MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-024E07
Chromosome	X (Build37)
Map Location	6,752,396 - 6,752,960
singlet/doublet	singlet
Overlap gene	Clcn5
Upstream gene	Bmp15, Shroom4, LOC100043937, Dgkk, Ccnb3, Akap4
Downstream gene	Usp27x, 2010204K13Rik, LOC668973, Ppp1r3f, 4930524L23Rik, Foxp3, Ccdc22, Cacna1f, Syp, LOC632264, Lmo6, Plp2, Pdzx, Ppia-psx_14.1, Gpkow, LOC100043938, Wdr45, Praf2, Ccdc120, EG236622, Tcfe3, Gripap1, LOC100043939, Kcnd1, Otud5, Pim2, Slc35a2, Pqbp1, Timm17b, Pcsk1n, Eras, Hdac6, LOC668974, Gata1, Glod5, LOC668975, EG627737, EG632013, Suv39h1, Was, EG627782, Wdr13, Rbm3, Tbc1d25
Link	Open Mouse BAC browser

Click to get alignment info.

name	Bmp15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12155 MGI:1316745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shroom4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208431 MGI:2685570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043937 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Dgkk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331374 MGI:3580254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccnb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209091 MGI:2183443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11643 MGI:102794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Clcn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12728 MGI:99486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp27x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54651 MGI:1859645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010204K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68355 MGI:1922859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC668973 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Ppp1r3f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54646 MGI:1859617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930524L23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78185 MGI:1925435
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Foxp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20371 MGI:1891436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54638 MGI:1859608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacna1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54652 MGI:1859639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20977 MGI:98467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC632264 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	Lmo6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54630 MGI:1859635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18824 MGI:1298382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdzx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54634 MGI:1859644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppia-psx_14.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606726
definition	note : peptidylprolyl isomerase A pseudogene x_14.1 pseudo : _no_value

name	Gpkow (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209416 MGI:1859610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043938 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Wdr45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54636 MGI:1859606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Praf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54637 MGI:1859607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc120 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54648 MGI:1859619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG236622 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236622 MGI:3643748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 6 Proteins

name	Tcfe3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209446 MGI:98511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gripap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54645 MGI:1859616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Kcnd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16506 MGI:96671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otud5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54644 MGI:1859615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18715 MGI:97587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc35a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22232 MGI:1345297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pqbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54633 MGI:1859638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm17b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21855 MGI:1343176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcsk1n (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30052 MGI:1353431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eras (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353283 MGI:2665023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15185 MGI:1333752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668974 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668974
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Gata1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14460 MGI:95661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glod5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69824 MGI:1917074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668975 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	EG627737 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627737 MGI:3644276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 94 ESTs, 7 Proteins

name	EG632013 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632013 MGI:3643105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 254 ESTs, 4 Proteins

name	Suv39h1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20937 MGI:1099440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Was (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22376 MGI:105059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627782 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627782 MGI:3646481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Wdr13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73447 MGI:1914661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19652 MGI:1099460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209815 MGI:2444862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmp15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328446 GeneID:12155 MGI:1316745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone morphogenetic protein 15 transcript_id : NM_009757.3

name	Shroom4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94818778 GeneID:208431 MGI:2685570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : shroom family member 4 transcript_id : NM_001040459.1

name	LOC100043937 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270927 GeneID:100043937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to gamma-aminobutyric acid A receptor, epsilon transcript_id : XM_001481246.1

name	Dgkk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50054140 GeneID:331374 MGI:3580254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol kinase kappa transcript_id : NM_177914.2

name	Ccnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371324 GeneID:209091 MGI:2183443
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin B3 transcript_id : NM_183015.2

name	Akap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347480 GeneID:11643 MGI:102794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 4 transcript_id : NM_009651.3

name	Akap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347482 GeneID:11643 MGI:102794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 4 transcript_id : NM_001042542.1

name	Clcn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980677 GeneID:12728 MGI:99486
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel 5 transcript_id : NM_016691.2

name	Usp27x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388539 GeneID:54651 MGI:1859645
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 27, X chromosome transcript_id : NM_019461.2

name	Ppp1r3f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248586 GeneID:54646 MGI:1859617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 3F transcript_id : NM_138605.2

name	4930524L23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270944 GeneID:78185 MGI:1925435
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 4930524L23 gene transcript_id : XM_001475132.1

