MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-340B19
Chromosome	2 (Build37)
Map Location	31,759,190 - 31,759,723
singlet/doublet	singlet
Overlap gene	Lamc3
Upstream gene	Ppia-ps2_387.1, Tor1b, Tor1a, BC005624, Usp20, Fnbp1, Gpr107, Freq, LOC622345, LOC670182, LOC665700, BC034076, Ass1, Fubp3, LOC100041465, Prdm12, Exosc2, Abl1, BC094274, Fibcd1
Downstream gene	2810003C17Rik, Nup214, A130092J06Rik, LOC100040058, Ppapdc3, 5830434P21Rik, Pomt1, Uck1, LOC622534, 2900010J23Rik, Golga2, Dnm1, Ciz1, 1110008P14Rik, Lcn2, Ptges2, LOC100041671, Slc25a25, 4933440H19Rik, C230093N12Rik, Dpm2, Pip5kl1, St6galnac4, St6galnac6, Ak1, Eng, Fpgs, Cdk9, Sh2d3c, Tor2a, Ttc16, Ptrh1, 1700019L03Rik, Stxbp1, 9130404D14Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ppia-ps2_387.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606546
definition	note : peptidylprolyl isomerase A pseudogene 2_387.1 pseudo : _no_value

name	Tor1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30934 MGI:1353605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tor1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30931 MGI:1353568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC005624 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227707 MGI:2385132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74270 MGI:1921520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fnbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14269 MGI:109606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gpr107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277463 MGI:2139054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Freq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14299 MGI:109166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622345 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622345
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC670182 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC665700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	BC034076 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227712 MGI:2677838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ass1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11898 MGI:88090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fubp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320267 MGI:2443699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041465 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Prdm12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381359 MGI:2685844
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Exosc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227715 MGI:2385133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11350 MGI:87859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC094274 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227717 MGI:3630329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fibcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98970 MGI:2138953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lamc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23928 MGI:1344394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810003C17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108897 MGI:1919598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup214 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227720 MGI:1095411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A130092J06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241303 MGI:2443569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040058 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Ppapdc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227721 MGI:2445183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830434P21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227723 MGI:1923304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pomt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99011 MGI:2138994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uck1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22245 MGI:98904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622534 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 399 ESTs, 9 Proteins

name	2900010J23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72931 MGI:1920181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Golga2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99412 MGI:2139395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dnm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13429 MGI:107384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ciz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68379 MGI:1920234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110008P14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73737 MGI:1920987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16819 MGI:96757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptges2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:96979 MGI:1917592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041671 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 118 ESTs pseudo : _no_value

name	Slc25a25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227731 MGI:1915913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933440H19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71254 MGI:1918504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230093N12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98952 MGI:2138935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13481 MGI:1330238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pip5kl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227733 MGI:2448520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	St6galnac4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20448 MGI:1341894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	St6galnac6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50935 MGI:1355316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11636 MGI:87977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eng (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13805 MGI:95392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fpgs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14287 MGI:95576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107951 MGI:1328368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh2d3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27387 MGI:1351631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tor2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30933 MGI:1353596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338348 MGI:2443048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptrh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329384 MGI:1913779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700019L03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227736 MGI:2447809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stxbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20910 MGI:107363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130404D14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227737 MGI:2442910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tor1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861255 GeneID:30934 MGI:1353605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin family 1, member B transcript_id : NM_133673.3

name	Tor1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450254 GeneID:30931 MGI:1353568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin family 1, member A (torsin A) transcript_id : NM_144884.1

name	BC005624 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450248 GeneID:227707 MGI:2385132
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC005624 transcript_id : NM_144885.1

name	Usp20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359890 GeneID:74270 MGI:1921520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 20 transcript_id : NM_028846.3

name	Fnbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662769 GeneID:14269 MGI:109606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin binding protein 1 transcript_id : NM_001038700.1

name	Fnbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662772 GeneID:14269 MGI:109606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin binding protein 1 transcript_id : NM_019406.2

name	Gpr107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802594 GeneID:277463 MGI:2139054
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 107 transcript_id : NM_178760.3

name	Freq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130553 GeneID:14299 MGI:109166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : frequenin homolog (Drosophila) transcript_id : NM_019681.3

name	LOC670182 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249240 GeneID:670182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical LOC670182 transcript_id : XM_001473893.1

name	LOC665700 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94366343 GeneID:665700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : hemicentin 1-like transcript_id : XM_978791.1

name	BC034076 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982240 GeneID:227712 MGI:2677838
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC034076 transcript_id : NM_177649.3

