MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-450N18
Chromosome	2 (Build37)
Map Location	154,357,716 - 154,357,958
singlet/doublet	singlet
Overlap gene	Cbfa2t2
Upstream gene	Commd7, 7530422B04Rik, Dnmt3b, LOC668932, Mapre1, EG329541, LOC100043869, Spag4l, Bpil1, Bpil3, Rya3, LOC100043870, Gm1006, EG545477, Psp, LOC100043652, 1700058C13Rik, Plunc, 2310021H06Rik, U46068, BC018465, 5430413K10Rik, OTTMUSG00000015915, Cdk5rap1, Snta1
Downstream gene	Apba2bp, 1700003F12Rik, E2f1, Pxmp4, Zfp341, Chmp4b, LOC668936, LOC435692, Raly, Eif2s2, a, Ahcy, Itch, LOC100043877, LOC668931, Dynlrb1, Map1lc3a, Cdc91l1, Trp53inp2, Ncoa6, LOC668938, Ggtl3, Acss2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Commd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99311 MGI:1914197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	7530422B04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228792 MGI:2685409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Dnmt3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13436 MGI:1261819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	LOC668932 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 11 Proteins

name	Mapre1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13589 MGI:891995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG329541 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329541 MGI:3644206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043869 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 531 ESTs, 7 Proteins

name	Spag4l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76407 MGI:1923657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bpil1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66557 MGI:1913807
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bpil3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228796 MGI:2684965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rya3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378700 MGI:2675077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043870 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gm1006 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381399 MGI:2685852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545477 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545477 MGI:3647736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19194 MGI:97787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	1700058C13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73388 MGI:1920638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plunc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18843 MGI:1338036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310021H06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67135 MGI:1914385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	U46068 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228801 MGI:2137431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC018465 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228802 MGI:2385160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430413K10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71425 MGI:1918675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000015915 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433492 MGI:3709343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk5rap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66971 MGI:1914221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snta1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20648 MGI:101772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbfa2t2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12396 MGI:1333833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apba2bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56846 MGI:1861721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700003F12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75480 MGI:1922730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E2f1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13555 MGI:101941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pxmp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59038 MGI:1891701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228807 MGI:2682937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chmp4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75608 MGI:1922858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 1543 ESTs, 11 Proteins

name	LOC435692 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins pseudo : _no_value

name	Raly (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19383 MGI:97850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2s2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67204 MGI:1914454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50518 MGI:87853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ahcy (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269378 MGI:87968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itch (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16396 MGI:1202301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043877 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC668931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668931
definition	note : proteasome (prosome, macropain) subunit, beta type 3 pseudogene pseudo : _no_value

name	Dynlrb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67068 MGI:1914318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map1lc3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66734 MGI:1915661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc91l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228812 MGI:3039607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trp53inp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68728 MGI:1915978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncoa6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56406 MGI:1929915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668938 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 5 Proteins pseudo : _no_value

name	Ggtl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207182 MGI:1913385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acss2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60525 MGI:1890410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Commd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29789332 GeneID:99311 MGI:1914197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COMM domain containing 7 transcript_id : NM_133850.1

name	7530422B04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250069 GeneID:228792 MGI:2685409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 7530422B04 gene transcript_id : XM_001480604.1

name	Dnmt3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801915 GeneID:13436 MGI:1261819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3B transcript_id : NM_001003961.2

name	Dnmt3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803432 GeneID:13436 MGI:1261819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3B transcript_id : NM_001003963.2

name	Dnmt3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388604 GeneID:13436 MGI:1261819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3B transcript_id : NM_001003960.2

name	Dnmt3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803558 GeneID:13436 MGI:1261819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3B transcript_id : NM_010068.3

name	LOC668932 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250071 GeneID:668932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 11 Proteins product : similar to DNA cytosine-5 methyltransferase 3B2 transcript_id : XM_001004878.2

name	Mapre1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063571 GeneID:13589 MGI:891995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein, RP/EB family, member 1 transcript_id : NM_007896.3

name	EG329541 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802612 GeneID:329541 MGI:3644206
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG329541 transcript_id : NM_177849.3

name	LOC100043869 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250212 GeneID:100043869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 531 ESTs, 7 Proteins product : similar to Translocase of outer mitochondrial membrane 20 homolog (yeast) transcript_id : XM_001481127.1

name	Spag4l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32261333 GeneID:76407 MGI:1923657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 4-like transcript_id : NM_029599.1

name	Bpil1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380515 GeneID:66557 MGI:1913807
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bactericidal/permeability-increasing protein-like 1 transcript_id : NM_025631.2

name	Bpil3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556281 GeneID:228796 MGI:2684965
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bactericidal/permeability-increasing protein-like 3 transcript_id : NM_199303.1