name	Foxp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905074 GeneID:20371 MGI:1891436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box P3 transcript_id : NM_054039.1

name	Ccdc22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922577 GeneID:54638 MGI:1859608
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 22 transcript_id : NM_138603.3

name	Cacna1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115648150 GeneID:54652 MGI:1859639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, alpha 1F subunit transcript_id : NM_019582.2

name	Syp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678194 GeneID:20977 MGI:98467
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptophysin transcript_id : NM_009305.1

name	LOC632264 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270946 GeneID:632264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : hypothetical LOC632264 transcript_id : XM_001475288.1

name	Lmo6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802108 GeneID:54630 MGI:1859635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domain only 6 transcript_id : NM_175097.3

name	Plp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348936 GeneID:18824 MGI:1298382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteolipid protein 2 transcript_id : NM_019755.3

name	Pdzx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053861 GeneID:54634 MGI:1859644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ domain containing, X chromosome transcript_id : NM_018832.2

name	Gpkow (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125991227 GeneID:209416 MGI:1859610
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G patch domain and KOW motifs transcript_id : NM_173747.3

name	LOC100043938 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271022 GeneID:100043938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043938 transcript_id : XM_001481247.1

name	Wdr45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27363471 GeneID:54636 MGI:1859606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 45 transcript_id : NM_172372.1

name	Praf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802596 GeneID:54637 MGI:1859607
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRA1 domain family 2 transcript_id : NM_138602.2

name	Ccdc120 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61742830 GeneID:54648 MGI:1859619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 120 transcript_id : NM_207202.2

name	EG236622 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406982 GeneID:236622 MGI:3643748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 5 Proteins product : predicted gene, EG236622, transcript variant 3 transcript_id : XM_906012.2

name	Tcfe3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27819656 GeneID:209446 MGI:98511
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor E3 transcript_id : NM_172472.1

name	Gripap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46592838 GeneID:54645 MGI:1859616
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GRIP1 associated protein 1 transcript_id : NM_207670.1

name	LOC100043939 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271024 GeneID:100043939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100043939 transcript_id : XM_001481248.1

name	Kcnd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680525 GeneID:16506 MGI:96671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, Shal-related family, member 1 transcript_id : NM_008423.1

name	Otud5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560767 GeneID:54644 MGI:1859615
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : OTU domain containing 5 transcript_id : NM_138604.2

name	Pim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133908617 GeneID:18715 MGI:97587
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proviral integration site 2 transcript_id : NM_138606.2

name	Slc35a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17530970 GeneID:22232 MGI:1345297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35 (UDP-galactose transporter), member A2 transcript_id : NM_078484.1

name	Pqbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130717 GeneID:54633 MGI:1859638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polyglutamine binding protein 1 transcript_id : NM_019478.3

name	Timm17b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357331 GeneID:21855 MGI:1343176
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 17b transcript_id : NM_011591.3

name	Pcsk1n (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475958 GeneID:30052 MGI:1353431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proprotein convertase subtilisin/kexin type 1 inhibitor transcript_id : NM_013892.2

name	Eras (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31581542 GeneID:353283 MGI:2665023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ES cell-expressed Ras transcript_id : NM_181548.2

name	Hdac6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6996925 GeneID:15185 MGI:1333752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 6 transcript_id : NM_010413.2

name	Gata1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679946 GeneID:14460 MGI:95661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GATA binding protein 1 transcript_id : NM_008089.1

name	Glod5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360348 GeneID:69824 MGI:1917074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glyoxalase domain containing 5 transcript_id : NM_027227.2

name	EG627737 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406983 GeneID:627737 MGI:3644276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 94 ESTs, 7 Proteins product : predicted gene, EG627737 transcript_id : XM_892438.2

name	EG632013 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270949 GeneID:632013 MGI:3643105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 254 ESTs, 4 Proteins product : predicted gene, EG632013 transcript_id : XM_001476014.1

name	Suv39h1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755701 GeneID:20937 MGI:1099440
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of variegation 3-9 homolog 1 (Drosophila) transcript_id : NM_011514.1

name	Was (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678580 GeneID:22376 MGI:105059
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wiskott-Aldrich syndrome homolog (human) transcript_id : NM_009515.1

name	Wdr13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370534 GeneID:73447 MGI:1914661
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 13 transcript_id : NM_026137.3