name	Ass1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893196 GeneID:11898 MGI:88090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : argininosuccinate synthetase 1 transcript_id : NM_007494.3

name	Fubp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802436 GeneID:320267 MGI:2443699
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : far upstream element (FUSE) binding protein 3 transcript_id : NM_001033389.2

name	LOC100041465 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249275 GeneID:100041465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100041465 transcript_id : XM_001478150.1

name	Prdm12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366345 GeneID:381359 MGI:2685844
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : PR domain containing 12 transcript_id : XM_355325.5

name	Exosc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386116 GeneID:227715 MGI:2385133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 2 transcript_id : NM_144886.2

name	Abl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803247 GeneID:11350 MGI:87859
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-abl Abelson murine leukemia oncogene 1 transcript_id : NM_009594.2

name	BC094274 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351388 GeneID:227717 MGI:3630329
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC094274 transcript_id : NM_183424.2

name	Fibcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353012 GeneID:98970 MGI:2138953
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibrinogen C domain containing 1 transcript_id : NM_178887.3

name	Lamc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130018 GeneID:23928 MGI:1344394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : laminin gamma 3 transcript_id : NM_011836.3

name	2810003C17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553104 GeneID:108897 MGI:1919598
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810003C17 gene transcript_id : NM_145144.1

name	Nup214 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378032 GeneID:227720 MGI:1095411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 214 transcript_id : NM_172268.2

name	A130092J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801699 GeneID:241303 MGI:2443569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A130092J06 gene transcript_id : NM_175511.3

name	LOC100040058 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249244 GeneID:100040058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100040058 transcript_id : XM_001474012.1

name	Ppapdc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356125 GeneID:227721 MGI:2445183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidic acid phosphatase type 2 domain containing 3 transcript_id : NM_145521.3

name	5830434P21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328384 GeneID:227723 MGI:1923304
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830434P21 gene transcript_id : NM_172661.2

name	Pomt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553106 GeneID:99011 MGI:2138994
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein-O-mannosyltransferase 1 transcript_id : NM_145145.1

name	Uck1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468946 GeneID:22245 MGI:98904
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uridine-cytidine kinase 1 transcript_id : NM_011675.1

name	LOC622534 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249279 GeneID:622534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 399 ESTs, 9 Proteins product : similar to Rpl36 protein transcript_id : XM_886968.3

name	2900010J23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354012 GeneID:72931 MGI:1920181
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900010J23 gene transcript_id : NM_175190.3

name	Golga2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378041 GeneID:99412 MGI:2139395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi autoantigen, golgin subfamily a, 2 transcript_id : NM_133852.2

name	Golga2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378029 GeneID:99412 MGI:2139395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi autoantigen, golgin subfamily a, 2 transcript_id : NM_001080968.1

name	Dnm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063569 GeneID:13429 MGI:107384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynamin 1 transcript_id : NM_010065.2

name	Ciz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19882246 GeneID:68379 MGI:1920234
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDKN1A interacting zinc finger protein 1 transcript_id : NM_028412.1

name	1110008P14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574083 GeneID:73737 MGI:1920987
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110008P14 gene transcript_id : NM_198001.1

name	Lcn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328048 GeneID:16819 MGI:96757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 2 transcript_id : NM_008491.1

name	Ptges2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526841 GeneID:96979 MGI:1917592
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin E synthase 2 transcript_id : NM_133783.1

name	Slc25a25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560753 GeneID:227731 MGI:1915913
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 transcript_id : NM_146118.2

name	4933440H19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922677 GeneID:71254 MGI:1918504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933440H19 gene transcript_id : NM_194335.2

name	C230093N12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801802 GeneID:98952 MGI:2138935
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230093N12 gene transcript_id : NM_153560.3

name	Dpm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560809 GeneID:13481 MGI:1330238
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dolichol-phosphate (beta-D) mannosyltransferase 2 transcript_id : NM_010073.2

name	Pip5kl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38016143 GeneID:227733 MGI:2448520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol-4-phosphate 5-kinase-like 1 transcript_id : NM_198191.1

name	St6galnac4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56711335 GeneID:20448 MGI:1341894
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 transcript_id : NM_011373.2

name	St6galnac6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778763 GeneID:50935 MGI:1355316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 transcript_id : NM_001025311.1

name	St6galnac6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778902 GeneID:50935 MGI:1355316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 transcript_id : NM_016973.2

name	St6galnac6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778903 GeneID:50935 MGI:1355316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 transcript_id : NM_001025310.1

name	Ak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130459 GeneID:11636 MGI:87977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylate kinase 1 transcript_id : NM_021515.2

name	Eng (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679648 GeneID:13805 MGI:95392
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endoglin transcript_id : NM_007932.1