name	Rya3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:35902743 GeneID:378700 MGI:2675077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : antimicrobial peptide RYA3 transcript_id : NM_194357.1

name	LOC100043870 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250214 GeneID:100043870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043870 transcript_id : XM_001481133.1

name	Gm1006 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131066 GeneID:381399 MGI:2685852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1006, (NCBI) transcript_id : NM_001034875.2

name	EG545477 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249112 GeneID:545477 MGI:3647736
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545477 transcript_id : NM_001080811.1

name	Psp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982095 GeneID:19194 MGI:97787
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : parotid secretory protein transcript_id : NM_008953.2

name	1700058C13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130490 GeneID:73388 MGI:1920638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700058C13 gene transcript_id : NM_028528.2

name	Plunc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348464 GeneID:18843 MGI:1338036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : palate, lung, and nasal epithelium carcinoma associated transcript_id : NM_011126.2

name	2310021H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802605 GeneID:67135 MGI:1914385
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310021H06 gene transcript_id : NM_025990.2

name	U46068 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59939911 GeneID:228801 MGI:2137431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence U46068 transcript_id : NM_001012392.1

name	U46068 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59939909 GeneID:228801 MGI:2137431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence U46068 transcript_id : NM_153418.2

name	BC018465 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450266 GeneID:228802 MGI:2385160
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC018465 transcript_id : NM_144890.1

name	5430413K10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982542 GeneID:71425 MGI:1918675
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430413K10 gene transcript_id : NM_175167.3

name	OTTMUSG00000015915 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909313 GeneID:433492 MGI:3709343
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000015915 transcript_id : NM_001025574.1

name	Cdk5rap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130251 GeneID:66971 MGI:1914221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDK5 regulatory subunit associated protein 1 transcript_id : NM_025876.2

name	Snta1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678056 GeneID:20648 MGI:101772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntrophin, acidic 1 transcript_id : NM_009228.1

name	Cbfa2t2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41152519 GeneID:12396 MGI:1333833
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) transcript_id : NM_172860.1

name	Apba2bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130437 GeneID:56846 MGI:1861721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor protein-binding, family A, member 1 binding protein transcript_id : NM_021546.2

name	1700003F12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802924 GeneID:75480 MGI:1922730
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700003F12 gene transcript_id : NM_029305.2

name	E2f1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347517 GeneID:13555 MGI:101941
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E2F transcription factor 1 transcript_id : NM_007891.2

name	Pxmp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365206 GeneID:59038 MGI:1891701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal membrane protein 4 transcript_id : NM_021534.3

name	Zfp341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556275 GeneID:228807 MGI:2682937
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 341 transcript_id : NM_199304.1

name	Chmp4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672914 GeneID:75608 MGI:1922858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromatin modifying protein 4B transcript_id : NM_029362.3

name	LOC668936 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250072 GeneID:668936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 1543 ESTs, 11 Proteins product : similar to ribosomal protein L5 transcript_id : XM_001004898.2

name	Raly (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963504 GeneID:19383 MGI:97850
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hnRNP-associated with lethal yellow transcript_id : NM_023130.1

name	Eif2s2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311551 GeneID:67204 MGI:1914454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2, subunit 2 (beta) transcript_id : NM_026030.2

name	a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031989 GeneID:50518 MGI:87853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nonagouti transcript_id : NM_015770.3

name	Ahcy (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098091 GeneID:269378 MGI:87968
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S-adenosylhomocysteine hydrolase transcript_id : NM_016661.2

name	Itch (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487316 GeneID:16396 MGI:1202301
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : itchy, E3 ubiquitin protein ligase transcript_id : NM_008395.2

name	LOC100043877 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250217 GeneID:100043877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100043877 transcript_id : XM_001481148.1

name	Dynlrb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802705 GeneID:67068 MGI:1914318
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein light chain roadblock-type 1 transcript_id : NM_025947.2

name	Map1lc3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956147 GeneID:66734 MGI:1915661
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 1 light chain 3 alpha transcript_id : NM_025735.1

name	Cdc91l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52630435 GeneID:228812 MGI:3039607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC91 cell division cycle 91-like 1 (S. cerevisiae) transcript_id : NM_001004721.1

name	Trp53inp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130530 GeneID:68728 MGI:1915978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 inducible nuclear protein 2 transcript_id : NM_178111.3

name	Ncoa6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790176 GeneID:56406 MGI:1929915
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor coactivator 6 transcript_id : NM_019825.1

name	Ggtl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450126 GeneID:207182 MGI:1913385
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-glutamyltransferase-like 3 transcript_id : NM_144786.1