name	Rbm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367595 GeneID:19652 MGI:1099460
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 3 transcript_id : NM_016809.3

name	Tbc1d25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359040 GeneID:209815 MGI:2444862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 25 transcript_id : NM_172478.2

name	Bmp15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106259 CCDS:CCDS29958.1 GeneID:12155 MGI:1316745
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : bone morphogenetic protein 15 protein_id : NP_033887.1

name	Shroom4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94818779 CCDS:CCDS29959.1 GeneID:208431 MGI:2685570
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : shroom family member 4 protein_id : NP_001035549.1

name	LOC100043937 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270928 GeneID:100043937
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481296.1

name	Dgkk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50054141 GeneID:331374 MGI:3580254
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0004143 - diacylglycerol kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0046339 - diacylglycerol metabolism [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0007205 - protein kinase C activation [Evidence IEA]; GO:0006979 - response to oxidative stress [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy product : diacylglycerol kinase kappa protein_id : NP_808582.2

name	Ccnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942087 CCDS:CCDS29961.1 GeneID:209091 MGI:2183443
definition	GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007126 - meiosis [Evidence IEA] codon_start : 1 exception : mismatches in translation function : G2 mitotic cyclin product : cyclin B3 protein_id : NP_898836.1 transl_except : (pos:complement(6608009..6608011),aa:Met)

name	Akap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347481 GeneID:11643 MGI:102794
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0051018 - protein kinase A binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008104 - protein localization [Evidence IMP]; GO:0030317 - sperm motility [Evidence IMP]; GO:0007178 - transmembrane receptor protein serine/threonine kinase signaling pathway [Evidence IPI] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : A-kinase anchor protein 4 isoform a protein_id : NP_033781.2

name	Akap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347483 GeneID:11643 MGI:102794
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0051018 - protein kinase A binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008104 - protein localization [Evidence IMP]; GO:0030317 - sperm motility [Evidence IMP]; GO:0007178 - transmembrane receptor protein serine/threonine kinase signaling pathway [Evidence IPI] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : A-kinase anchor protein 4 isoform b protein_id : NP_001036007.1

name	Clcn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980678 CCDS:CCDS29963.1 GeneID:12728 MGI:99486
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006897 - endocytosis [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : chloride channel 5 protein_id : NP_057900.2

name	Usp27x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789092 GeneID:54651 MGI:1859645
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ubiquitin specific protease 27, X chromosome protein_id : NP_062334.1

name	Ppp1r3f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248587 CCDS:CCDS29964.1 GeneID:54646 MGI:1859617
definition	codon_start : 1 product : protein phosphatase 1, regulatory (inhibitor) subunit 3F protein_id : NP_613071.2

name	4930524L23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270945 GeneID:78185 MGI:1925435
definition	codon_start : 1 product : hypothetical protein LOC78185 protein_id : XP_001475182.1

name	Foxp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905075 CCDS:CCDS29965.1 GeneID:20371 MGI:1891436
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001816 - cytokine production [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : scurfy product : forkhead box P3 protein_id : NP_473380.1

name	Ccdc22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922578 CCDS:CCDS29966.1 GeneID:54638 MGI:1859608
definition	codon_start : 1 product : coiled-coil domain containing 22 protein_id : NP_613069.3

name	Cacna1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115648151 GeneID:54652 MGI:1859639
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : L-type dihydropyridine-sensitive calcium channel alpha-1f subunit; calcium channel voltage-dependent alpha 1F subunit product : calcium channel, voltage-dependent, alpha 1F subunit protein_id : NP_062528.2

name	Syp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678195 CCDS:CCDS29967.1 GeneID:20977 MGI:98467
definition	GO_component : GO:0030285 - integral to synaptic vesicle membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IDA]; GO:0008021 - synaptic vesicle [Evidence ISS] [Evidence IDA]; GO:0030672 - synaptic vesicle membrane [Evidence IDA]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence TAS]; GO:0007268 - synaptic transmission [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : exocytosis note : Syp I product : synaptophysin protein_id : NP_033331.1

name	LOC632264 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270947 GeneID:632264
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475338.1

name	Lmo6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28201983 GeneID:54630 MGI:1859635
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : LIM only 6 product : LIM domain only 6 protein_id : NP_780306.1