name	Fpgs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469106 GeneID:14287 MGI:95576
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : folylpolyglutamyl synthetase transcript_id : NM_010236.1

name	Cdk9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662403 GeneID:107951 MGI:1328368
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 9 (CDC2-related kinase) transcript_id : NM_130860.2

name	Sh2d3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982734 GeneID:27387 MGI:1351631
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2 domain containing 3C transcript_id : NM_013781.2

name	Tor2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130175 GeneID:30933 MGI:1353596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin family 2, member A transcript_id : NM_152800.2

name	Ttc16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28893556 GeneID:338348 MGI:2443048
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 16 transcript_id : NM_177384.1

name	Ptrh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802363 GeneID:329384 MGI:1913779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) transcript_id : NM_178595.3

name	1700019L03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931145 GeneID:227736 MGI:2447809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700019L03 gene transcript_id : NM_025619.1

name	Stxbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678178 GeneID:20910 MGI:107363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin binding protein 1 transcript_id : NM_009295.1

name	9130404D14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122640 GeneID:227737 MGI:2442910
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130404D14 gene transcript_id : NM_146119.1

name	Tor1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559990 CCDS:CCDS15890.1 GeneID:30934 MGI:1353605
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : torsin family 1, member B protein_id : NP_598434.2

name	Tor1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450255 CCDS:CCDS15891.1 GeneID:30931 MGI:1353568
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : dystonia 1 product : torsin A protein_id : NP_659133.1

name	BC005624 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450249 CCDS:CCDS15892.1 GeneID:227707 MGI:2385132
definition	codon_start : 1 product : cDNA sequence BC005624 protein_id : NP_659134.1

name	Usp20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794162 CCDS:CCDS15893.1 GeneID:74270 MGI:1921520
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ubiquitin specific protease 20 protein_id : NP_083122.1

name	Fnbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662770 GeneID:14269 MGI:109606
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; formin binding protein 17 product : formin binding protein 1 isoform a protein_id : NP_001033789.1

name	Fnbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956088 CCDS:CCDS15894.1 GeneID:14269 MGI:109606
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; formin binding protein 17 product : formin binding protein 1 isoform b protein_id : NP_062279.1

name	Gpr107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520219 CCDS:CCDS15895.1 GeneID:277463 MGI:2139054
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : expressed sequence AI790205 protein_id : NP_848875.1

name	Freq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790115 CCDS:CCDS15896.1 GeneID:14299 MGI:109166
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence TAS] GO_process : GO:0050806 - positive regulation of synaptic transmission [Evidence TAS] codon_start : 1 note : neuronal calcium sensor-1 product : frequenin homolog protein_id : NP_062655.1

name	LOC670182 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249241 GeneID:670182
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473943.1

name	LOC665700 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94366344 GeneID:665700
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983885.1

name	BC034076 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982241 CCDS:CCDS15897.1 GeneID:227712 MGI:2677838
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC227712 protein_id : NP_808317.2

name	Ass1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6996911 CCDS:CCDS15898.1 GeneID:11898 MGI:88090
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004055 - argininosuccinate synthase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0006526 - arginine biosynthesis [Evidence IEA]; GO:0000050 - urea cycle [Evidence IEA] codon_start : 1 note : arginosuccinate synthetase 1 product : argininosuccinate synthetase protein_id : NP_031520.1

name	Fubp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370320 CCDS:CCDS15899.1 GeneID:320267 MGI:2443699
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : far upstream element (FUSE) binding protein 3 protein_id : NP_001028561.1

name	LOC100041465 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249276 GeneID:100041465
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478200.1

name	Prdm12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366346 GeneID:381359 MGI:2685844
definition	codon_start : 1 product : PR domain containing 12 protein_id : XP_355325.5

name	Exosc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450259 CCDS:CCDS15900.1 GeneID:227715 MGI:2385133
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 note : homolog of Yeast RRP4 (ribosomal RNA processing 4), 3'-5'-exoribonuclease product : exosome component 2 protein_id : NP_659135.1

name	Abl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859504 CCDS:CCDS15901.1 GeneID:11350 MGI:87859
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Abelson murine leukemia oncogene product : v-abl Abelson murine leukemia oncogene 1 protein_id : NP_033724.1

name	BC094274 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34556201 CCDS:CCDS15902.1 GeneID:227717 MGI:3630329
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005184 - neuropeptide hormone activity [Evidence ISS] GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence ISS] [Evidence IEA] codon_start : 1 note : P518 precursor protein; P518 precursor protein (P518) product : P518 precursor protein_id : NP_906269.1