name	Acss2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892533 GeneID:60525 MGI:1890410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase short-chain family member 2 transcript_id : NM_019811.3

name	Commd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789333 CCDS:CCDS16912.1 GeneID:99311 MGI:1914197
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : COMM domain containing 7 protein_id : NP_598611.1

name	7530422B04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250070 GeneID:228792 MGI:2685409
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480654.1

name	Dnmt3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556229 CCDS:CCDS16914.1 GeneID:13436 MGI:1261819
definition	GO_component : GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence ISS] [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IGI]; GO:0006349 - imprinting [Evidence IMP]; GO:0031503 - protein complex localization [Evidence IDA] codon_start : 1 exception : mismatches in translation function : methylates cytosine in DNA note : isoform 1 is encoded by transcript variant 1 product : DNA methyltransferase 3B isoform 1 protein_id : NP_001003961.1

name	Dnmt3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556271 CCDS:CCDS16915.1 GeneID:13436 MGI:1261819
definition	GO_component : GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence ISS] [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IGI]; GO:0006349 - imprinting [Evidence IMP]; GO:0031503 - protein complex localization [Evidence IDA] codon_start : 1 exception : mismatches in translation function : methylates cytosine in DNA note : isoform 4 is encoded by transcript variant 4 product : DNA methyltransferase 3B isoform 4 protein_id : NP_001003963.1

name	Dnmt3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556217 CCDS:CCDS16913.1 GeneID:13436 MGI:1261819
definition	GO_component : GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence ISS] [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IGI]; GO:0006349 - imprinting [Evidence IMP]; GO:0031503 - protein complex localization [Evidence IDA] codon_start : 1 exception : mismatches in translation function : methylates cytosine in DNA note : isoform 2 is encoded by transcript variant 2 product : DNA methyltransferase 3B isoform 2 protein_id : NP_001003960.1

name	Dnmt3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556223 CCDS:CCDS16916.1 GeneID:13436 MGI:1261819
definition	GO_component : GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence ISS] [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IGI]; GO:0006349 - imprinting [Evidence IMP]; GO:0031503 - protein complex localization [Evidence IDA] codon_start : 1 exception : mismatches in translation function : methylates cytosine in DNA note : isoform 3 is encoded by transcript variant 3 product : DNA methyltransferase 3B isoform 3 protein_id : NP_034198.2

name	LOC668932 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367338 GeneID:668932
definition	codon_start : 1 product : similar to DNA cytosine-5 methyltransferase 3B2 protein_id : XP_001004878.1

name	Mapre1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106301 CCDS:CCDS16917.1 GeneID:13589 MGI:891995
definition	GO_component : GO:0030981 - cortical microtubule cytoskeleton [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005874 - microtubule [Evidence IDA]; GO:0005819 - spindle [Evidence ISS] GO_function : GO:0008017 - microtubule binding [Evidence IEA]; GO:0051010 - microtubule plus-end binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0031115 - negative regulation of microtubule polymerization [Evidence ISS] codon_start : 1 note : adenomatosis polyposis coli binding protein Eb1; APC-binding protein EB1; end-binding protein 1 product : microtubule-associated protein, RP/EB family, member 1 protein_id : NP_031922.1

name	EG329541 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244438 GeneID:329541 MGI:3644206
definition	codon_start : 1 product : hypothetical protein LOC329541 protein_id : NP_808517.1

name	LOC100043869 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250213 GeneID:100043869
definition	codon_start : 1 product : similar to Translocase of outer mitochondrial membrane 20 homolog (yeast) protein_id : XP_001481177.1

name	Spag4l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32261334 GeneID:76407 MGI:1923657
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007283 - spermatogenesis [Evidence ISS] codon_start : 1 product : spermatogenesis-related gene 4 protein_id : NP_083875.1

name	Bpil1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385094 CCDS:CCDS16919.1 GeneID:66557 MGI:1913807
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : bactericidal/permeability-increasing protein-like 1 protein_id : NP_079907.1

name	Bpil3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556282 CCDS:CCDS16920.1 GeneID:228796 MGI:2684965
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : bactericidal/permeability-increasing protein-like 3 product : bactericidal/permeability-increasing protein-like 3 precursor protein_id : NP_955007.1

name	Rya3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925587 CCDS:CCDS16921.1 GeneID:378700 MGI:2675077
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005549 - odorant binding [Evidence ISS] GO_process : GO:0045087 - innate immune response [Evidence ISS] codon_start : 1 product : antimicrobial peptide RYA3 protein_id : NP_919338.2

name	LOC100043870 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250215 GeneID:100043870
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481183.1