name	Plp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790169 GeneID:18824 MGI:1298382
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0019956 - chemokine binding [Evidence ISS] GO_process : GO:0006935 - chemotaxis [Evidence ISS]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence ISS] codon_start : 1 product : proteolipid protein 2 protein_id : NP_062729.1

name	Pdzx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053862 CCDS:CCDS29968.1 GeneID:54634 MGI:1859644
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : PDZ domain containing X chromosome product : PDZ domain containing, X chromosome protein_id : NP_061302.2

name	Gpkow (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125991228 CCDS:CCDS29969.1 GeneID:209416 MGI:1859610
definition	codon_start : 1 product : G patch domain and KOW motifs protein_id : NP_776108.2

name	LOC100043938 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271023 GeneID:100043938
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481297.1

name	Wdr45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27363472 CCDS:CCDS29970.1 GeneID:54636 MGI:1859606
definition	codon_start : 1 note : WD repeat domain, X-linked 1 product : WD repeat domain 45 protein_id : NP_758960.1

name	Praf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070422 CCDS:CCDS29971.1 GeneID:54637 MGI:1859607
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : PRA1 domain family 2 protein_id : NP_613068.1

name	Ccdc120 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61742831 CCDS:CCDS29972.1 GeneID:54648 MGI:1859619
definition	codon_start : 1 product : coiled-coil domain containing 120 protein_id : NP_997085.2

name	EG236622 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999712 GeneID:236622 MGI:3643748
definition	codon_start : 1 product : similar to SMT3B protein isoform 3 protein_id : XP_911105.1

name	Tcfe3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27819657 GeneID:209446 MGI:98511
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045670 - regulation of osteoclast differentiation [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcription factor E3 protein_id : NP_766060.1

name	Gripap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46592839 GeneID:54645 MGI:1859616
definition	codon_start : 1 product : GRIP1 associated protein 1 protein_id : NP_997553.1

name	LOC100043939 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271025 GeneID:100043939
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481298.1

name	Kcnd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680526 CCDS:CCDS29974.1 GeneID:16506 MGI:96671
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium voltage gated channel, Shal-related family, member 1; potassium voltage-gated channel Shal-related family member 1 product : potassium voltage-gated channel, Shal-related family, member 1 protein_id : NP_032449.1

name	Otud5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560768 CCDS:CCDS29975.1 GeneID:54644 MGI:1859615
definition	codon_start : 1 product : OTU domain containing 5 protein_id : NP_613070.2

name	Pim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070430 CCDS:CCDS29976.1 GeneID:18715 MGI:97587
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0008637 - apoptotic mitochondrial changes [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : alternative start codon note : non-AUG (CUG) translation initiation codon product : serine-threonine protein kinase pim-2 protein_id : NP_613072.1 transl_except : (pos:7455445..7455447,aa:Met)

name	Slc35a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17530971 GeneID:22232 MGI:1345297
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005338 - nucleotide-sugar transporter activity [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005459 - UDP-galactose transporter activity [Evidence IMP] [Evidence IDA] GO_process : GO:0008643 - carbohydrate transport [Evidence IDA]; GO:0015780 - nucleotide-sugar transport [Evidence IEA]; GO:0006810 - transport [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy function : sugar transporter note : UDP-galactose translocator; solute carrier family (UDP-N-acetylglucosamine transporter), member 2 product : solute carrier family 35, member 2 protein_id : NP_511039.1

name	Pqbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980927 CCDS:CCDS29977.1 GeneID:54633 MGI:1859638
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : scurfy candidate 2; polyglutamine tract binding protein-1 product : polyglutamine binding protein 1 protein_id : NP_062351.2

name	Timm17b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468937 CCDS:CCDS29978.1 GeneID:21855 MGI:1343176
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005744 - mitochondrial inner membrane presequence translocase complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0015450 - protein translocase activity [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : translocator of inner mitochondrial membrane 17 kDa, b; translocator of inner mitochondrial membrane b product : translocator of inner mitochondrial membrane 17b protein_id : NP_035721.1