name	Fibcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725730 GeneID:98970 MGI:2138953
definition	codon_start : 1 exception : mismatches in translation product : fibrinogen C domain containing 1 protein_id : NP_849218.1

name	Lamc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66392579 CCDS:CCDS15903.1 GeneID:23928 MGI:1344394
definition	GO_component : GO:0005604 - basement membrane [Evidence IEA]; GO:0031012 - extracellular matrix [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : laminin gamma 3 protein_id : NP_035966.2

name	2810003C17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553105 CCDS:CCDS15904.1 GeneID:108897 MGI:1919598
definition	codon_start : 1 product : ionized calcium binding adapter molecule 2 protein_id : NP_660126.1

name	Nup214 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378033 GeneID:227720 MGI:1095411
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005643 - nuclear pore [Evidence TAS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005487 - nucleocytoplasmic transporter activity [Evidence IMP]; GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IMP]; GO:0006611 - protein export from nucleus [Evidence ISS]; GO:0006606 - protein import into nucleus [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IMP] codon_start : 1 product : nucleoporin 214 protein_id : NP_758472.2

name	A130092J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425270 CCDS:CCDS15905.1 GeneID:241303 MGI:2443569
definition	codon_start : 1 product : hypothetical protein LOC241303 protein_id : NP_780720.1

name	LOC100040058 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249245 GeneID:100040058
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474062.1

name	Ppapdc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704026 CCDS:CCDS15906.1 GeneID:227721 MGI:2445183
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : phosphatidic acid phosphatase type 2 domain containing 3 protein_id : NP_663496.1

name	5830434P21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328385 CCDS:CCDS15907.1 GeneID:227723 MGI:1923304
definition	codon_start : 1 product : hypothetical protein LOC227723 protein_id : NP_766249.2

name	Pomt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553107 CCDS:CCDS15908.1 GeneID:99011 MGI:2138994
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence ISS] GO_function : GO:0004169 - dolichyl-phosphate-mannose-protein mannosyltransferase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000030 - mannosyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0006493 - protein amino acid O-linked glycosylation [Evidence IEA] codon_start : 1 product : protein O-mannosyltransferase 1 protein_id : NP_660127.1

name	Uck1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468947 CCDS:CCDS15909.1 GeneID:22245 MGI:98904
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004849 - uridine kinase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 note : uridine monophosphate kinase product : uridine-cytidine kinase 1 protein_id : NP_035805.1

name	LOC622534 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249280 GeneID:622534
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892061.2

name	2900010J23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424800 GeneID:72931 MGI:1920181
definition	codon_start : 1 product : hypothetical protein LOC72931 protein_id : NP_780399.1

name	Golga2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378042 GeneID:99412 MGI:2139395
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA] [Evidence ISS]; GO:0005801 - Golgi cis face [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1; SY11 protein; golgi autoantigen, golgin subfamily a product : golgi autoantigen, golgin subfamily a, 2 isoform a protein_id : NP_598613.2

name	Golga2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378030 GeneID:99412 MGI:2139395
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA] [Evidence ISS]; GO:0005801 - Golgi cis face [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2; SY11 protein; golgi autoantigen, golgin subfamily a product : golgi autoantigen, golgin subfamily a, 2 isoform b protein_id : NP_001074437.1

name	Dnm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063570 GeneID:13429 MGI:107384
definition	EC_number : 3.6.5.5 GO_component : GO:0030117 - membrane coat [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : dynamin protein_id : NP_034195.2

name	Ciz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19882247 CCDS:CCDS15911.1 GeneID:68379 MGI:1920234
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : CDKN1A-interacting zinc finger protein 1 product : Cip1-interacting zinc finger protein protein_id : NP_082688.1

name	1110008P14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574084 GeneID:73737 MGI:1920987
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73737 protein_id : NP_932118.1

name	Lcn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328049 CCDS:CCDS15913.1 GeneID:16819 MGI:96757
definition	GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : lipocalin 2 protein_id : NP_032517.1

name	Ptges2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526842 CCDS:CCDS15914.1 GeneID:96979 MGI:1917592
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0050220 - prostaglandin-E synthase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0001516 - prostaglandin biosynthesis [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0046903 - secretion [Evidence IDA] codon_start : 1 exception : mismatches in translation product : prostaglandin E synthase 2 protein_id : NP_598544.1

name	Slc25a25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560754 CCDS:CCDS15915.1 GeneID:227731 MGI:1915913
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : mitochondrial Ca2+-dependent solute carrier protein_id : NP_666230.2