name	Gm1006 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702217 CCDS:CCDS16922.1 GeneID:381399 MGI:2685852
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 note : Novel LBP / BPI / CETP family, N-terminal domain containing protein product : hypothetical protein LOC381399 protein_id : NP_001030047.1

name	EG545477 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249113 GeneID:545477 MGI:3647736
definition	codon_start : 1 product : hypothetical protein LOC545477 protein_id : NP_001074280.1

name	Psp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679509 CCDS:CCDS16923.1 GeneID:19194 MGI:97787
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : parotid secretory protein protein_id : NP_032979.1

name	1700058C13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037321 CCDS:CCDS16924.1 GeneID:73388 MGI:1920638
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 note : Novel LBP / BPI / CETP family, N-terminal domain containing protein product : hypothetical protein LOC73388 protein_id : NP_082804.1

name	Plunc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10242375 CCDS:CCDS16925.1 GeneID:18843 MGI:1338036
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0045087 - innate immune response [Evidence ISS] codon_start : 1 exception : mismatches in translation note : palate, lung, and nasal epithelium expressed transcript product : palate, lung, and nasal epithelium carcinoma associated protein_id : NP_035256.1

name	2310021H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735429 CCDS:CCDS16926.1 GeneID:67135 MGI:1914385
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 2310021H06 protein_id : NP_080266.1

name	U46068 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59939912 CCDS:CCDS16927.1 GeneID:228801 MGI:2137431
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; von Ebner minor salivary gland protein; long palate, lung and nasal epithelium carcinoma associated 1; von Ebner minor salivary protein product : long palate, lung and nasal epithelium carcinoma associated 1 isoform 1 protein_id : NP_001012392.1

name	U46068 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59939910 CCDS:CCDS16927.1 GeneID:228801 MGI:2137431
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; von Ebner minor salivary gland protein; long palate, lung and nasal epithelium carcinoma associated 1; von Ebner minor salivary protein product : long palate, lung and nasal epithelium carcinoma associated 1 isoform 2 protein_id : NP_700467.2

name	BC018465 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450267 CCDS:CCDS16928.1 GeneID:228802 MGI:2385160
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC228802 protein_id : NP_659139.1

name	5430413K10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982543 GeneID:71425 MGI:1918675
definition	GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71425 protein_id : NP_780376.2

name	OTTMUSG00000015915 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909314 GeneID:433492 MGI:3709343
definition	codon_start : 1 product : hypothetical protein LOC433492 protein_id : NP_001020745.1

name	Cdk5rap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385358 CCDS:CCDS16931.1 GeneID:66971 MGI:1914221
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA]; GO:0042808 - neuronal Cdc2-like kinase binding [Evidence ISS] GO_process : GO:0007420 - brain development [Evidence ISS]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0045736 - negative regulation of cyclin-dependent protein kinase activity [Evidence ISS]; GO:0045664 - regulation of neuron differentiation [Evidence ISS] codon_start : 1 product : CDK5 regulatory subunit associated protein 1 protein_id : NP_080152.1

name	Snta1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678057 GeneID:20648 MGI:101772
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007528 - neuromuscular junction development [Evidence IMP] codon_start : 1 note : alpha1-syntrophin; syntrophin acidic 1 product : syntrophin, acidic 1 protein_id : NP_033254.1

name	Cbfa2t2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41152520 CCDS:CCDS16932.1 GeneID:12396 MGI:1333833
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030855 - epithelial cell differentiation [Evidence IMP]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : CBFA2T2 identified gene homolog; core-binding factor runt domain alpha subunit 2 translocated to 2 homolog product : core-binding factor, runt domain, alpha subunit 2, translocated to, 2 homolog protein_id : NP_766448.1

name	Apba2bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946982 GeneID:56846 MGI:1861721
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IEA]; GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005789 - endoplasmic reticulum membrane [Evidence ISS]; GO:0000137 - Golgi cis cisterna [Evidence IDA] [Evidence ISS] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0017000 - antibiotic biosynthesis [Evidence IEA]; GO:0019538 - protein metabolism [Evidence TAS] [Evidence ISS]; GO:0009306 - protein secretion [Evidence ISS] codon_start : 1 product : amyloid beta (A4) precursor protein-binding, family A, member 1 binding protein protein_id : NP_067521.1

name	1700003F12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626064 CCDS:CCDS16933.1 GeneID:75480 MGI:1922730
definition	codon_start : 1 product : hypothetical protein LOC75480 protein_id : NP_083581.1

name	E2f1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681243 CCDS:CCDS16935.1 GeneID:13555 MGI:101941
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : E2F transcription factor 1 protein_id : NP_031917.1

name	Pxmp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946966 CCDS:CCDS16936.1 GeneID:59038 MGI:1891701
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : 24 kDa intrinsic membrane protein product : peroxisomal membrane protein 4 protein_id : NP_067509.1