name	Pcsk1n (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305455 CCDS:CCDS29979.1 GeneID:30052 MGI:1353431
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA]; GO:0005802 - Golgi trans face [Evidence IDA]; GO:0030141 - secretory granule [Evidence IDA] GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IDA] GO_process : GO:0016486 - peptide hormone processing [Evidence IDA] codon_start : 1 exception : mismatches in translation function : inhibits prohormone processing note : protein serine alanine alanine serine; pancreas protein 3; basic protein IA-4; granin-like neuroendocrine peptide product : proprotein convertase subtilisin/kexin type 1 inhibitor protein_id : NP_038920.1

name	Eras (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559801 CCDS:CCDS29980.1 GeneID:353283 MGI:2665023
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : small GTPase E-Ras product : ES cell-expressed Ras protein_id : NP_853526.1

name	Hdac6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6996926 GeneID:15185 MGI:1333752
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0004407 - histone deacetylase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0007026 - negative regulation of microtubule depolymerization [Evidence IDA]; GO:0006476 - protein amino acid deacetylation [Evidence IDA]; GO:0000209 - protein polyubiquitination [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence TAS] codon_start : 1 exception : mismatches in translation note : histone deacetylase 5; scurfy candidate 6 product : histone deacetylase 6 protein_id : NP_034543.2

name	Gata1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679947 CCDS:CCDS29981.1 GeneID:14460 MGI:95661
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : GATA-binding protein 1 product : GATA binding protein 1 protein_id : NP_032115.1

name	Glod5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312444 CCDS:CCDS29982.1 GeneID:69824 MGI:1917074
definition	GO_function : GO:0018583 - biphenyl-2,3-diol 1,2-dioxygenase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] codon_start : 1 product : glyoxalase domain containing 5 protein_id : NP_081503.1

name	EG627737 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999799 GeneID:627737 MGI:3644276
definition	codon_start : 1 product : similar to ribosomal protein L22 protein_id : XP_897531.1

name	EG632013 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270950 GeneID:632013 MGI:3643105
definition	codon_start : 1 product : similar to 40S ribosomal protein S29 protein_id : XP_001476064.1

name	Suv39h1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755702 GeneID:20937 MGI:1099440
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005677 - chromatin silencing complex [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0018024 - histone-lysine N-methyltransferase activity [Evidence IDA] [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008276 - protein methyltransferase activity [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006342 - chromatin silencing [Evidence TAS]; GO:0006323 - DNA packaging [Evidence TAS] codon_start : 1 note : Suv39h histone methyltransferase product : suppressor of variegation 3-9 homolog 1 protein_id : NP_035644.1

name	Was (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678581 CCDS:CCDS29984.1 GeneID:22376 MGI:105059
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0012506 - vesicle membrane [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence IDA] GO_process : GO:0030041 - actin filament polymerization [Evidence IDA]; GO:0030048 - actin filament-based movement [Evidence IDA]; GO:0008154 - actin polymerization and/or depolymerization [Evidence IDA]; GO:0016197 - endosome transport [Evidence IDA]; GO:0042110 - T cell activation [Evidence IMP] codon_start : 1 note : Wiskott-Aldrich syndrome protein product : Wiskott-Aldrich syndrome homolog protein_id : NP_033541.1

name	Wdr13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336024 CCDS:CCDS29986.1 GeneID:73447 MGI:1914661
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : memory-related protein product : WD repeat protein 13 protein_id : NP_080413.1

name	Rbm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37497112 CCDS:CCDS29987.1 GeneID:19652 MGI:1099460
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0043023 - ribosomal large subunit binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0035196 - miRNA-mediated gene silencing, production of miRNAs [Evidence IDA]; GO:0009409 - response to cold [Evidence IDA]; GO:0043037 - translation [Evidence IDA] codon_start : 1 product : RNA binding motif protein 3 protein_id : NP_058089.2

name	Tbc1d25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369646 CCDS:CCDS29988.1 GeneID:209815 MGI:2444862
definition	codon_start : 1 exception : mismatches in translation note : ornithine aminotransferase-like 1 product : TBC1 domain family, member 25 protein_id : NP_766066.1

name	LOC668973 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668973
definition	number : 2 pseudo : _no_value

name	LOC668973 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668973
definition	number : 1 pseudo : _no_value

name	LOC668974 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668974
definition	number : 1 pseudo : _no_value

name	2010204K13Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270943 GeneID:68355 MGI:1922859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : RIKEN cDNA 2010204K13 gene transcript_id : XR_035367.1

name	LOC668975 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270948 GeneID:668975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to chromosome 20 open reading frame 111 pseudo : _no_value transcript_id : XR_032513.1