name	4933440H19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37059816 CCDS:CCDS15916.1 GeneID:71254 MGI:1918504
definition	codon_start : 1 product : hypothetical protein LOC71254 protein_id : NP_919316.1

name	C230093N12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956346 CCDS:CCDS15917.1 GeneID:98952 MGI:2138935
definition	codon_start : 1 product : early estrogen-induced gene 1 protein protein_id : NP_705788.1

name	Dpm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753672 GeneID:13481 MGI:1330238
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0009059 - macromolecule biosynthesis [Evidence IEA] codon_start : 1 product : dolichol-phosphate (beta-D) mannosyltransferase 2 protein_id : NP_034203.1

name	Pip5kl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016144 CCDS:CCDS15920.1 GeneID:227733 MGI:2448520
definition	GO_component : GO:0042995 - cell projection [Evidence IDA] GO_function : GO:0016308 - 1-phosphatidylinositol-4-phosphate 5-kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : phosphatidylinositol phosphate kinase-like product : phosphatidylinositol-4-phosphate 5-kinase-like 1 protein_id : NP_937834.1

name	St6galnac4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755512 CCDS:CCDS15921.1 GeneID:20448 MGI:1341894
definition	EC_number : 2.4.99.7 GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047290 - (alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1, 3)-N-acetyl-galactosaminide 6-alpha-sialyltransferase activity [Evidence IEA]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : ST6GalNAc IV; sialyltransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) D; Sia-alpha-2-3-Gal-beta-1-3-GalNAc GalNAc-alpha-2,6-sialyltransferase; GalNAc alpha-2,6-sialyltransferase; ST6 neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 protein_id : NP_035503.1

name	St6galnac6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778764 CCDS:CCDS15922.1 GeneID:50935 MGI:1355316
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030173 - integral to Golgi membrane [Evidence IEA] GO_function : GO:0001665 - alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity [Evidence IDA]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence IDA]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; sialytransferase 7 (alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F; ST6GalNAcVI; sialytransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F; (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 isoform 3 protein_id : NP_001020482.1

name	St6galnac6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394269 CCDS:CCDS15923.1 GeneID:50935 MGI:1355316
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030173 - integral to Golgi membrane [Evidence IEA] GO_function : GO:0001665 - alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity [Evidence IDA]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence IDA]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; sialytransferase 7 (alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F; ST6GalNAcVI; sialytransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F; (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 isoform 1 protein_id : NP_058669.1

name	St6galnac6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778904 GeneID:50935 MGI:1355316
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030173 - integral to Golgi membrane [Evidence IEA] GO_function : GO:0001665 - alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity [Evidence IDA]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence IDA]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; sialytransferase 7 (alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F; ST6GalNAcVI; sialytransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F; (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 isoform 2 protein_id : NP_001020481.1

name	Ak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946936 CCDS:CCDS15924.1 GeneID:11636 MGI:87977
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004017 - adenylate kinase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0019201 - nucleotide kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046034 - ATP metabolism [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA] codon_start : 1 note : cytosolic adenylate kinase product : adenylate kinase 1 protein_id : NP_067490.1

name	Eng (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679649 CCDS:CCDS15925.1 GeneID:13805 MGI:95392
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence TAS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0017015 - regulation of transforming growth factor beta receptor signaling pathway [Evidence TAS] codon_start : 1 exception : mismatches in translation note : transmembrane glycoprotein product : endoglin protein_id : NP_031958.1

name	Fpgs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469107 CCDS:CCDS15926.1 GeneID:14287 MGI:95576
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004326 - tetrahydrofolylpolyglutamate synthase activity [Evidence IEA] GO_process : GO:0009396 - folic acid and derivative biosynthesis [Evidence IEA]; GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : folylpolyglutamyl synthetase protein_id : NP_034366.1

name	Cdk9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18699998 CCDS:CCDS15927.1 GeneID:107951 MGI:1328368
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0017069 - snRNA binding [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : cyclin-dependent kinase 9 protein_id : NP_570930.1

name	Sh2d3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305329 CCDS:CCDS15928.1 GeneID:27387 MGI:1351631
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005068 - transmembrane receptor protein tyrosine kinase adaptor protein activity [Evidence TAS] GO_process : GO:0007165 - signal transduction [Evidence TAS]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : novel SH2-containing protein 3; Cas/HEF1-associated signal transducer; SH2-containing Eph receptor-binding protein 1 product : SH2 domain containing 3C protein_id : NP_038809.1

name	Tor2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779883 CCDS:CCDS15929.1 GeneID:30933 MGI:1353596
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IEA] codon_start : 1 product : torsin family 2, member A protein_id : NP_690013.1