name	Zfp341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76559897 CCDS:CCDS16937.1 GeneID:228807 MGI:2682937
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 341 protein_id : NP_955008.2

name	Chmp4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077049 CCDS:CCDS16938.1 GeneID:75608 MGI:1922858
definition	GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : chromatin modifying protein 4B protein_id : NP_083638.1

name	LOC668936 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250073 GeneID:668936
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004898.2

name	Raly (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963505 CCDS:CCDS16939.1 GeneID:19383 MGI:97850
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hnRNP-associated with lethal yellow protein_id : NP_075619.1

name	Eif2s2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149756 GeneID:67204 MGI:1914454
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045946 - positive regulation of translation [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : eukaryotic translation initiation factor 2, subunit 2 (beta, 38kDa); eukaryotic translation initiation factor 2 subunit 2 (beta) product : eukaryotic translation initiation factor 2, subunit 2 (beta) protein_id : NP_080306.1

name	a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031990 CCDS:CCDS16941.1 GeneID:50518 MGI:87853
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0009755 - hormone-mediated signaling [Evidence IEA] codon_start : 1 note : agouti signal protein; non-agouti product : nonagouti protein_id : NP_056585.2

name	Ahcy (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098092 CCDS:CCDS16942.1 GeneID:269378 MGI:87968
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0004013 - adenosylhomocysteinase activity [Evidence IDA]; GO:0005507 - copper ion binding [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043621 - protein self-association [Evidence IPI] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA]; GO:0019510 - S-adenosylhomocysteine catabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : S-adenosylhomocysteine hydrolase protein_id : NP_057870.2

name	LOC100043877 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250218 GeneID:100043877
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481198.1

name	Itch (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487317 GeneID:16396 MGI:1202301
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence ISS] codon_start : 1 note : E3 ubiquitin protein ligase; itchy product : itchy, E3 ubiquitin protein ligase protein_id : NP_032421.2

name	Dynlrb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735425 GeneID:67068 MGI:1914318
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0030286 - dynein complex [Evidence IEA] [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003774 - motor activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence ISS]; GO:0008090 - retrograde axon cargo transport [Evidence ISS]; GO:0007632 - visual behavior [Evidence ISS] codon_start : 1 exception : mismatches in translation note : dynein, cytoplasmic, light polypeptide 2A product : dynein, cytoplasmic, light chain 2A protein_id : NP_080223.1

name	Map1lc3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956148 CCDS:CCDS16945.1 GeneID:66734 MGI:1915661
definition	GO_component : GO:0005776 - autophagic vacuole [Evidence IDA] [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0031090 - organelle membrane [Evidence ISS]; GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000045 - autophagic vacuole formation [Evidence ISS]; GO:0006914 - autophagy [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : microtubule-associated protein 1 light chain 3 alpha protein_id : NP_080011.1

name	Cdc91l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52630436 CCDS:CCDS16946.1 GeneID:228812 MGI:3039607
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IEA]; GO:0042765 - GPI-anchor transamidase complex [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence ISS]; GO:0003923 - GPI-anchor transamidase activity [Evidence ISS] GO_process : GO:0016255 - attachment of GPI anchor to protein [Evidence ISS]; GO:0051301 - cell division [Evidence IEA]; GO:0006506 - GPI anchor biosynthesis [Evidence IEA] codon_start : 1 note : GPI transamidase component; phosphatidylinositol-glycan biosynthesis, class U protein product : cell division cycle 91-like 1 protein_id : NP_001004721.1

name	Trp53inp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017443 CCDS:CCDS16947.1 GeneID:68728 MGI:1915978
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : tumor protein p53 inducible nuclear protein 2 protein_id : NP_835212.1

name	Ncoa6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790177 GeneID:56406 MGI:1929915
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0030331 - estrogen receptor binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0046965 - retinoid X receptor binding [Evidence ISS]; GO:0046966 - thyroid hormone receptor binding [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0030099 - myeloid cell differentiation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006367 - transcription initiation from RNA polymerase II promoter [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy note : PPAR interacting protein PRIP; peroxisome proliferator-activated receptor interacting protein,PRIP; thyroid hormone receptor binding protein; nuclear receptor-activating protein 250 product : nuclear receptor coactivator 6 protein_id : NP_062799.1

name	Ggtl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450127 CCDS:CCDS16949.1 GeneID:207182 MGI:1913385
definition	codon_start : 1 exception : mismatches in translation note : mFLJ00311 protein product : gamma-glutamyltransferase-like 3 protein_id : NP_659035.1