name	EG627782 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270938 GeneID:627782 MGI:3646481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG627782 pseudo : _no_value transcript_id : XR_035160.1

clone name	MSMg01-261B21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-291P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301O12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-332P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086N02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-024E07.b	B6Ng01-024E07.g
ACC	DH855959	DH855960
length	1,173	559
definition	DH855959\|Mus musculus domesticus DNA, BAC clone: B6Ng01-024E07, 5' end.	DH855960\|Mus musculus domesticus DNA, BAC clone: B6Ng01-024E07, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcacctgacgaataccgaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctaagatcaaaaattcaggtgacagc agatgctggcgaggatgtggagaaagaggaacactcctccattgttggtg ggattgcaggcttgtacaaccactctggaaatccgtctggcggttcctca gaaaattggacatagaactaccggaggatccagcaatacctctcctgggc atatatccagaagatgccccaactggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacccagat gcccctcaacagaggaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctagccaa atggatggacctggagggcatcatcctgagtgaggtaacacattcacaaa ggaactcacacaatatgtactcactgataagtggatattagcccaaaacc taggatacccaagatataagatacaatttcctaaacacatgaaactcaag aaaaatgaagactgaagtgtggacactatgcccctccttagaagtgggaa caaaacacccttggaaggagttacagagacaaagtttggagctgagatga aaggatggaccatgtagagactgccttatccagggatccaccccataatc agcatccaaacgctgacaccattgcatacactagcaagattttatcgaaa ggacccagatgtagctgtttcttgtgagactattgccggggcttacaaac acagaagtggatgcccacagtcagctaatggatggatcacagggctctca ttggagtagctagagaaagtacccaaggagctaagggatctgcaccctat aggtggattaactttataatctaccagtacccggagctcttgatctagtt gcatgtgtatcaaagaaggcctagccggccttcatggtaaaaaaggtcct ggaacacaattttatatgctcctaaagggggacccgtgtccaaaagggga tggcggtagcgaatggttttcta	cagatagatggccatgagctatcatgtaggtactgggaatctaaccctgg tcctctgtagggacaacaaatgttcttaaccactgagctgtctttctacc tccagaaacaatggtttaaaaatggaatatatatatgtatatatatatat gcatatacatacacacatatatatgtatatatatatatattcttttttgt gtactcatgattgaactctgggccttgtatatgtagaactgatttctatc tcctgtatttgaaatattttcatcatgaaagccagagttggttgcacaca cttgagaaggaggagcaggaggagcaggagttggaagtcattcttgacta cattcttgagcagcctgagaccttatctgaaaagcaaacaacaaacaaac aaacaaacctccccaaaaggccaaaacaaaaaatccccacaaaccaaaca aacaaacattttaaaatcttaaatttatttatttatttattcattcattc attcattcattcattcagtgtgtgaggtgtgtgtgtgtatgtctgtggtg tgtgtgtgt
quality values	Open. Hide. 42 13 9 13 13 11 14 31 13 50 45 55 55 47 43 38 55 49 55 50 55 55 55 55 52 52 61 52 37 24 20 43 20 30 30 27 45 59 59 61 55 55 59 59 59 59 59 59 59 59 59 61 59 61 61 61 61 61 61 59 61 59 59 59 61 61 52 59 59 59 35 61 59 59 55 59 61 61 59 59 59 59 59 59 59 52 59 61 61 61 61 61 61 59 59 55 34 35 59 61 61 61 61 59 61 61 59 61 59 61 59 59 59 59 52 61 61 59 59 61 61 61 61 59 59 61 59 59 39 61 61 61 61 61 61 59 59 61 61 61 59 59 61 59 59 59 61 59 59 59 59 52 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 59 61 61 59 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 59 59 52 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 59 59 59 59 59 49 52 61 61 61 61 61 61 61 61 61 61 61 61 61 59 49 61 59 59 61 61 59 59 61 61 61 61 61 61 59 61 61 61 59 59 61 59 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 59 59 61 59 59 52 59 59 49 59 49 59 52 59 59 59 55 55 49 59 59 59 61 61 61 61 59 61 61 61 61 61 59 59 61 59 61 61 59 61 61 59 59 59 59 61 61 61 61 59 59 59 59 61 61 61 61 59 59 59 59 59 59 52 59 59 52 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 59 59 59 44 55 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 