name	Ttc16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893557 CCDS:CCDS15930.1 GeneID:338348 MGI:2443048
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : tetratricopeptide repeat domain 16 protein_id : NP_796358.1

name	Ptrh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519902 CCDS:CCDS15931.1 GeneID:329384 MGI:1913779
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 note : novel protein similar to bacterial peptidyl-tRNA hydrolase product : peptidyl-tRNA hydrolase 1 homolog protein_id : NP_848710.1

name	1700019L03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113931146 CCDS:CCDS15932.1 GeneID:227736 MGI:2447809
definition	codon_start : 1 product : hypothetical protein LOC227736 protein_id : NP_079895.1

name	Stxbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678179 CCDS:CCDS15933.1 GeneID:20910 MGI:107363
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007412 - axon target recognition [Evidence IMP]; GO:0015031 - protein transport [Evidence IEA]; GO:0016188 - synaptic vesicle maturation [Evidence IMP]; GO:0006810 - transport [Evidence IEA]; GO:0006904 - vesicle docking during exocytosis [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : minisatellite 10g detected by probe MMS10; UNC-18 homolog product : syntaxin binding protein 1 protein_id : NP_033321.1

name	9130404D14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122641 CCDS:CCDS15934.1 GeneID:227737 MGI:2442910
definition	codon_start : 1 note : novel PH domain containing protein product : hypothetical protein LOC227737 protein_id : NP_666231.1

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 1 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 2 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 3 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 4 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 5 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 6 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 7 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 8 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 9 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 10 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 11 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 12 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 13 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 14 pseudo : _no_value

name	LOC622345 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622345
definition	number : 15 pseudo : _no_value

name	LOC100041671 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249283 GeneID:100041671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 118 ESTs product : hypothetical protein LOC100041671 pseudo : _no_value transcript_id : XR_033714.1

