 31 19

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_150766357_150767160
seq2: B6Ng01-341O19.b_49_851 (reverse)

seq1  TCCTTCCACCCACCCACCCACCAAGGTTTGTGGGACAGCCTAGCCCCTGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTCCACCCACCCACCCACCAAGGTTTGTGGGACAGCCTAGCCCCTGA  50

seq1  CCTGCTGCTCCTCCCGGCACCCTGCCTCCTCCAGCTTCTTCATTAACACC  100
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  -CTGCTGCTCCTCCCGGCACCCTGCCTCCTCCAGCTTCTTCATTAACACC  99

seq1  TGGATAGCACCGTGGTTCTCTTCCTTCTGTGTATGGAGACCAGAAGGCTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGATAGCACCGTGGTTCTCTTCCTTCTGTGTATGGAGACCAGAAGGCTC  149

seq1  TCCTTCCAGCTGAAGGACCCTGCAGTTGAGCTGTGACATTTCATCCTTGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTCCAGCTGAAGGACCCTGCAGTTGAGCTGTGACATTTCATCCTTGT  199

seq1  ACTTTTGAGTCTATAGCAAAAAGAGTTCAAACACATTTTTATGTACATGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTTGAGTCTATAGCAAAAAGAGTTCAAACACATTTTTATGTACATGT  249

seq1  TATGAATTTATTAATGATTTAACTAAAGTAGGAAAACCTTTCCTTAGCTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGAATTTATTAATGATTTAACTAAAGTAGGAAAACCTTTCCTTAGCTT  299

seq1  CAGCTCCAAAGGAGAAATGTACCATAAATATATACAAGAAGTTGAGTCTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTCCAAAGGAGAAATGTACCATAAATATATACAAGAAGTTGAGTCTA  349

seq1  AAGAGCAGGATGTATCCAGGACCTAGAAGGTTTCTGGGAATCTTTCCCTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGCAGGATGTATCCAGGACCTAGAAGGTTTCTGGGAATCTTTCCCTG  399

seq1  TAGCTGCTTCGTTCCTAAACATCATTTTTGTCTGAAGAACTTTTTTTTTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTGCTTCGTTCCTAAACATCATTTTTGTCTGAAGAACTTTTTTTTTG  449

seq1  AGCATGAGCAGAAATTCACACGTCACAGATCACTATGAACAGAAACACGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATGAGCAGAAATTCACACGTCACAGATCACTATGAACAGAAACACGT  499

seq1  GTAGTCTCTAACTCCCAAGCCTCCAGGAGAAAGAAACACTGATCAAAGTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGTCTCTAACTCCCAAGCCTCCAGGAGAAAGAAACACTGATCAAAGTA  549

seq1  GTTCAAGTTCTCCCTCTCAGTCTTCTCGGCTATGCCTGATGCACCCAGGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCAAGTTCTCCCTCTCAGTCTTCTCGGCTATGCCTGATGCACCCAGGC  599

seq1  CATTGGTACAACTGAAGCTAAAGGGAAATAATTACGGATTGTGAGGTGTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGGTACAACTGAAGCTAAAGGGAAATAATTACGGATTGTGAGGTGTT  649

seq1  GCCAGAGGAAGATTACCAAGGCTTGAACAGCCAGCCAGCCTCTATGCTGT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGAGGAAGATTACCAAGGCTTGAACAGCCAGCCAGCCTCTATGCTGT  699

seq1  CTTTATATATTTACCGGAGAAATAAGGATATGAATATGGAGGTCAAACAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTATATATTTACCGGAGAAATAAGGATATGAATATGGAGGTCAAACAC  749

seq1  TCGTTTAAGAAAATGCTTCTAAATGTCAGCTTCATTCACATCATTCCAGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGTTTAAGAAAATGCTTCTAAATGTCAGCTTCATTCACATCATTCCAGA  799

seq1  ATTC  804
      ||||
seq2  ATTC  803

seq1: chr2_150627295_150628248
seq2: B6Ng01-341O19.g_65_1026

seq1  GAATTCTACATGGGCCGCACGCTGCAGAATACCATGGTGAACCTGGGCCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTACATGGGCCGCACGCTGCAGAATACCATGGTGAACCTGGGCCT  50

seq1  TCAGACTGCATGCGACGAAGCCACTTATCAGGTGTGTTTAATCTGTCCCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGACTGCATGCGACGAAGCCACTTATCAGGTGTGTTTAATCTGTCCCC  100