52 61 52 59 61 59 59 61 61 59 61 59 61 61 59 61 61 59 61 59 61 59 61 61 59 61 59 59 61 59 59 59 59 59 59 59 59 59 61 61 61 59 61 61 59 59 59 59 61 59 59 50 61 61 59 59 59 59 59 59 61 61 17 23 12 8 18 19 52 52 61 59 59 59 59 61 61 61 61 61 61 61 61 55 52 52 55 52 55 52 52 55 55 47 49 61 61 61 28 27 21 27 18 35 55 61 61 55 61 61 61 55 61 61 61 55 61 55 55 61 61 61 61 61 55 61 61 61 55 61 61 61 61 61 52 61 55 61 61 61 61 61 61 55 55 55 50 50 49 50 50 55 55 55 55 61 47 61 61 61 61 61 41 43 50 41 49 34 55 49 55 61 61 26 14 11 12 14 14 38 61 61 61 47 50 55 50 50 50 38 50 31 50 47 30 37 39 49 61 35 61 55 61 40 45 50 50 50 45 47 24 53 61 50 61 61 61 61 61 61 61 43 61 53 43 35 43 27 50 32 43 29 43 33 43 36 33 31 27 50 50 50 50 50 61 52 61 61 38 61 24 53 61 61 50 23 61 52 14 43 38 37 39 31 61 50 50 53 47 50 50 52 52 61 61 53 53 61 53 25 53 53 23 47 53 52 47 53 52 28 23 47 53 39 45 45 47 46 52 61 53 50 27 42 24 8 53 53 28 53 53 45 53 38 30 57 38 38 42 18 17 24 18 22 20 31 43 43 53 24 52 50 28 53 21 27 17 31 34 27 21 14 21 11 16 35 30 35 21 24 16 30 39 39 45 37 53 36 36 35 45 50 20 33 43 47 30 33 32 17 16 15 24 35 30 40 24 37 18 47 47 47 43 32 26 18 33 33 32 15 21 28 31 35 10 30 28 18 10 17 10 16 27 29 45 31 21 34 35 12 19 30 23 15 8 10 8 12 18 35 42 34 13 30 24 30 34 53 37 57 57 40 23 32 33 8 17 47 33 47 38 28 18 50 34 20 7 37 15 20 21 20 9 17 31 20 16 28 29 38 31 42 32 11 14 38 18 32 10 33 19 28 17 22 24 38 17 32 29 11 8 9 12 5 7 19 37 29 14 12 12 12 8 19 16 8 29 26 26 22 16 32 24 44 22 20 16 10 27 21 28 16 13 21 16 17 11 10 18 37 25 8 15 37 11 10 12 16 18 20 21 37 24 21 29 23 9 25 20 34 48 28 21 11 12 6 14 10 11 19 20 28 31 9 28 39 18 19 22 18 27 16 22 21 8 30 21 28 10 22 28 15 12 11 19 18 13 7 19 32 29 11 34 15 16 14 16 13 24 14 7 23 14 10 19 23 23 12 12 10 14 10 24 23 14 10 7 10 7 5 10 12 10 10 7 10 21 14 30 29 22 7 5 11 6 5 15 14 29 14 22 10 7 10 12 20 11 14 11 17 16 9 11 43 8 6 5 10 29 8 29 28 18 12 12 7 8 10 11 12 13 10 6 4 10 18 15 19 15 16 19 14 7 32 5 14 5 11 23 15 9 7 7 11 11 6 16 6 6 8 16 8 9 7 9 23 15 7 5 14 27 20 7 25 12 9 17 16 9 16 5 4 10 9 5 6 14 38 19 10 30 5 13 13 10 6 10 6 12 15 14 30 32 9 10 15 26 17 21 14 15 11 5 13 10 14 4 6 4 5 7 6 10 12 5 6 12 6 3 4 6 1	Open. Hide. 23 20 19 35 23 19 18 22 23 36 61 49 59 49 59 59 59 45 59 61 59 59 59 52 59 61 59 59 49 61 59 59 59 59 59 44 55 59 59 59 59 59 52 59 59 59 49 52 59 35 35 52 52 59 59 59 61 59 59 49 61 59 59 59 59 59 59 52 49 59 59 61 59 59 59 59 59 59 59 59 59 59 59 59 59 59 52 59 59 59 59 59 59 61 61 61 59 59 61 61 55 61 59 59 52 61 61 59 61 59 61 61 61 61 61 55 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 45 59 59 55 44 55 59 61 61 61 59 59 55 55 55 55 59 59 59 61 61 59 59 59 59 59 59 59 59 52 61 61 59 59 59 61 59 59 61 61 59 55 59 61 61 59 61 59 61 59 59 61 59 61 59 61 59 59 59 59 61 61 61 61 61 59 61 61 59 61 59 59 61 61 59 61 61 59 52 61 52 59 59 59 59 59 59 61 59 59 59 59 59 59 59 59 61 59 59 59 61 59 59 61 61 59 61 61 59 59 59 52 61 61 59 59 61 59 61 61 55 55 61 55 61 61 55 55 55 61 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 55 61 61 52 55 55 55 55 61 61 61 61 55 61 61 61 61 61 61 61 55 55 55 61 55 55 55 50 50 50 50 55 50 43 55 55 55 55 55 50 50 50 50 50 49 50 50 50 49 50 50 50 55 61 55 61 55 55 55 53 50 50 50 61 50 61 50 50 50 50 50 50 50 50 50 50 50 47 50 61 61 61 61 53 52 53 61 53 53 61 50 61 61 53 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 57 57 47 47 53 57 57 57 52 53 57 57 57 57 57 57 57 47 57 57 53 53 57 57 53 53 57 57 53 53 57 57 53 53 53 57 57 53 57 50 57 53 57 57 57 57 57 57 57 53 52 51 57 57 57 57 57 47 41 37 32 57 50 57 47 53 53 52 13 17 12