clone name	MSMg01-351I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418G04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-262G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023A07
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-340B19.T7 (MSMg01no340_b19.b1)	MSMg01-340B19.TJ (MSMg01no340_b19.g1)
ACC	AG454231	AG454232
length	687	741
length of high quality (start - end)	123 (48 - 170)	533 (76 - 608)
definition	CHROMAT_FILE: MSMg01no340_b19.b1 PHD_FILE: MSMg01no340_b19.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:29:05 2005	CHROMAT_FILE: MSMg01no340_b19.g1 PHD_FILE: MSMg01no340_b19.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:29:05 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	NNAACCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTCCGAGGATCC GCGGAATTCATGATCCTCCTGCCTCAACTTTCTGAATGTTAGCGTTTAAA GGGTTGTGCCACCATATTCACTATGGAGACTTAAATCTTTATTCAATATT CAGGTCAGAAGAAAACTTNTCTGGGGCCTTCACTGGCAGAAATGGAACCC CAAGGGAAAAGGGAAAACCCTGGGAATTTTTTTGGGGCCCGGCCGGAAAA AAAAACCCAAAGGGTGAAATTTCCGGGGTTTAAAAAAAAAAAAAAAAAAA AAGAGGGGCCCCCCGGGGGGGGCCCCNNAAGGCTTTTGGGGGTAAAAAAA ATCCCCCTAAAAAAAAACCATTTTTTTGGGGCGGGGGGGGGGGGGGTTAA AAAAGAGGGGGGGGCGGCCCCCCCCCCCCCCCCAAAAAAAGAAAAAAAAA CCCCTCCCTCCCCACCCACCGGGGAGAAAATATTTTTTTTTCCCCCCCCG GGGGTTTTTTGTTTTTTTGCCACCCCCCCCCCCCCCCCCCCGGGGGGGGG GGGGAGGAAATTTTTTTGGGGNGNACCACAAAAAAAAAAATTTTTTTTTT TTTTTGGGGGGGGTTAAAACCAAAAAAAAAAAAAAAAAACAAACCCCCCC ACCCCCCCCCCCCTTTTTTTTTTGTTGTTTTTTTTTT	NCGATGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXTGTGCCTGGCTCCAGGCACCACACA GTGAAGCCGGAAGCAGAGGAGGACCGTGAAGGGAGATGGGCTGGACCAGG GCAAGTGGGATGCTGGGGTGGCTGGTACAGACACTGGGAAGGCTTCTTTT CCCTCTCCACCATCCTTGCAGAAGGTTCCAGGGCCCCTTCCTTCCTTTAC CAGCATGTCTTTGAGGTTAAACAGACAGAGCCACACCACACACAGCTGAA ACATCAAAGGGCTGCTGGGGACTGCGGGGGACTGTGGGAAAGACTGGGGT GGGCGGATCTGAATCCTATGGGTGGGGGTGGAAGACTGGATTTCATTAGC TGCCAGGGTTGGAACAGTTAAGAAAGGGTTAAGTGGAGTTTGGGGACCTT CCTGCCCTCCTACCACAGGCGCCTCTCTGGGTGGACTCATCCTGGAATGA CTTGTGAGGGAGGACTGGGGCTCAAGTGCTCCCTAGACATCATGTTCACT CTCCTGCACAGCCAAGGACCCCACACTGAATGCCAGGCCCACCCAGGGGC ACAGGCAGCCCACTGTGGTTTGGGGCATTGTTTCCTGTCAGTCTCATTAG CTTCAAGGCTGCTGGCTCANAAAACTCACGCAGAACTCGTTGGGATCCTC ACGCGGGGCTCGGGGCCCACGAAGGCCCCGGAAAAAGAGCA
quality values	Open. Hide. 0 0 3 6 6 6 8 6 6 8 8 10 19 34 37 37 32 29 29 37 23 24 22 28 28 28 43 48 30 29 28 28 26 30 27 25 8 6 6 6 8 8 11 12 12 12 11 14 19 23 37 47 41 23 19 17 19 30 23 30 33 33 37 37 37 37 32 32 30 28 23 23 32 27 47 37 33 33 37 37 37 39 39 30 26 26 28 30 30 30 33 41 50 50 50 53 53 57 57 57 50 50 50 50 37 47 57 53 53 50 50 50 53 53 68 68 51 47 42 42 42 50 68 68 68 68 68 68 68 68 68 68 68 47 47 47 47 47 53 53 53 53 53 50 50 50 53 50 53 53 47 47 44 41 39 37 37 37 37 37 37 39 39 39 37 25 10 3 0 3 14 7 9 9 9 9 9 24 27 27 28 22 15 13 13 8 8 8 14 7 7 6 9 9 9 12 14 20 20 14 9 9 9 9 9 9 18 12 12 12 9 14 9 8 8 8 10 10 8 8 8 8 8 8 8 10 10 10 16 12 11 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 16 22 28 36 41 21 17 11 9 9 9 8 9 10 10 10 8 9 9 8 8 8 6 6 6 6 8 6 14 12 12 9 11 12 12 12 15 31 23 19 8 8 8 12 10 11 14 23 21 23 23 23 13 12 8 8 8 8 9 8 11 10 13 11 12 12 12 10 10 9 10 13 8 8 8 8 12 12 3 0 0 3 8 8 8 8 8 6 8 6 8 8 8 12 10 9 9 12 12 12 12 12 11 11 11 11 9 9 9 9 11 11 11 11 13 19 18 12 11 8 8 8 8 10 11 19 25 21 21 11 10 9 11 8 8 8 10 10 17 18 17 22 24 26 26 16 10 8 8 8 8 8 11 12 13 13 8 8 8 10 8 15 20 20 18 17 8 8 8 8 8 8 8 8 8 12 19 23 22 29 27 20 15 10 9 9 10 16 16 16 17 14 10 10 10 22 15 21 15 12 10 10 10 10 12 11 10 10 11 15 11 11 12 17 10 6 6 6 10 6 7 7 7 14 11 6 6 6 6 8 7 8 8 8 10 13 17 22 21 22 23 12 8 6 6 8 8 12 8 11 9 9 9 9 8 11 8 8 8 8 8 8 8 8 8 8 16 19 8 8 8 8 8 8 7 7 8 12 11 12 12 12 12 22 23 19 9 9 9 15 14 9 9 8 8 8 8 19 22 28 24 24 25 24 18 11 10 6 6 6 6 9 10 11 17 17 14 13 10 8 8 8 15 3 0 3 0 3 8 8 9 9 9 9 7 7 7 9 11 12 22 15 12 8 8 8 8 11 15 17 14 14 13 13 19 7 11 7 7 8 10 21 22 15 8 6 6 8 8 11 11 8 9 9 9 10 9 9 10 9 9 9 25 19 18 12 12 18 19 19 17 9 7 6 10 10 10 10 10 9 7 7 8 8 8 13 17 29 37 37 27 30 22 20 16 16 17 17 18 22 27 26 29 23 23 9 6 6 6 6 6 9 13 25 38 14 14 14 14 14	Open. Hide. 0 3 8 8 10 10 10 9 8 7 7 9 9 18 21 37 37 41 39 39 39 39 41 42 37 37 37 37 37 37 43 34 22 12 11 15 15 18 22 19 21 24 30 30 48 53 57 57 27 23 14 14 20 33 23 53 53 53 53 48 42 36 36 36 36 36 43 46 57 42 42 41 41 43 43 57 68 68 68 68 68 59 59 59 59 51 51 50 50 50 51 68 68 68 68 68 68 68 57 57 50 50 57 57 68 68 68 59 59 68 68 68 57 57 68 68 68 68 68 68 68 68 68 68 68 50 68 68 68 68 68 68 68 51 51 50 50 50 50 59 68 68 68 68 68 68 68 68 50 50 68 51 51 51 68 68 68 48 57 29 35 35 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 68 68 68 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 57 57 57 57 57 57 57 57 59 59 59 57 59 59 50 50 50 50 47 59 59 59 44 37 39 44 44 44 47 59 59 59 59 44 41 39 44 44 44 47 47 59 59 59 59 48 48 48 48 48 41 47 37 37 37 37 37 30 37 44 59 39 41 42 41 41 48 48 48 59 59 59 59 59 59 39 39 39 43 43 59 59 47 43 41 40 40 43 43 43 57 46 48 48 59 41 40 40 39 39 39 32 28 28 31 27 24 24 27 25 24 35 35 36 36 47 47 43 41 37 31 34 20 17 17 25 21 31 24 24 24 24 25 29 34 37 28 27 31 32 33 37 37 37 34 29 24 19 19 15 15 16 24 22 21 13 12 12 19 23 36 28 32 24 26 28 30 19 16 13 14 17 16 24 21 12 16 11 11 11 18 12 24 12 22 16 23 17 13 9 9 9 9 10 11 11 11 11 10 10 12 12 13 16 12 11 11 11 11 3 0 3 10 10 11 8 10 9 9 9 10 15 11 11 11 15 12 10 9 10 8 8 8 8 8 10 12 12 8 7 8 7 6 6 6 6 11 8 10 12 12 8 8 9 9 8 10 13 8 8 8 10 8 13 10 10 8 8 8 7 7 7 11 15 14 9 9 9 9 10 10 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no340_b19.g1 MSMg01no340_b19.g1 CHROMAT_FILE:
MSMg01no340_b19.g1 PHD_FILE: MSMg01no340_b19.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 22:29:05 2005
         (533 letters)