seq1  TGAAGAGTGACCACTGACATTAGGACACCTGTGCCCTGGAGTGTTTTACC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGAGTGACCACTGACATTAGGACACCTGTGCCCTGGAGTGTTTTACC  150

seq1  CTGTCAGGAAGGATCATGTCCCTTCCTCAAGGGGAGAACATAAGACTGTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCAGGAAGGATCATGTCCCTTCCTCAAGGGGAGAACATAAGACTGTA  200

seq1  AGGGATGATAATAAATGGAATTATGAGAAGACTGGTTTGAGTGGTGATGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGATGATAATAAATGGAATTATGAGAAGACTGGTTTGAGTGGTGATGC  250

seq1  TGTGGTTTAGAAGTTTCTAGAAATGTACTCCCTTCTCCCAGTCCAGGGGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGTTTAGAAGTTTCTAGAAATGTACTCCCTTCTCCCAGTCCAGGGGT  300

seq1  AGGTTTTGAATATGTCATGATCTATTTGATTTCCCTCTCTGATCTTCAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTTTGAATATGTCATGATCTATTTGATTTCCCTCTCTGATCTTCAGA  350

seq1  CATCCTCCTGACCTCATTGTGCTGTGCAGGTGTAGAAGTGCCTCCTCTCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCCTCCTGACCTCATTGTGCTGTGCAGGTGTAGAAGTGCCTCCTCTCA  400

seq1  TGGAAGAAGCCAACTGTTCAGGCATTTTCTTTGCCTTAATTTTACACAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAGAAGCCAACTGTTCAGGCATTTTCTTTGCCTTAATTTTACACAGG  450

seq1  TCGTTTGTACCCTCAGCAGAGCTGTGCTTATCTCCCAGTCTCTCTTCACT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGTTTGTACCCTCAGCAGAGCTGTGCTTATCTCCCAGTCTCTCTTCACT  500

seq1  CTCCTCTCTCCTCTGGAACGCTGGTCTCAGATGGGGAAGTTCTGTAGTGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTCTCTCCTCTGGAACGCTGGTCTCAGATGGGGAAGTTCTGTAGTGA  550

seq1  GACCTTGCAACATGGGTACATGAAGGTCTTTAGAGAGGGGTGCCCCCCAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTTGCAACATGGGTACATGAAGGTCTTTAGAGAGGGGTGCCCCCCAT  600

seq1  GTTGCCGCAGCACCCCATCTGCTTTGTTCAGAGCTTAGGTATGAGGAGTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGCCGCAGCACCCCATCTGCTTTGTTCAGAGCTTAGGTATGAGGAGTT  650

seq1  TGGGGGCCTGGTAGGGACATAAGTCCAGCATGGGAGTAAGTCTCG-TTGG  699
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  TGGGGGCCTGGTAGGGACATAAGTCCAGCATGGGAGTAAGTCTCGTTTGG  700

seq1  AGACCACCTTCTCTCCTGAGGATG-TTAGTCACCATTCTATTGCTATGAA  748
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  AGACCACCTTCTCTCCTGAGGATGTTTAGTCACCATTCTATTGCTATGAA  750

seq1  AAAATAATGTAGAGAAATCGAAAGAAAGAAAGATCCATTTCGGTTCCAGT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATAATGTAGAGAAATCGAAAGAAAGAAAGATCCATTTCGGTTCCAGT  800

seq1  CTCAGT-GGCCTGAGACAGGCAGCCCTGCATGTAATGAAGCCGCTTACCA  847
      |||||| |||||||||||||||||||||||||||||||||||||||| ||
seq2  CTCAGTGGGCCTGAGACAGGCAGCCCTGCATGTAATGAAGCCGCTTA-CA  849

seq1  GGTGAGCATG-TGGCAG-AGTCGG-CTGCCCACTTCCCAGAGCCAGCAAT  894
      |||||||||| |||||| |||||| |||||||||||||||||||||||||
seq2  GGTGAGCATGTTGGCAGAAGTCGGCCTGCCCACTTCCCAGAGCCAGCAAT  899

seq1  CAAGGACAGAGACGCAGGGG-CAGGACGCAC-TCCTGGA-GGGTGCCTT-  940
      | |||||||||||||||||| |||||||||| ||||||| ||||||||| 
seq2  C-AGGACAGAGACGCAGGGGCCAGGACGCACTTCCTGGAGGGGTGCCTTC  948

seq1  CCCCGCAGGGACCC  954
      ||||||||||||||
seq2  CCCCGCAGGGACCC  962

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information