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_6752396_6752960
seq2: B6Ng01-024E07.g_68_632 (reverse)

seq1  ACACACACACACCACAGACATACACACACACACCTCACACACTGAATGAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACACACACACCACAGACATACACACACACACCTCACACACTGAATGAA  50

seq1  TGAATGAATGAATGAATGAATAAATAAATAAATAAATTTAAGATTTTAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATGAATGAATGAATGAATAAATAAATAAATAAATTTAAGATTTTAAA  100

seq1  ATGTTTGTTTGTTTGGTTTGTGGGGATTTTTTGTTTTGGCCTTTTGGGGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTTGTTTGTTTGGTTTGTGGGGATTTTTTGTTTTGGCCTTTTGGGGA  150

seq1  GGTTTGTTTGTTTGTTTGTTGTTTGCTTTTCAGATAAGGTCTCAGGCTGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTGTTTGTTTGTTTGTTGTTTGCTTTTCAGATAAGGTCTCAGGCTGC  200

seq1  TCAAGAATGTAGTCAAGAATGACTTCCAACTCCTGCTCCTCCTGCTCCTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGAATGTAGTCAAGAATGACTTCCAACTCCTGCTCCTCCTGCTCCTC  250

seq1  CTTCTCAAGTGTGTGCAACCAACTCTGGCTTTCATGATGAAAATATTTCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTCAAGTGTGTGCAACCAACTCTGGCTTTCATGATGAAAATATTTCA  300

seq1  AATACAGGAGATAGAAATCAGTTCTACATATACAAGGCCCAGAGTTCAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATACAGGAGATAGAAATCAGTTCTACATATACAAGGCCCAGAGTTCAAT  350

seq1  CATGAGTACACAAAAAAGAATATATATATATATACATATATATGTGTGTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGAGTACACAAAAAAGAATATATATATATATACATATATATGTGTGTA  400

seq1  TGTATATGCATATATATATATACATATATATATTCCATTTTTAAACCATT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATATGCATATATATATATACATATATATATTCCATTTTTAAACCATT  450

seq1  GTTTCTGGAGGTAGAAAGACAGCTCAGTGGTTAAGAACATTTGTTGTCCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCTGGAGGTAGAAAGACAGCTCAGTGGTTAAGAACATTTGTTGTCCC  500

seq1  TACAGAGGACCAGGGTTAGATTCCCAGTACCTACATGATAGCTCATGGCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGAGGACCAGGGTTAGATTCCCAGTACCTACATGATAGCTCATGGCC  550

seq1  ATCTATCTGGAATTC  565
      |||||||||||||||
seq2  ATCTATCTGGAATTC  565

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information