>mm_chr2_31758990_31759923
          Length = 934

 Score = 1002 bits (518), Expect = 0.0
 Identities = 530/534 (99%), Gaps = 1/534 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   tgtgcctggctccaggcaccacacagtgaagccggaagcagaggaggaccgtgaagggag 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 734 tgtgcctggctccaggcaccacacagtgaagccggaagcagaggaggaccgtgaagggag 675

                                                                       
Query: 61  atgggctggaccagggcaagtgggatgctggggtggctggtacagacactgggaaggctt 120
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 674 atgggctggaccagggcaagtgggatgctggagtggctggtacagacactgggaaggctt 615

                                                                       
Query: 121 cttttccctctccaccatccttgcagaaggttccagggccccttccttcctttaccagca 180
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 614 cttttccctctccaccatccttgcagaaggttccagggccccttccttccttcaccagca 555

                                                                       
Query: 181 tgtctttgaggttaaacagacagagccacaccacacacagctgaaacatcaaagggctgc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 554 tgtctttgaggttaaacagacagagccacaccacacacagctgaaacatcaaagggctgc 495

                                                                       
Query: 241 tggggactgc-gggggactgtgggaaagactggggtgggcggatctgaatcctatgggtg 299
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 494 tggggactgcggggggactgtgggaaagactggggtgggcggatctgaatcctatgggtg 435

                                                                       
Query: 300 ggggtggaagactggatttcattagctgccagggttggaacagttaagaaagggttaagt 359
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 434 ggggtggaagactggatttcattagctgccagggttggaacagttaagaaagggttaagt 375

                                                                       
Query: 360 ggagtttggggaccttcctgccctcctaccacaggcgcctctctgggtggactcatcctg 419
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 374 ggagtttggggaccttcctgccctcctaccacaggcgcctctctgggtggactcatcctg 315

                                                                       
Query: 420 gaatgacttgtgagggaggactggggctcaagtgctccctagacatcatgttcactctcc 479
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 314 gaatgacttgtgagggaggactggggctcaagtgctccctagacatcatgttcactctcc 255

                                                                 
Query: 480 tgcacagccaaggaccccacactgaatgccaggcccacccaggggcacaggcag 533
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 254 tgcccagccaaggaccccacactgaatgccaggcccacccaggggcacaggcag 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 25
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 533
Length of database: 934
Length adjustment: 10
Effective length of query: 523
Effective length of database: 924
Effective search space:   483252
Effective search space used:   483252
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information