name	Acss2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980996 CCDS:CCDS16950.1 GeneID:60525 MGI:1890410
definition	EC_number : 6.2.1.1 GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003987 - acetate-CoA ligase activity [Evidence IDA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016208 - AMP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006085 - acetyl-CoA biosynthesis [Evidence IDA]; GO:0006750 - glutathione biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : acetyl-CoA synthetase; acetyl-CoA synthetase 1; acetyl-Coenzyme A synthetase 2 (AMP forming); acetyl-Coenzyme A synthetase 1 (AMP forming) product : acetyl-Coenzyme A synthetase 2 (ADP forming) protein_id : NP_062785.2

name	LOC100043652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043652
definition	number : 1 pseudo : _no_value

name	LOC668938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668938
definition	number : 2 pseudo : _no_value

name	LOC668938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668938
definition	number : 1 pseudo : _no_value

name	LOC435692 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250216 GeneID:435692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_035020.1

clone name	MSMg01-538K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316J12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-119O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146N09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-303P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526C06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-126O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-094F02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-463I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-174A11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-409O08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-070L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-115C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-456D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106E16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-340C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243O18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-450N18.T7 (MSMg01no450_n18.b1)	MSMg01-450N18.TJ (MSMg01no450_n18.g1)
ACC	AG538485	AG538486
length	780	823
length of high quality (start - end)	245 (71 - 315)	81 (72 - 152)
definition	CHROMAT_FILE: MSMg01no450_n18.b1 PHD_FILE: MSMg01no450_n18.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:20:55 2005	CHROMAT_FILE: MSMg01no450_n18.g1 PHD_FILE: MSMg01no450_n18.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:20:55 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	CATXXXXXXXXXXXXXXXXXXXXXXXCTATTTCAATAAATCCGCGGAATT CNATATATTCCAGATAAAGCTTAATGCACGTTCCCTGCAGTTCCAGCTCC TCTAGAGGCAGCTTTATCAACTTAGTCTCAAAATAAAAACAACAAAAGGC TGGGATCACACTTGCCAAATACACCCAAGGCTCTAAATGTAATCATCTGT ACTGTGACCAGGGAGGGTGGCAGGATGTAACTGGTACTGTCACATTGTTT CTGCCCTTACATCCTTTTTTCATCTTTATGACCTACCTGCCTTCTCCTAC GTGTACCAGGCACTTATTAACTCTAAATTCTGTCTTAATCTCCTAAGTGG TATAATTATCATATCTGGTCTAATTTTTCGTATTTGTTTTTATTCTATCA AAGCATCCTGGGCCCTGGGTAAGGTATTGGGAGTCTACCTTATCTGCCTG CCCAGTTTGTAATTTAGAACCAACATTTACCTAATGAGATTACTGTGAGG ACCAGAAGAAGCATGCATGCACAGCCAGGTGTCCATCCACCTGCACACAG TGAGCCTACTACATCTCTATAGCTGGGTATCTTCATCTGTATGTACTGAA TCTGCTCCTAGACTGCTAGTCTTTATCATCCCATGGGACACCCTTCACTT TTTGTTATTTACAAAAACGTGCGTGCGGGCTGCAACAACTTTATGAAACT AAAATAATACCCCATCCATCTATTCCCTACCTTCACAAATACAAAAAATT TTTCTTTATATCGTTTAAAACCTCCCCCCC	CGATGCTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXCTGATTTGACTTAAATAGTTTTAGAAAGT TTGGGTAGTTGATAGAAGGTTTAAAGAGATGGTTTAAGTTGTTTTGCCAG AAAGATACCACCAAGTTAGAGTCACGAACAGAACGTGCCCGCCCGTCACT GTAGAATACAGAGGGCTGCGCAGGGTAGAAAAGGAGCCAAGTGAGCTTTC CTGGGTTACTAGCACGGAACTGTACACTGAACAGGAACATAGGCTTGGCA CAAAAAATGACCACACTTTTTTCTTTCTAGGTAGCCTCTGAGCTCCTGCA CCTTGTTATCTATCCATGTGCCCACCGGTCTTGCTGCCTCCCTTGCAGCG ACATCTTCCCCCCCCCCTCGCTGCATCCTCCTATTCCTCTATTCTTCTTT CCTCCTTCTGCTCTCTACCCCCTCCTCCCCCTTTCCCTTACTGCTCCCCC CCACTCCCTCTGTCTTCTTTTCCCCCCCCCTCTTCCTCCCCTTCTTCCCA TTATCTTCTCTCGCTTCCTATTTTCTCCTTCCCCTCTCCCTCCTCCTTCC CTCTTCTCCCTTCCCCTCTTTCTTTACCCCTCCCTCCTTCGTTTCCTCTC CTCCCCTCTCTCTCTTCTCTCCCTCCCTCTTCCTTTTTCTCCCCCCTCCT CCTTTCTCCCTCTCCCTCCTCCCCCCCCTTTCTATCACTCCTCTTCTGCT ATTCCGCTCTTCCCCCTTCCCGTCCCCTCTCCCTCCTCCCTTCTTTGTTC CCCCTCTTCTCCTTCCCCCTCCN
quality values	Open. Hide. 8 8 8 8 10 9 14 21 23 30 25 25 20 19 24 19 21 10 10 10 23 31 25 21 9 9 9 9 9 6 8 8 8 8 8 11 8 10 8 8 10 10 15 27 27 28 24 17 21 10 3 0 3 21 17 10 8 7 8 8 9 10 10 10 11 9 12 12 12 13 22 22 33 33 33 33 33 53 53 53 59 59 59 59 59 57 57 57 57 57 57 48 47 42 42 42 51 68 68 68 68 68 68 68 68 68 68 57 44 37 32 32 32 34 30 25 23 23 23 23 36 34 44 54 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 42 30 30 36 50 57 57 57 57 57 54 54 57 57 57 68 68 68 68 68 68 68 68 68 57 68 68 68 68 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 59 54 57 57 57 57 57 52 52 57 57 68 68 68 59 59 59 59 59 57 50 50 50 50 50 68 59 59 57 57 46 57 57 68 68 68 68 68 68 68 68 48 48 42 44 44 59 47 44 44 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 48 48 59 59 59 59 57 57 57 57 57 57 59 53 50 50 50 50 50 59 30 23 10 8 8 6 6 6 6 6 6 6 9 19 19 32 32 59 59 59 48 48 48 48 48 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 54 59 59 59 59 68 59 59 43 43 43 39 39 36 30 27 41 32 54 59 59 59 59 68 68 59 59 59 59 59 59 59 59 59 54 54 54 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 44 44 28 28 28 28 44 44 57 57 57 44 39 39 43 23 27 11 11 12 25 25 59 59 59 59 59 68 68 68 68 57 57 57 57 57 48 48 48 48 48 57 59 59 59 57 46 43 57 43 48 48 48 48 48 41 39 37 30 26 26 27 26 31 38 39 39 41 42 42 42 48 48 48 59 59 59 59 59 39 39 33 34 33 39 39 39 39 39 39 36 23 23 16 18 18 13 18 14 14 14 15 20 25 30 35 39 40 40 40 37 34 28 28 25 32 28 25 25 34 25 31 39 43 29 24 19 24 24 32 32 32 25 22 33 22 22 28 28 26 15 10 8 8 8 15 17 11 10 15 10 10 11 22 19 23 20 20 23 19 16 10 10 10 10 15 15 10 14 9 9 8 17 18 28 21 19 11 11 11 15 10 10 10 17 10 9 9 14 14 18 34 23 23 14 14 8 10 8 10 9 11 8 8 8 8 8 9 10 10 9 7 8 10 8 8 8 8 8 8 8 9 12 10 14 12 8 9 8 8 8 9 10 9 11 10 12 14 11 13 9 16 8 8 8 8 8 6 6 6 6 8 8 10 10 10 20 8 7 6 6 6 6 8 8 8 8 8 6 6 6 8 8 8 8 8 8 10 13 8 8 9 10 7 6 6 6 8 6 10 10 9 9 9 9 10 10 10 8 9 9 11 16 13 11 11 11 8 8 7 7 8 8 6 7 7 8 6 8 8 10 8 9 8 8 8 6 6 6 8 8 8 8 8 8 8 10 22 25 22 22 24 21 17 11 11 10 10 13 10 10 10 10 10 10 10 12 12 12 12 12 15 15 11 11 11 11 11 11 11 11 11 10	Open. Hide. 6 6 6 11 13 10 8 8 8 9 10 9 10 13 10 9 22 28 23 22 25 15 19 15 13 17 19 12 15 10 8 6 6 6 6 6 10 14 14 12 12 15 16 20 25 22 15 16 24 25 22 39 39 23 17 12 9 9 8 8 9 8 11 11 23 15 12 12 14 14 19 41 41 44 44 44 59 59 59 47 39 39 39 32 29 31 37 32 32 27 27 30 32 33 33 33 33 37 37 31 28 32 39 39 39 37 39 39 37 37 44 37 37 37 37 41 37 43 40 40 43 43 59 59 59 59 43 36 36 34 36 36 48 48 48 48 59 48 39 39 37 37 39 39 39 25 24 12 12 12 12 12 16 13 15 11 9 9 9 9 17 14 23 23 28 34 39 43 37 37 28 28 28 25 36 36 39 39 36 39 33 36 29 29 28 28 30 40 40 46 46 46 43 39 32 31 20 20 20 41 30 25 12 12 12 25 24 28 14 14 14 28 28 24 19 17 30 30 28 28 28 24 19 18 13 17 10 12 12 18 18 24 29 25 20 15 18 14 17 19 25 18 23 25 34 40 27 27 30 30 20 23 11 11 15 15 28 28 14 14 14 21 15 23 19 21 11 13 13 11 23 16 12 12 10 8 8 8 8 10 10 9 9 9 11 12 12 12 15 15 13 13 18 18 22 22 13 13 12 20 12 11 11 11 11 11 12 11 11 12 18 10 6 8 6 6 6 6 12 14 25 11 11 11 23 23 34 28 23 18 24 12 12 12 15 13 21 21 27 16 11 11 16 25 30 26 17 11 12 11 11 12 19 16 13 10 10 10 11 18 12 10 10 10 12 12 12 12 11 10 11 17 12 8 8 10 11 11 10 12 12 12 14 15 14 12 8 10 10 12 13 8 11 11 11 8 8 8 8 8 8 12 10 10 13 16 16 12 12 12 18 22 27 13 11 17 10 12 10 10 10 10 13 10 10 9 13 14 20 16 10 10 10 12 12 12 12 10 10 10 9 10 12 23 24 18 21 21 21 12 12 10 8 8 8 10 9 10 10 10 10 10 10 10 9 8 8 8 10 10 9 12 12 12 12 10 10 8 8 8 8 10 8 8 9 10 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 11 20 15 14 8 8 8 8 10 15 10 8 7 8 8 10 10 12 11 11 11 12 22 19 13 6 6 8 6 10 10 10 13 17 21 15 10 9 9 10 10 10 12 10 10 10 8 8 6 6 11 12 18 18 18 10 8 8 6 6 8 10 8 8 6 6 8 8 8 8 8 8 8 10 15 20 24 37 37 22 20 11 11 11 19 15 10 12 9 9 9 10 8 9 10 8 8 8 8 8 10 8 8 8 10 8 6 8 8 10 8 8 8 14 14 30 20 17 12 13 11 10 10 8 8 8 8 8 8 8 8 8 8 8 10 8 9 8 11 8 8 7 6 8 8 8 12 13 10 8 9 9 18 20 19 19 10 11 9 8 8 6 7 10 10 10 6 6 6 6 8 19 19 13 8 8 8 10 10 11 10 8 9 8 8 8 8 15 17 13 17 11 8 8 8 8 8 8 8 8 8 8 8 8 8 11 12 10 10 15 15 10 10 11 13 17 21 22 18 20 16 10 9 9 8 8 8 8 8 8 8 8 8 8 8 10 10 12 9 9 9 9 8 8 8 8 8 8 9 13 8 6 6 8 8 8 8 17 17 18 10 10 10 8 8 8 7 7 7 7 13 13 8 8 6 6 8 15 17 17 12 12 14 17 17 26 28 13 13 9 10 10 9 9 11 10 12 13 13 13 8 10 9 11 15 9 9 12 15 16 13 12 16 19 20 15 13 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no450_n18.b1 MSMg01no450_n18.b1 CHROMAT_FILE:
MSMg01no450_n18.b1 PHD_FILE: MSMg01no450_n18.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:20:55 2005
         (245 letters)



>mm_chr2_154357516_154358160
          Length = 645

 Score =  462 bits (239), Expect = e-135
 Identities = 242/243 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   ttaatgcacgttccctgcagttccagctcctctagaggcagctttatcaacttagtctca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 443 ttaatgcacgttccctgcagttccagctcctctagaggcagctttatcaacttagtctca 384

                                                                       
Query: 61  aaataaaaacaacaaaaggctgggatcacacttgccaaatacacccaaggctctaaatgt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 383 aaataaaaacaacaaaaggctgggatcacacttgccaaatacacccaaggccctaaatgt 324

                                                                       
Query: 121 aatcatctgtactgtgaccagggagggtggcaggatgtaactggtactgtcacattgttt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 323 aatcatctgtactgtgaccagggagggtggcaggatgtaactggtactgtcacattgttt 264

                                                                       
Query: 181 ctgcccttacatccttttttcatctttatgacctacctgccttctcctacgtgtaccagg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 263 ctgcccttacatccttttttcatctttatgacctacctgccttctcctacgtgtaccagg 204

              
Query: 241 cac 243
           |||
Sbjct: 203 cac 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 11
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 245
Length of database: 645
Length adjustment: 9
Effective length of query: 236
Effective length of database: 636
Effective search space:   150096
Effective search space used:   150096
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information